Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 131
Filtrar
1.
Braz. j. biol ; 83: e243910, 2023. tab, graf
Artículo en Inglés | LILACS, VETINDEX | ID: biblio-1278525

RESUMEN

Abstract Nucleotide excision repair (NER) acts repairing damages in DNA, such as lesions caused by cisplatin. Xeroderma Pigmentosum complementation group C (XPC) protein is involved in recognition of global genome DNA damages during NER (GG-NER) and it has been studied in different organisms due to its importance in other cellular processes. In this work, we studied NER proteins in Trypanosoma cruzi and Trypanosoma evansi, parasites of humans and animals respectively. We performed three-dimensional models of XPC proteins from T. cruzi and T. evansi and observed few structural differences between these proteins. In our tests, insertion of XPC gene from T. evansi (TevXPC) in T. cruzi resulted in slower cell growth under normal conditions. After cisplatin treatment, T. cruzi overexpressing its own XPC gene (TcXPC) was able to recover cell division rates faster than T. cruzi expressing TevXPC gene. Based on these tests, it is suggested that TevXPC (being an exogenous protein in T. cruzi) interferes negatively in cellular processes where TcXPC (the endogenous protein) is involved. This probably occurred due interaction of TevXPC with some endogenous molecules or proteins from T.cruzi but incapacity of interaction with others. This reinforces the importance of correctly XPC functioning within the cell.


Resumo O reparo por excisão de nucleotídeos (NER) atua reparando danos no DNA, como lesões causadas por cisplatina. A proteína Xeroderma Pigmentosum complementation group C (XPC) está envolvida no reconhecimento de danos pela via de reparação global do genoma pelo NER (GG-NER) e tem sido estudada em diferentes organismos devido à sua importância em outros processos celulares. Neste trabalho, estudamos proteínas do NER em Trypanosoma cruzi e Trypanosoma evansi, parasitos de humanos e animais, respectivamente. Modelos tridimensionais das proteínas XPC de T. cruzi e T. evansi foram feitos e observou-se poucas diferenças estruturais entre estas proteínas. Durante testes, a inserção do gene XPC de T. evansi (TevXPC) em T. cruzi resultou em crescimento celular mais lento em condições normais. Após o tratamento com cisplatina, T. cruzi superexpressando seu próprio gene XPC (TcXPC) foi capaz de recuperar as taxas de divisão celular mais rapidamente do que T. cruzi expressando o gene TevXPC. Com base nesses testes, sugere-se que TevXPC (sendo uma proteína exógena em T. cruzi) interfere negativamente nos processos celulares em que TcXPC (a proteína endógena) está envolvida. Isso provavelmente ocorreu pois TevXPC é capaz de interagir com algumas moléculas ou proteínas endógenas de T.cruzi, mas é incapaz de interagir com outras. Isso reforça a importância do correto funcionamento de XPC dentro da célula.


Asunto(s)
Humanos , Animales , Trypanosoma cruzi/genética , Xerodermia Pigmentosa , Daño del ADN/genética , Biología Computacional , Proteínas de Unión al ADN/genética , Proteínas de Unión al ADN/metabolismo , Reparación del ADN/genética
2.
Chinese Journal of Biotechnology ; (12): 359-371, 2023.
Artículo en Chino | WPRIM | ID: wpr-970380

RESUMEN

This study aims to develop an improved cell screening system for farnesoid X receptor (FXR) agonists based on a dual luciferase reporter gene system. FXR response element (FXRE) fragments from FXR target genes were cloned and inserted into upstream of firefly luciferase (Luc) gene in the plasmid pGL4-luc2P-Hygro. In combination with the internal reference plasmid containing renilla luciferase, a dual luciferase reporter gene system was developed and used for high throughput screening of FXR agonists. After studying the effects of over-expression of RXR, mouse or human FXR, various FXRE fragments, and different ratio of FXR plasmid amount to reporter gene plasmid, induction efficiency of the screening system was optimized by the known FXR agonist GW4064, and Z factor for the system reached 0.83 under optimized conditions. In summary, an improved cell screening system based on double luciferase reporter gene detection system was developed to facilitate the discovery of FXR agonists, where a new enhanced FXRE element was formed by a superposition of multiple FXRE fragments from FXR target genes, instead of a superposition of traditional IR-1 (inverted repeats-1) fragments.


