Clinical features and genetic analysis of a patient with type 2 neurofibromatosis manifested as oculomotor nerve palsy / 中华医学遗传学杂志

OBJECTIVE@#To report on a rare case of Neurofibromatosis type 2 (NF2) manifesting as oculomotor nerve palsy and explore its genetic basis.@*METHODS@#A patient with NF2 who had presented at Beijing Ditan Hospital Affiliated to Capital Medical University on July 10, 2021 was selected as the study subject. Cranial and spinal cord magnetic resonance imaging (MRI) was carried out on the patient and his parents. Peripheral blood samples were collected and subjected to whole exome sequencing. Candidate variant was verified by Sanger sequencing.@*RESULTS@#MRI revealed bilateral vestibular Schwannomas, bilateral cavernous sinus meningiomas, popliteal neurogenic tumors, and multiple subcutaneous nodules in the patient. DNA sequencing revealed that he has harbored a de novo nonsense variant of the NF2 gene, namely c.757A>T, which has replaced a codon (AAG) encoding lysine (K) at position 253 with a stop codon (TAG). This has resulted in removal of the Merlin protein encoded by the NF2 gene from position 253 onwards. The variant was not found in public databases. Bioinformatic analysis suggested that the corresponding amino acid is highly conserved. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was rated as pathogenic (PVS1+PS2+PM2_Supporting+PP3+PP4).@*CONCLUSION@#The heterozygous nonsense variant c.757A>T (p.K253*) of the NF2 gene probably underlay the disease in this patient with an early onset, atypical but severe phenotype.

Expression of NF2 Modulates the Progression of BRAFV600E Mutated Thyroid Cancer Cells

BACKGROUND: We previously reported the frequent neurofibromatosis 2 (NF2) gene mutations in anaplastic thyroid cancers in association with the BRAF V600E mutation. We aimed to investigate the role of NF2 in thyroid cancer with BRAF mutation. METHODS: To identify the function of NF2 in thyroid cancers, we investigated the changes in cell proliferation, colon formation, migration and invasion of thyroid cancer cells (8505C, BHT101, and KTC-1) with BRAF V600E mutation after overexpression and knock-down of NF2. We also examined how cell proliferation changed when NF2 was mutagenized. Human NF2 expression in papillary thyroid carcinoma (PTC) was analyzed using the The Cancer Genome Atlas (TCGA) data. RESULTS: First, NF2 was overexpressed in 8505C and KTC-1 cells. Compared to control, NF2 overexpressed group of both thyroid cancer cells showed significant inhibition in cell proliferation and colony formation. These results were also confirmed by cell migration and invasion assay. After knock-down of NF2 in 8505C cells, there were no significant changes in cell proliferation and colony formation, compared with the control group. However, after mutagenized S288* and Q470* sites of NF2 gene, the cell proliferation increased compared to NF2 overexpression group. In the analysis of TCGA data, the mRNA expression of NF2 was significantly decreased in PTCs with lateral cervical lymph node (LN) metastasis compared with PTCs without LN metastasis. CONCLUSION: Our study suggests that NF2 might play a role as a tumor suppressor in thyroid cancer with BRAF mutation. More studies are needed to elucidate the mechanism how NF2 acts in thyroid cancer with BRAF mutation.

Genetic and clinical characteristics of Korean patients with neurofibromatosis type 2

PURPOSE: Neurofibromatosis type 2 (NF2) is characterized by multiple tumors, including vestibular schwannoma (VS) and others affecting cranial and peripheral nerves. NF2 is caused by mutation of the NF2 gene. The mutation spectrum of NF2 has not been characterized in Korean patients. In the current study, the clinical and genetic characteristics of Korean NF2 patients were analyzed. MATERIALS AND METHODS: Twenty-five unrelated Korean families were enrolled according to the Manchester criteria. Genetic analysis was performed by direct sequencing and multiplex ligation-dependent probe amplification methods using genomic DNA from peripheral lymphocytes or tumor tissues. RESULTS: All patients had bilateral/unilateral VS and/or other cranial and peripheral nerve tumors. Two patients were familial cases and the other 24 patients were sporadic. Germline NF2 mutations were detected in peripheral lymphocytes from both familial cases, but only in 26.1% of the 23 sporadic families. Somatic mutations were also found in tumor tissues from two of the sporadic families. These somatic mutations were not found in peripheral lymphocytes. A total of 10 different mutations including 2 novel mutations were found in 40.0% of studied families. Five mutations (50.0%) were located in exon 6 of NF2, the FERM domain coding region. CONCLUSION: Family history was an important factor in identifying germline NF2 mutations. Further study is required to investigate whether exon 6 is a mutation hotspot in Korean NF2 patients and its correlation to phenotypic severity.

