RESUMEN
@#Objective To develop and verify a quantitative real-time PCR method for determination of the content of host cell DNA residues in severe acute respiratory symptom coronavirus 2(SARS-CoV-2) inactivated vaccine(Vero cells),in order to better control the safety of products.Methods DNA was extracted from inactivated SARS-CoV-2 vaccine(Vero cells) bulk by magnetic bead separation method,and the DNA residues of host cells were quantitatively analyzed by probetype PCR.The linear range,repeatability,intermediate precision,quantitative limit,specificity,durability and accuracy of the developed method were verified,and the host cell DNA re sidues of 5 batches of inactivated SARS-CoV-2 vaccine(Vero cells)were determined by this method.Results DNA standard curve showed good linearity in the range of 300～0.003 pg/μL(each R~2> 0.99);Relative standard deviations(RSD) of repeatability and intermediate precision verification were less than 20%;The quantitative limit was 0.001 pg/μL;Sample dilution and purified liquid dilution had no interference to detection;The results of 60 min incubation at 53,55,57 ℃ and 56,60,64 min incubation at 55 ℃ showed no significant difference;The recoveries of accuracy verification were 79%～83%,RSD <5%.This method had good adaptability in detecting DNA residues in the bulk of inactivated SARS-CoV-2 vaccine(Vero cells).Conclusion The quantitative realtime PCR method for determination of host cell DNA residues in inactivated SARS-CoV-2 vaccine(Vero cells) has been successfully developed,of which the linearity and range,repeatability,intermediate precision,quantitative limit,specificity,durability and accuracy meet the acceptable standards,and are suitable for the detection and quality control of host cell DNA residues in inactivated SARS-CoV-2 vaccine(Vero cells).
RESUMEN
OBJECTIVE: To validate a PCR-Taqman probe method for detection of residual DNA of NS0 host cells. METHODS: Multiple pairs of primers and probes were designed and synthesized for the NS0 genome repeat sequence, and the optimal primer probe combination was selected through experiments. Pretreatment kit (magnetic bead method) was used to enrich and purify the host cell DNA residue in the sample.According to the requirements of ICH and China Pharmacopoeia general principle No. 9101, validation of the detection method including linearity and range, accuracy,precision, specificity, quantitative limit and reference DNA calibration was carried out for self-developed residual CHO host cell DNA quantitation kit (PCR-Taqman probe).Using the intermediate product and drug substance of the monoclonal antibody process produced by NS0 cells, the test performance of the kit was verified, and five independent laboratories were organized to coordinate the calibration. RESULTS: NS0 cell DNA detection (Taqman method) forward primer sequence was CCCCTTCAGCTCCTTGGGTA, reverse primer sequence was GCCTGGCAAATACAGAAGTGG, and probe sequence was FAM-AGGGCCCCCAATGGAGGAGCT-TAMRA. The standard curve of DNA was in the range of 3 fg•μL-1 to 300 pg•μL-1 with good linearity (r2>0. 99). The deviation of the mean from the true value was less than 15% at six different concentrations. The quantitative limit was 3 fg•μL-1.The DNA calibration result of the internal reference sample was 30 μg•mL-1. Good precision (RSD≤30%) was obtained. The q-PCR method was specific for CHO DNA, which showed no responses to the DNA of E. coli, human genome DNA(kidney epithelium 293T cells), and CHO genome DNA(Chinese hamster ovary cells). In addition, the detection recovery rate was in the range of 70% to 130% with RSD less than 15% for the intermediate products and drug substance in the production process. The RSD of the five collaborative laboratories was less than 30%. CONCLUSION: The self-developed residual NS0 host cell DNA quantitation kit (PCR-Taqman probe) has good specificity, sensitivity and accuracy, and can meet the requirements of host DNA residue detection.
RESUMEN
Objective To reduce the residual proteins and DNA of host cells in the preparation of H5N1 influenza A virus. Methods Core 700 was firstly used to remove residual host cell proteins, and then Capto Q was used to remove host cell DNA. Several batches of H5N1 influenza A virus cultured in Ma-din-Darby canine kidney ( MDCK) cells were purified using this method. The efficiency of purification was evaluated using many methods including quantitative real-time PCR, hemagglutination ( HA) test and single radial immunodiffusion assay. Moreover, Benzonase nuclease was used for comparison. Results Without the use of Benzonase nuclease, the overall removal rates of host cell DNA and residual proteins were 99. 62％ and 98. 1％, and the HA antigen recovery rate was 66. 96％. Conclusions This study established a purification strategy with good effect for cell-based influenza vaccines. It can efficiently remove host cell DNA and proteins and achieve a high HA recovery rate. The purification result is no worse than that of adding Benzonase nuclease, suggesting the potential of its application in actual vaccine production.
RESUMEN
Objective@#To reduce the residual proteins and DNA of host cells in the preparation of H5N1 influenza A virus.@*Methods@#Core 700 was firstly used to remove residual host cell proteins, and then Capto Q was used to remove host cell DNA. Several batches of H5N1 influenza A virus cultured in Madin-Darby canine kidney (MDCK) cells were purified using this method. The efficiency of purification was evaluated using many methods including quantitative real-time PCR, hemagglutination (HA) test and single radial immunodiffusion assay. Moreover, Benzonase nuclease was used for comparison.@*Results@#Without the use of Benzonase nuclease, the overall removal rates of host cell DNA and residual proteins were 99.62% and 98.1%, and the HA antigen recovery rate was 66.96%.@*Conclusions@#This study established a purification strategy with good effect for cell-based influenza vaccines. It can efficiently remove host cell DNA and proteins and achieve a high HA recovery rate. The purification result is no worse than that of adding Benzonase nuclease, suggesting the potential of its application in actual vaccine production.