Asunto(s)
Humanos , Ratones , Animales , Factores de Transcripción/genética , Proteínas de Unión al ADN/genética , Receptores Citoplasmáticos y Nucleares/genética , Genes Reporteros , Luciferasas/genética
3.
Journal of Experimental Hematology ; (6): 333-337, 2023.
Artículo en Chino | WPRIM | ID: wpr-982063

RESUMEN

OBJECTIVE@#To investigate the correlation between single-nucleotide polymorphism (SNP) of ARID5B gene and resistance to methotrexate (MTX) in children with acute lymphoblastic leukemia (ALL).@*METHODS@#A total of 144 children with ALL who were treated in General Hospital of Ningxia Medical University from January 2015 to November 2021 were enrolled and divided into MTX resistant group and non-MTX resistant group, with 72 cases in each group. Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) technology was used to measure the SNP of ARID5B gene in all children and analyze its correlation with MTX resistant.@*RESULTS@#There were no significant differences in the genotype and gene frequency of rs7923074, rs10821936, rs6479778, and rs2893881 between MTX resistant group and non-MTX resistant group (P>0.05). The frequency of C/C genotype in the MTX resistant group was significantly higher than that in the non-MTX resistant group, while the frequency of T/T genotype was opposite (P<0.05). The frequency of C allele in the MTX resistant group was significantly higher than that in the non-MTX resistant group, while the frequency of T allele was opposite (P<0.05). Multivariate logistic regression analysis showed that ARID5B gene rs4948488 TT genotype and T allele frequency were risk factors for MTX resistant in ALL children (P<0.05).@*CONCLUSION@#The SNP of ARID5B gene is associated with MTX resistant in ALL children.


Asunto(s)
Niño , Humanos , Proteínas de Unión al ADN/genética , Frecuencia de los Genes , Genotipo , Metotrexato , Polimorfismo de Nucleótido Simple , Leucemia-Linfoma Linfoblástico de Células Precursoras/genética , Factores de Transcripción/genética , Resistencia a Antineoplásicos
4.
Chinese Journal of Medical Genetics ; (6): 847-850, 2023.
Artículo en Chino | WPRIM | ID: wpr-981834

RESUMEN

OBJECTIVE@#To explore the clinical feature and genetic etiology of a patient with normosmic idiopathic hypogonadotropic hypogonadism (nIHH) due to variant of CHD7 gene.@*METHODS@#A patient who had presented at Anhui Provincial Children's Hospital in October 2022 was selected as the study subject. Clinical data of the patient was collected. The patient and his parents were subjected to trio-whole exome sequencing. Candidate variant was verified by Sanger sequencing and bioinformatic analysis.@*RESULTS@#The patient had featured delayed development of secondary sexual characteristics but normal olfactory function. Genetic testing revealed that he has harbored a c.3052C>T (p.Pro1018Ser) missense variant of the CHD7 gene, for which both of his parents were of the wild type. The variant has not been recorded in the PubMed and HGMD databases. Analysis of amino acid sequences suggested that the variant site is highly conserved, and the variant may affect the stability of protein structure. Based on the guidelines from the American College of Medical Genetics and Genomics, the c.3032C>T variant was classified as a likely pathogenic (PS2+PM2_Supporting+PP2+PP3+PP4).@*CONCLUSION@#The delayed development of secondary sexual characteristics of the patient may be attributed to the c.3052C>T (p.Pro1018Ser) variant of the CHD7 gene. Above finding has expanded the variation spectrum of the CHD7 gene.


