RESUMEN
AIM To clone the Actin gene in Fritillaria thunbergii Miq.and to make bioinformatics analysis.METHODS The total mRNA in roots,stems,leaves,flowers and bulbs of F.thunbergii was extracted,and the degenerate primer was designed and synthesized.With total mRNA in leaves as a template,the conserved fragments of Actin gene was cloned by RT-PCR and Ta cloning technology.Using this gene as a reference gene,tissue specificity expression analysis was adopted in 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) gene.RESULTS One gene sequence (463 bp) was obtained by RT-PCR amplification and Ta cloning.The Actin gene in F.thunbergii showed high similarities to those in Lilium regale Wilson,Tulipa gesneriana,Ornithogalum caudatum Jacq.,Dendrobium officinale Kimura et Migo,Diospyros kaki Thunb.,Betula luminifera H.Winkl.and Zea mays L.(84％-98％),the homologies of its amino acid sequence to Drosera adelae F.Muell,Brassica napus L.,Vanilla peanigoeia Ancer,L.regale,Jatropha carcas L.,Lycium barbarum L.and Rhizophora stylosa amino acid sequences were all more than 89％,and the Actin protein had close genetic relationships with Lotus corniculatus L.,L.regale and T.gesneriana.The expressions of HMGR gene in various parts of this plant showed obvious differences,which was in sequence of bulbs ＞ flowers ＞ leaves ＞ stems ＞ roots.CONCLUSION It is the first time that Actin gene (named as FtActin) is coloned in F.thunbergii,which can lay the basis for its effective application.
RESUMEN
Objective: In order to provide a theoretical basis for clarifying the mechanism of synthesis of saponins during different induction formation period of Dioscorea bulbifera microtubers, squalene synthase (SQS) gene expression of D. bulbifera microtubers was analyzed in this paper. Methods: Using Actin gene as a reference gene, Real-time quantitative PCR (qRT-PCR) analysis technology was applied. The amplification curve and solubility curve of SQS (target gene) and Actin (reference gene) were successfully constructed by SYBR Green I after RNA was extracted from different formation period of D. bulbifera microtuber and cDNA was obtained by reverse transcription. Result: Quantitative results showed that: During the initial stage (18-36 d) of D. bulbifera microtuber formation, the expression level of SQS gene increased significantly. During the mid-term (36-72 d) of D. bulbifera microtuber formation, the expression level of SQS gene decreased significantly, and tended to be stable. During the later stage (72-90 d) of D. bulbifera microtuber formation, the expression level of SQS gene decreased significantly again. Conclusion: In general, in the process of D. bulbifera microtuber formation, the expression level of SQS gene shows the trend of "low-high-low-constant-low", which indicates that SQS is a key enzyme of saponin biosynthesis during the different induction formation period of D. bulbifera microtubers.
RESUMEN
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
RESUMEN
Objective: To clone the actin (ACT) gene of Eleutherococcus senticosus, and to make the gene a valuable internal gene. Methods: Part of the sequence of ACT gene was cloned by real-time PCR (RT-PCR), and the sequence was used as internal control gene for analyses of semiquantitative PCR and RT-PCR. Results: The ACT gene (1031 bp) of E. senticosus was cloned, coding 343 amino acids. To compare the amino acid sequence of E. senticosus ACT gene with those of Betula luminifera, Gossypium hirsutum, and Camellia sinensis, the amino acid homology was 99.42%, 98.83%, and 98.54%. The expression of ACT in different organs of E. senticosus during various growing periods was constant. The expression of ACT gene in different organs and during different growth and development stages was basically constant, and when the sequence acted as internal control gene, the semiquantative PCR and RT-PCR have good amplification effect and reproducibility. Conclusion: The ACT sequence in E. senticosus is firstly separated and reported, it could act as an internal control gene, and its reaction system of RT-PCR is established.
RESUMEN
An alpha actin gene segment, isolated from Nile tilapia (Oreochromis niloticus), was characterized by nucleotide sequencing, predicted amino acid sequence and Southern blot hybridization. Genomic DNA amplification resulted in a 1063-bp fragment corresponding to a partial alpha-cardiac muscle actin gene containing exons 3 to 6. Southern blot analysis of the restriction-digested DNA revealed that the Nile tilapia genome contains multiple muscle actin isoforms. Although comparison of the nucleotide sequence, amino acid residues and exon-intron organization of the isolated actin gene with those of other vertebrates showed a high level of identity, diagnostic amino acid residues can still be correlated to distinct actin genes in fish species.