Analysis of NF2 gene mutations in intraspinal Schwannomas / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.</p><p><b>METHODS</b>Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.</p><p><b>RESULTS</b>Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.</p><p><b>CONCLUSION</b>The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.</p>

Expression of Merlin protein in non-small cell lung carcinoma and the clinical significance / 中南大学学报(医学版)

OBJECTIVE@#To determine the expression and clinical significance of Merlin protein in non-small cell lung cancer (NSCLC).@*METHODS@#The expression of Merlin protein in 45 cases of NSCLC and adjacent tissue of NSCLC and normal lung tissue was checked by immunohistochemistry. The relation between the expression of Merlin protein and the multiple factors of pathological type, gender, P-TNM stage, differentiation and lymph node metastasis was analyzed.@*RESULTS@#The expression rates of Merlin protein in NSCLC and normal lung tissue sections were 73.33% and 15.56%, respectively (P0.05).@*CONCLUSION@#Merlin protein might contribute to the initiation of metastasis of NSCLC.

Merlin; NF2 Tumor Suppressor and Regulator of Receptor Distribution/Signaling / 대한이비인후과학회지

Acoustic tumor is the most common tumor originating from cerebellopontine angle. Acoustic tumor is benign and main origin of this tumor is vestibular nerve. This tumor arises in Schwann cell (SC) and is encapsulated. Recently, the tumor is called vestibular schwannoma (VS). VS is classified to two type by epidemiology, sporadic form and neurofibromatosis type 2 (NF2). NF2 is autosomal dominant inherent disorder. This tumor is characterized bilateral VS, brain tumors such as meningioma and ependymoma, and spinal or cranial nerve schwannoma. Genetic studies suggested that NF2 is caused by abnormality or mutation of NF2 gene in chromosome 22q12. Both of them are known to develop the tumor by mutation of NF2 gene. Merlin is the cytoskeletal protein product of the NF2 tumor suppressor gene that mediates cell to cell contact information to regulate SC proliferation and survival. And merlin is highly homologous to ERM proteins. Merlin function is regulated by its conformation, adopting an inactive, growth permissive state following serine 518 (S518) phosphorylation. In NF2 patients, the precise mechanisms of developing the VS are unclear. But, the abnormalities of merlin are confirmed by many studies. And now, a lot of research about merlin function is progressing. In this study, the author would introduce about merlin (structure, function, molecular pathway, tumorigenesis and regulation) which leads to VS and molecular studies about merlin, and suggest the future direction of research.

Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations / 대한진단검사의학회지

BACKGROUND: Neurofibromatosis type 2 (NF2) is an autosomal dominant syndrome caused by the NF2 tumor suppressor gene. However, the NF2 mutation characteristics in Korean patients are not sufficiently understood. In this study, we conducted a comprehensive mutational analysis in 7 Korean NF2 patients by performing direct sequencing and gene-dosage assessment. METHODS: We analyzed all exons and flanking regions of NF2 by direct sequencing and screened the deletions or duplications involving NF2 by multiplex ligation-dependent probe amplification. RESULTS: Four novel NF2 mutations, including 2 splice-site mutations (c.364-1G>A and c.886-3C>G), 1 frameshift mutation (c.524delA), and 1 missense mutation (c.397T>C; p.Cys133Arg), were identified in our patients. No large deletion or duplication was identified in our series. Subsequently, we identified an abnormal splicing product by using reverse transcription-PCR and direct sequencing in 2 patients with a novel splice-site mutation. The missense mutation c.397T>C was predicted to have harmful effects on protein function. CONCLUSIONS: The detection rate of NF2 mutations in Korean patients (57%) is similar to those in other populations. Our results provided a greater insight into the mutational spectrum of the NF2 gene in Korean subjects.