Asunto(s)
Niño , Humanos , Masculino , Secuencia de Aminoácidos , Biología Computacional , ADN Helicasas/genética , Proteínas de Unión al ADN/genética , Pruebas Genéticas , Genómica , Hipogonadismo/genética , Mutación
5.
Acta Academiae Medicinae Sinicae ; (6): 422-428, 2023.
Artículo en Chino | WPRIM | ID: wpr-981286

RESUMEN

Objective To study the pathological types,expression of mismatch repair protein,human epidermal growth factor receptor 2(HER2),and Pan-TRK,and Epstein-Barr virus(EBV)infection in patients with colorectal cancer resected in Tibet. Methods A total of 79 patients with colorectal cancer resected in Tibet Autonomous Region People's Hospital from December 2013 to July 2021 were enrolled in this study.The clinical and pathological data of the patients were collected.The expression of mismatch repair protein,HER2,and Pan-TRK was detected by immunohistochemical(IHC)staining,and detection of HER2 gene by fluorescence in situ hybridization(FISH)in the patients with HER2 IHC results of 2+ or above.EBV was detected by in situ hybridization with EBV-encoded small RNA. Results A total of 79 colorectal cancer patients were included in this study,with the male-to-female ratio of 1.26:1 and the mean age of(57.06±12.74)years(24-83 years).Among them,4 patients received preoperative neoadjuvant therapy.Colonic cancer and rectal cancer occurred in 57(57/79,72.15%,including 31 and 26 in the right colon and left colon,respectively)and 22(22/79,27.85%)patients,respectively.The maximum diameter of tumor varied within the range of 1-20 cm,with the mean of(6.61±3.33)cm.Among the 79 colorectal cancer patients,75(75/79,94.94%)patients showed adenocarcinoma.Lymph node metastasis occurred in 12(12/21,57.14%)out of the 21 patients with severe tumor budding,13(13/23,56.52%)out of the 23 patients with moderate tumor budding,and 2(2/31,6.45%)out of the 31 patients with mild tumor budding,respectively.The lymph node metastasis rate showed differences between the patients with severe/moderate tumor budding and the patients with mild tumor budding(all P<0.001).The IHC staining showed that mismatch repair protein was negative in 10(10/65,15.38%)patients,including 5 patients with both MSH2 and MSH6 negative,4 patients with both MLH1 and PMS2 negative,and 1 patient with MSH6 negative.Pan-TRK was negative in 65 patients.The IHC results of HER2 showed 0 or 1+ in 60 patients and 2+ in 5 patients.FISH showed no positive signal in the 5 patients with HER2 IHC results of 2+.The detection with EBV-encoded small RNA showed positive result in 1(1/65,1.54%)patient. Conclusions Non-specific adenocarcinoma of the right colon is the most common in the patients with colorectal cancer resected in Tibet,and 15% of the patients showed mismatch repair protein defects.EBV-associated colorectal carcer is rare,Pan-TRK expression and HER2 gene amplification are seldom.The colorectal cancer patients with moderate and severe tumor budding are more likely to have lymph node metastasis.


Asunto(s)
Adulto , Anciano , Femenino , Humanos , Masculino , Persona de Mediana Edad , Adulto Joven , Anciano de 80 o más Años , Adenocarcinoma , Biomarcadores de Tumor/genética , Neoplasias Colorrectales/patología , Reparación de la Incompatibilidad de ADN , Proteínas de Unión al ADN/genética , Infecciones por Virus de Epstein-Barr/diagnóstico , Herpesvirus Humano 4/metabolismo , Hibridación Fluorescente in Situ , Metástasis Linfática , Tibet
6.
Chinese Journal of Medical Genetics ; (6): 397-400, 2022.
Artículo en Chino | WPRIM | ID: wpr-928427

RESUMEN

OBJECTIVE@#To analyze the clinical and genetic characteristics of a child featuring Xia-Gibbs syndrome.@*METHODS@#Whole exome sequencing was carried out for the child.@*RESULTS@#The patient has presented with developmental delay, hypotonia, strabismus and snoring. Cranial MRI revealed hypomyelination, while the EEGs were normal. Genetic testing revealed a de novo variant of the AHDC1 gene, namely c.730delA (p.Ile244Serfs*16), which was classified as pathogenic (PVS1+PS2+PM2). Together with 60 cases from the literature, individuals harboring a AHDC1 variant commonly have delayed motor milestones, speech delay, facial dysmorphism and hypotonia. Dysgenesis of corpus callosum is also common. In total 47 AHDC1 variants have been reported, among which truncating variants were the most common type.@*CONCLUSION@#The c.730delA (p.Ile244Serfs*16) variant of the AHDC1 gene probably underlay the Xia-Gibbs syndrome in this patient. Above finding has provided a basis for the clinical diagnosis.


Asunto(s)
Niño , Humanos , Anomalías Múltiples/genética , Proteínas de Unión al ADN/genética , Discapacidad Intelectual/genética , Hipotonía Muscular , Mutación , Secuenciación del Exoma
7.
Chinese Journal of Medical Genetics ; (6): 387-391, 2022.
Artículo en Chino | WPRIM | ID: wpr-928425

RESUMEN

OBJECTIVE@#To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.@*METHODS@#The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.@*RESULTS@#Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.@*CONCLUSION@#The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.


Asunto(s)
Humanos , Síndrome CHARGE/genética , ADN Helicasas/genética , Proteínas de Unión al ADN/genética , Pruebas Genéticas , Heterocigoto , Mutación , Fenotipo , Secuenciación del Exoma
8.
Chinese Journal of Medical Genetics ; (6): 282-285, 2022.
Artículo en Chino | WPRIM | ID: wpr-928402

RESUMEN

OBJECTIVE@#To explore the genetic basis for two Chinese pedigrees affected with Coffin-Siris syndrome (CSS).@*METHODS@#Whole exome sequencing (WES) was carried out for the probands. Candidate variants were verified by Sanger sequencing of the probands and their family members.@*RESULTS@#The two probands were respectively found to harbor a heterozygous c.5467delG (p.Gly1823fs) variant and a heterozygous c.5584delA (p.Lys1862fs) variant of the ARID1B gene, which were both of de novo in origin and unreported previously. Based on the guidelines of American College of Medical Genetics and Genomics, both variants were predicted to be pathogenic (PVS1+PS2+PM2).@*CONCLUSION@#The c.5467delG (p.Gly1823fs) and c.5545delA (p.Lys1849fs) variants of the ARID1B genes probably underlay the CSS in the two probands. Above results have enabled genetic counselling and prenatal diagnosis for the pedigrees.


Asunto(s)
Humanos , Anomalías Múltiples , China , Proteínas de Unión al ADN/genética , Cara/anomalías , Deformidades Congénitas de la Mano , Discapacidad Intelectual , Micrognatismo , Cuello/anomalías , Linaje , Factores de Transcripción/genética
9.
Chinese Journal of Hematology ; (12): 241-246, 2022.
Artículo en Chino | WPRIM | ID: wpr-929564

RESUMEN

Objective: This study aimed to investigate the clinical and prognostic significance of TET2 single nucleotide polymorphism I1762V in patients with acute myeloid leukemia (AML) . Methods: The high-throughput sequencing method was used to sequence 58 hematological tumor-related genes in bone marrow samples from 413 patients with AML. TET2 I1762V and other somatic mutations were annotated and compared with patients' clinical information and prognosis. Results: I1762V was found in 154 patients with AML, which was significantly different from the general population in NyuWa Chinese Population Variant Database (χ(2)=72.4, P<0.001) . I1762V was not related to sex, age, and karyotype of patients with AML (P>0.05) . Patients with I1762V had a significantly higher proportion of NPM1 and KIT gene mutations than others (P<0.001) . NPM1 and KIT mutations were mutually exclusive. The survival analysis results revealed that the overall survival (OS) and progression-free survival (PFS) of patients with AML with I1762V were significantly greater than those of wild-type patients (HR=0.57, P=0.030; HR=0.55, P=0.020) , whereas the OS and PFS in patients with AML with DNMT3A mutation (with or without I1762V mutation) were lower than those of wild-type patients (HR=1.79, P=0.030; HR=1.74, P=0.040) . Conclusion: TET2 SNP I1762V has been linked to AML. I1762V is a prognostic factor of patients with AML, which can be used to guide the treatment and evaluate the prognosis of AML.