Expression of S518 phosphorylated Merlin and its interaction with CD44 in vestibular schwannoma / 中华耳鼻咽喉头颈外科杂志

<p><b>OBJECTIVE</b>To investigate the impact of S518 phosphorylation in Merlin on the interaction with CD44 in vestibular schwannoma and the tumor growth.</p><p><b>METHODS</b>Thirty-five samples of vestibular schwannoma were identified by pathology. Immunohistopathology and western blot were employed to analyze the expression and localization of S518 phosphorylated Merlin in the tumor tissues. Nerve tissues that were collected during other surgical operation were used as control. The expression level of S518 phosphorylated Merlin was compared with clinical stages, tumor size, clinical course and cystic degeneration. Immunoprecipitation was used to evaluate the impact of S518 phosphorylation in Merlin on the interaction with CD44.</p><p><b>RESULTS</b>In vestibular schwannoma, Merlin was phosphorylated at S518 and demonstrated perinuclear localization. The S518 phosphorylation level was much lower in the normal control nerve tissues than that in vestibular schwannoma tissues. There was no correlation between the phosphorylation level on Merlin and clinical stages, tumor size, clinical course and cystic degeneration. The S518 phosphorylated Merlin bound CD44 was higher than wild-type Merlin bound CD44 in vestibular schwannoma tissues.</p><p><b>CONCLUSIONS</b>The affinity of Merlin to CD44 was increased after phosphorylation at S518. Different cellular biological results might be triggered through binding to wild type Merlin and S518 phosphorylated Merlin.</p>

Intraneural Perineurioma in the Tongue: A Case Report

We report a case of an intraneural perineurioma that developed in an unusual location, the tongue. A 16-year-old male presented with a 1 cm sized protruding submucosal mass in his tongue without any sensory or motor signs or symptoms. The mass was excised. The mucosa was intact, with an ill-defined firm mass measuring 1.0 x 0.8 x 0.6 cm in the submucosa and muscle. The cut surface of the mass was pinkish gray and fibrotic. Microscopically, the mass contained tortuous and thickened peripheral nerve bundles in the submucosa, showing onion bulb like structures. The onion bulb like structures consisted of centrally located S-100 protein positive Schwann cells surrounded by Glut-1 positive perineurial cells. The FISH study did not reveal any genetic aberrations in chromosome 22.

Loss of heterozygosity on chromosome 22 in sporadic schwannoma and its relation to the proliferation of tumor cells / 中华医学杂志(英文版)

<p><b>BACKGROUND</b>Schwannoma is the tumor arising mainly from the cranial and spinal nerves. Bilateral vestibular schwannoma is the hallmark of neurofibromatosis type 2 (NF2). The NF2 gene has been cloned with comprehensive analysis of its mutations in schwannoma. However, most studies focused on vestibular schwannoma. There are differences in proliferation of tumor cell and ultrastructure between vestibular and spinal schwannomas. It is unknown whether genetic alterations in vestibular schwannoma are different from those in non-vestibular schwannoma. We analyzed the loss of heterozygosity (LOH) on chromosome 22 in patients with sporadic schwannoma including vestibular and spinal schwannomas and correlated this genetic alteration with tumor proliferation.</p><p><b>METHODS</b>In 54 unrelated patients without clinical NF1 or NF2, 36 patients had sporadic vestibular schwannoma, and 18 dorsal spinal root schwannoma. Four highly polymorphic linkage to NF2 gene microsatellite DNA markers (D22S264, D22S268, D22S280, CRYB2) were used to analyze LOH. The proliferative index was evaluated by Ki-67 and proliferative cell nuclear antigen (PCNA) immunostaining. Student's t test was used to analyze the difference of the proliferative index between schwannoma with LOH and that without LOH. The difference of the frequency of LOH in vestibular and spinal schwannomas was investigated by the chi-square test.</p><p><b>RESULTS</b>Twenty-three schwannomas (42.6%, 23/54) showed allele loss. The frequency of LOH in vestibular schwannoma was significantly higher than that in spinal schwannoma (chi2 = 5.14, P < 0.05). The proliferative index of schwannoma with LOH was significantly higher than that without LOH (tki-67 = 2.97, P = 0.0045; tPCNA = 2.93, P = 0.0051).</p><p><b>CONCLUSIONS</b>LOH on chromosome 22 is a frequent event in the tumorigenesis of sporadic schwannoma. And, there is a correlation between LOH on chromosome 22 and proliferative activity in schwannoma. The frequency of LOH in vestibular schwannoma is significantly different from that in spinal schwannoma.</p>