Asunto(s)
Humanos , Proteínas de Unión al ADN/genética , Dioxigenasas/genética , Leucemia Mieloide Aguda/genética , Mutación , Proteínas Nucleares/genética , Polimorfismo de Nucleótido Simple , Pronóstico
10.
Chinese Journal of Pediatrics ; (12): 345-349, 2022.
Artículo en Chino | WPRIM | ID: wpr-935699

RESUMEN

Objective: To summarize the phenotypes of epilepsy in patients with MBD5 gene variants. Methods: A total of 9 epileptic patients, who were treated in the Department of Pediatrics, Peking University First Hospital from July 2016 to September 2021 and detected with MBD5 gene pathogenic variants, were enrolled. The features of clinical manifestations, electroencephalogram (EEG), and neuroimaging were analyzed retrospectively. Results: Among 9 patients, 6 were male and 3 were female. Age at seizure onset ranged from 5 to 89 months. Multiple seizure types were observed, including generalized tonic clonic seizures (GTCS) in 7 patients, myoclonic seizures in 5 patients, focal seizures in 5 patients, atypical absence seizures in 3 patients, atonic seizures in 2 patients, myoclonus absence seizures in 1 patient, epileptic spasms in 1 patient, and tonic seizures in 1 patient. There were 8 patients with multiple seizure types, 2 patients with sensitivity to fever and 5 patients with clustering of seizures. Two patients had a history of status epilepticus. All patients had developmental delay before seizure onset. Nine patients had obvious language delay, and 6 patients had autism-like manifestations. Five patients had slow background activity in EEG. Interictal EEG showed abnormal discharges in 9 patients. Brain magnetic resonance imaging (MRI) was normal in all patients. A total of 9 epileptic patients carried MBD5 gene variants, all of them were de novo variants. There were MBD5 gene overall heterozygous deletion in 1 patient, large fragment deletions including MBD5 gene in 3 patients and single nucleotide variations (c.300C>A/p.C100X, c.1775delA/p.N592Tfs*29, c.1759C>T/p.Q587X, c.150_151del/p.Lys51Asnfs*6, c.113+1G>C) in 5 patients. The age at last follow-up ranged from 2 years and 9 months to 11 years and 11 months. At the last follow-up, 2 patients were seizure-free for more than 11 months to 4 years 6 months, 7 patients still had seizures. Conclusions: The initial seizure onset in patients with MBD5 gene variants usually occurs in infancy. Most patients have multiple seizure types. The seizures may be fever sensitive and clustered. Developmental delays, language impairments, and autistic behaviors are common. MBD5 gene variants include single nucleotide variations and fragment deletions. Epilepsy associated with MBD5 gene variants is usually refractory.


Asunto(s)
Niño , Preescolar , Femenino , Humanos , Lactante , Masculino , Proteínas de Unión al ADN/genética , Electroencefalografía , Epilepsias Mioclónicas/genética , Epilepsia/genética , Fiebre , Nucleótidos , Fenotipo , Estudios Retrospectivos , Convulsiones/genética
12.
Rev. Assoc. Med. Bras. (1992) ; 67(1): 64-70, Jan. 2021. tab, graf
Artículo en Inglés | LILACS | ID: biblio-1287776

RESUMEN

SUMMARY OBJECTIVE: Bladder cancer under the age of 40 is extremely rare. Bladder cancer development involves complex and multi-stage processes, one of which is the DNA damage repair mechanism. In this retrospective study, we aimed to evaluate the histopathological features of bladder urothelial carcinoma seen in patients under 40 years of age and tumor microsatellite instability status using immunohistochemistry. METHODS: A total of 50 patients under the age of 40 with urothelial bladder carcinoma from two different centers in the same country were included. Expression of the mismatch repair proteins MLH1, MSH2, MSH6, and PMS2 was analyzed by immunohistochemistry. RESULTS: Age at the time of diagnosis ranged from 17 to 40 years old. Most tumors were non-invasive papillary urothelial carcinoma. Two cases had nuclear loss of MSH-6 and PMS-2. We observed that tumor grade, tumor stage, presence of tumor differentiation, and infiltrative growth pattern of the tumor have significant impact on prognosis, but microsatellite instability does not have an effective role in bladder carcinogenesis in young patients. CONCLUSIONS: Our results indicate that the presence of microsatellite instability is not related to the low tumor grade and stage in urothelial neoplasms in young patients, suggesting that urothelial carcinoma of the bladder in young patients may represent a genetically stable form of neoplasia.


Asunto(s)
Humanos , Adolescente , Adulto , Adulto Joven , Carcinoma de Células Transicionales/genética , Inestabilidad de Microsatélites , Vejiga Urinaria/metabolismo , Estudios Retrospectivos , Proteínas de Unión al ADN/genética , Proteínas de Unión al ADN/metabolismo , Reparación de la Incompatibilidad de ADN
13.
Braz. j. med. biol. res ; 54(11): e11396, 2021. graf
Artículo en Inglés | LILACS | ID: biblio-1339444

RESUMEN

Current understanding of the genetic factors contributing to the etiology of non-syndromic craniosynostosis (NSC) remains scarce. The present work investigated the presence of variants in ALX4, EFNA4, and TWIST1 genes in children with NSC to verify if variants within these genes may contribute to the occurrence of these abnormal phenotypes. A total of 101 children (aged 45.07±40.94 months) with NSC participated in this cross-sectional study. Parents and siblings of the probands were invited to participate. Medical and family history of craniosynostosis were documented. Biological samples were collected to obtain genomic DNA. Coding exons of human TWIST1, ALX4, and EFNA4 genes were amplified by polymerase chain reaction and Sanger sequenced. Five missense variants were identified in ALX4 in children with bilateral coronal, sagittal, and metopic synostosis. A de novo ALX4 variant, c.799G>A: p.Ala267Thr, was identified in a proband with sagittal synostosis. Three missense variants were identified in the EFNA4 gene in children with metopic and sagittal synostosis. A TWIST1 variant occurred in a child with unilateral coronal synostosis. Variants were predicted to be among the 0.1% (TWIST1, c.380C>A: p. Ala127Glu) and 1% (ALX4, c.769C>T: p.Arg257Cys, c.799G>A: p.Ala267Thr, c.929G>A: p.Gly310Asp; EFNA4, c.178C>T: p.His60Tyr, C.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr) most deleterious variants in the human genome. With the exception of ALX4, c.799G>A: p.Ala267Thr, all other variants were present in at least one non-affected family member, suggesting incomplete penetrance. Thus, these variants may contribute to the development of craniosynostosis, and should not be discarded as potential candidate genes in the diagnosis of this condition.


Asunto(s)
Humanos , Niño , Craneosinostosis/genética , Factores de Transcripción/genética , Secuencia de Bases , Familia , Estudios Transversales , Mutación Missense/genética , Proteínas de Unión al ADN/genética
14.
Frontiers of Medicine ; (4): 302-312, 2021.
Artículo en Inglés | WPRIM | ID: wpr-880973

RESUMEN

Cullin-RING E3 ubiquitin ligase (CRL)-4 is a member of the large CRL family in eukaryotes. It plays important roles in a wide range of cellular processes, organismal development, and physiological and pathological conditions. DDB1- and CUL4-associated factor 8 (DCAF8) is a WD40 repeat-containing protein, which serves as a substrate receptor for CRL4. The physiological role of DCAF8 is unknown. In this study, we constructed Dcaf8 knockout mice. Homozygous mice were viable with no noticeable abnormalities. However, the fertility of Dcaf8-deficient male mice was markedly impaired, consistent with the high expression of DCAF8 in adult mouse testis. Sperm movement characteristics, including progressive motility, path velocity, progressive velocity, and track speed, were significantly lower in Dcaf8 knockout mice than in wild-type (WT) mice. However, the total motility was similar between WT and Dcaf8 knockout sperm. More than 40% of spermatids in Dcaf8 knockout mice showed pronounced morphological abnormalities with typical bent head malformation. The acrosome and nucleus of Dcaf8 knockout sperm looked similar to those of WT sperm. In vitro tests showed that the fertilization rate of Dcaf8 knockout mice was significantly reduced. The results demonstrated that DCAF8 plays a critical role in spermatogenesis, and DCAF8 is a key component of CRL4 function in the reproductive system.