Neurofibromatosis: a propósito de un caso / Neurofibromatosis: a proposal of a case

La neurofibromatosis (NF) forma parte de los síndromes neurocutáneos que presentan manifestaciones clínicas multisistémicas. Se describen ocho entidades, de las cuales las más frecuentes (98 por ciento-99 por ciento) corresponden a la NF tipo I y II, ambas enfermedades de herencia autosómica dominante, localizadas en los cromosomas 17 y 22, respectivamente. Específicamente, la NF tipo I se caracteriza por la presencia de manchas café con leche, seudoefélides inguinales y axilares, schwannomas y neurofibromas plexiformes. Además, se asocia compromiso de tipo neurológico (50 por ciento), con retraso del desarrollo psicomotor (10 por ciento-20 por ciento) y convulsiones (8 por ciento-13 por ciento) y compromiso óseo (50 por ciento), con escoliosis (20 por ciento), talla baja (10 por ciento) y pseudoartrosis (8 por ciento). A modo de ejemplo se describe el caso de un paciente portador de NF tipo I que presentó un neurofibroma plexiforme, cuyo diagnóstico diferencial era neurofibrosarcoma, el cual presentó una evolución benigna satisfactoria

Neurofibromatose (Síndrome de Von Recklinghausen): 3 Genética e NF2 / Neurofibromatosis (Von Recklinghausen Syndrome): 3 Genética e NF2

Neste terceiro capítulo da revisão bibliográfica sobre a síndrome de Von Recklinghausen (neurofibromatose), uma desordem genética que acomete um em cerca de 3 mil nascimentos quando do tipo 1 e uma em cada 50 mil pessoas no tipo 2, a temática será sobre genética e NF2

Neurofibromatose associada artéria trigeminal primitiva e aneurisma intracraniano / Neurofibromatosis associated to primitive trigeminal artery and intracranial aneurysm

Atualmente neurofibromatose faz parte de um grupo de doenças heterogêneas. A neurofibromatose NF-1 é a mais comum das facomatoses ocorrendo em aproximadamente 90 por cento dos casos. A anomalia anastomótica mais comum entre as áreas supridas pela artéria carótida e a artéria vertebral é uma artéria de grosso calibre que se localiza ao nível do seio cavernoso. Esta comunicaçäo vascular na opiniäo de muitos pesquisadores é a primitiva artéria trigeminal. É apresentada uma paciente com neurofibromatose tipo NF-1 periférico que apresentou uma cefaléia explosiva seguida de agitaçäo psicomotora. A punçäo lombar revelou-se hemorrágica e o estudo angiográfico revelou um aneurisma de artéria carótida interna direita e uma larga comunicaçäo entre os sistemas carótido-basilar ao nível do seio cavernoso

Germline Mutations of the NF2 Gene in Korean Neurofibromatosis 2 Patient / 대한암학회지

PURPOSE: Neurofibromatosis 2(NF2) is an autosomal dominant disease characterized by development of bilateral acoustic neuroma and various central nervous system tumors such as meningiomas, ependymomas, and schwannomas. Recent cloning of the gene responsible for NF2, the NF2 gene, permits the presymptomatic genetic diagnosis of affected individuals by direct analysis of the gene. This paper was intended to identify germline mutations in Korean NF2 patients. MATERIALS AND METHODS: We collected blood samples from 15 clinically diagnosed NF2 patients treated at the Department of Neurosurgery, Seoul National University Hospital. Purified genomic DNA samples were analyzed for mutations of the NF2 gene by using polymerase chain reaction(PCR)-single strand conformation polymorphism(SSCP) method followed by direct DNA sequencing. RESULTS: We were able to identify germline mutation of the NF2 gene in one patient. The mutation identified was 1 base pair deletion(A) at codon 318, resulting in premature stop codon due to frameshift. CONCLUSION: Identification of the germline mutation in NF2 gene should enable us to test all individual family members at risk to determine whether or not they carry the mutant NF2 gene.