Asunto(s)
Animales , Masculino , Ratones , Proteínas Cullin/genética , Proteínas de Unión al ADN/genética , Factor VIII , Ratones Noqueados , Espermatogénesis/genética , Ubiquitina-Proteína Ligasas
15.
Journal of Experimental Hematology ; (6): 450-455, 2021.
Artículo en Chino | WPRIM | ID: wpr-880096

RESUMEN

OBJECTIVE@#To investigate the relationship between acute myeloid leukemia (AML) patients ASXL2, ZBTB7A gene mutations and the prognosis.@*METHODS@#42 AML Patients treated in our hospital from January 2014 to January 2016 were selected and ASXL2 and ZBTB7A genes of their bone marrow samples were sequenced, the genetic characteristics and prognosis of core-binding factor-AML(CBF-AML) patients with ASXL2 and ZBTB7A mutations were analyzed.@*RESULTS@#ASXL2 (33.3%) and ZBTB7A (9.5%) mutations were found in t (8; 21) AML patients. Compared with wild-type, patients with ASXL2 mutations showed significantly higher white blood cell count at diagnosis [(9.49±1.85)×10@*CONCLUSION@#ASXL2 and ZBTB7A mutations are frequently found in t (8; 21) AML patients. The mutation of ASXL2 and ZBTB7A genes shows no significant effect on the prognosis of AML patients.


Asunto(s)
Humanos , Línea Celular Tumoral , Proteínas de Unión al ADN/genética , Leucemia Mieloide Aguda/genética , Mutación , Proteínas de Fusión Oncogénica/genética , Pronóstico , Proteínas Represoras/genética , Factores de Transcripción/genética
16.
Journal of Experimental Hematology ; (6): 1011-1018, 2021.
Artículo en Chino | WPRIM | ID: wpr-888512

RESUMEN

OBJECTIVE@#To the clinical characteristics and prognostic value of the patients with complete deletion of TET_JBP domain (ΔJBP) in TET2 acute myeloid leukemia (AML).@*METHODS@#Next Generation Sequencing technology was used to determine the mutations of 34 AML-related genes (including TET2 gene). The I-TASSER tool was used to predict the tertiary structure of the full-length TET2 protein and TET_JBP structure deletion.@*RESULTS@#Among 38 AML patients with TET2 mutations, 22(57.9%) showed truncation mutations, of which 16 (72.7%) produced TET2ΔJBP truncation mutants. Protein structure prediction showed that the deletion of TET_JBP domain lead to the significant changes of tertiary structure in TET2 protein. Compared with the patients in non-ΔJBP group, the age of patients in ΔJBP group were older (63 vs 54 years old, P=0.047), and the occurrence rate of CEBPA double mutation (CEBPA@*CONCLUSION@#AML patients with TET2ΔJBP truncation mutant shows lower CR rate, shorter EFS and OS after induction chemotherapy, which may be related to the poor prognosis, and co-mutation with CEBPA


Asunto(s)
Humanos , Persona de Mediana Edad , Proteínas de Unión al ADN/genética , Quimioterapia de Inducción , Leucemia Mieloide Aguda/genética , Mutación , Pronóstico , Proteínas Proto-Oncogénicas/genética , Inducción de Remisión
17.
Chinese Journal of Medical Genetics ; (6): 678-680, 2021.
Artículo en Chino | WPRIM | ID: wpr-888374

RESUMEN

OBJECTIVE@#To explore the genetic basis of a child with recurrent infection, multiple malformation and dysmorphism.@*METHODS@#The child and his parents were subjected to trio whole exome sequencing.@*RESULTS@#The child had a complaint of fever and cough, with long and thin eye fissures and long eyelashes. Genetic testing revealed that the child has carried a non-triplet deletion of the KDM6A gene, which was unreported previously. The variant resulted in frameshift and premature termination of the translation. His parents were both of the wild type for the locus. After antibiotic and immunoglobulin treatment, the severe secondary pneumonia caused by immunodeficiency has improved.@*CONCLUSION@#With combined laboratory test, imaging examination and genetic testing, the child was ultimately diagnosed with Kabuki syndrome type 2. The characteristics of immunodeficiency of Kabuki syndrome may render conventional antibiotic treatment ineffective, which deserves clinical attention.


Asunto(s)
Niño , Humanos , Anomalías Múltiples , Proteínas de Unión al ADN/genética , Cara/anomalías , Pruebas Genéticas , Enfermedades Hematológicas , Histona Demetilasas/genética , Proteínas de Neoplasias/genética , Proteínas Nucleares/genética , Fenotipo , Neumonía , Enfermedades Vestibulares
18.
Chinese Journal of Medical Genetics ; (6): 42-46, 2021.
Artículo en Chino | WPRIM | ID: wpr-879519

RESUMEN

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.


Asunto(s)
Niño , Humanos , Síndrome CHARGE/genética , ADN Helicasas/genética , Proteínas de Unión al ADN/genética , Variación Genética , Mutación , Fenotipo
19.
Chinese Medical Journal ; (24): 1017-1030, 2021.
Artículo en Inglés | WPRIM | ID: wpr-878138

RESUMEN

The LIM domain only 1 (LMO1) gene belongs to the LMO family of genes that encodes a group of transcriptional cofactors. This group of transcriptional cofactors regulates gene transcription by acting as a key "connector" or "scaffold" in transcription complexes. All LMOs, including LMO1, are important players in the process of tumorigenesis. Unique biological features of LMO1 distinct from other LMO members, such as its tissue-specific expression patterns, interacting proteins, and transcriptional targets, have been increasingly recognized. Studies indicated that LMO1 plays a critical oncogenic role in various types of cancers, including T-cell acute lymphoblastic leukemia, neuroblastoma, gastric cancer, lung cancer, and prostate cancer. The molecular mechanisms underlying such functions of LMO1 have also been investigated, but they are currently far from being fully elucidated. Here, we focus on reviewing the current findings on the role of LMO1 in tumorigenesis, the mechanisms of its oncogenic action, and the mechanisms that drive its aberrant activation in cancers. We also briefly review its roles in the development process and non-cancer diseases. Finally, we discuss the remaining questions and future investigations required for promoting the translation of laboratory findings to clinical applications, including cancer diagnosis and treatment.


Asunto(s)
Humanos , Masculino , Carcinogénesis/genética , Proteínas de Unión al ADN/genética , Regulación Neoplásica de la Expresión Génica , Proteínas con Dominio LIM/genética , Factores de Transcripción/metabolismo
20.
Chinese Journal of Medical Genetics ; (6): 260-263, 2021.
Artículo en Chino | WPRIM | ID: wpr-879566

RESUMEN

OBJECTIVE@#To explore the genetic basis for a child with mental and motor retardation, language impairment, facial dysmorphism and epilepsy.@*METHODS@#Whole exome sequencing was carried out to detect pathogenic variant in the proband, and candidate variant was selected based on his phenotype. Sanger sequencing was used to verify the variant in the proband, his parents and other family members.@*RESULTS@#The proband was found to carry a frameshifting mutation of MBD5 gene, namely c.2217delT (p.F739Lfs*6), which was inherited from his mother and unreported previously. Sanger sequencing confirmed that his brother carried the same mutation with a similar phenotype. His mother also had poor language expression when she was young, in addition with poor academic performance, though she could do some housework and had no history of convulsion.@*CONCLUSION@#A novel pathogenic variant of the MBD5 gene was discovered, which has enriched the mutational spectrum of the MBD5 gene. Above discovery has enabled genetic counseling and prenatal diagnosis for the family.


Asunto(s)
Niño , Femenino , Humanos , Masculino , Embarazo , Proteínas de Unión al ADN/genética , Discapacidad Intelectual/genética , Mutación , Linaje , Fenotipo , Secuenciación del Exoma
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA