A Brazilian regional basic diet-induced chronic malnutrition drives liver inflammation with higher ApoA-I activity in C57BL6J mice

Malnutrition is still considered endemic in many developing countries. Malnutrition-enteric infections may cause lasting deleterious effects on lipid metabolism, especially in children living in poor settings. The regional basic diet (RBD), produced to mimic the Brazilian northeastern dietary characteristics (rich in carbohydrate and low in protein) has been used in experimental malnutrition models, but few studies have explored the effect of chronic RBD on liver function, a central organ involved in cholesterol metabolism. This study aimed to investigate whether RBD leads to liver inflammatory changes and altered reverse cholesterol metabolism in C57BL6/J mice compared to the control group, receiving a standard chow diet. To evaluate liver inflammation, ionized calcium-binding adapter protein-1 (IBA-1) positive cell counting, interleukin (IL)-1β immunohistochemistry, and tumor necrosis factor (TNF)-α and IL-10 transcription levels were analyzed. In addition, we assessed reverse cholesterol transport by measuring liver apolipoprotein (Apo)E, ApoA-I, and lecithin-cholesterol acyltransferase (LCAT) by RT-PCR. Furthermore, serum alanine aminotransferase (ALT) was measured to assess liver function. RBD markedly impaired body weight gain compared with the control group (P<0.05). Higher hepatic TNF-α (P<0.0001) and IL-10 (P=0.001) mRNA levels were found in RBD-challenged mice, although without detectable non-alcoholic fatty liver disease. Marked IBA-1 immunolabeling and increased number of positive-IBA-1 cells were found in the undernourished group. No statistical difference in serum ALT was found. There was also a significant increase in ApoA mRNA expression in the undernourished group, but not ApoE and LCAT, compared with the control. Altogether our findings suggested that chronic RBD-induced malnutrition leads to liver inflammation with increased ApoA-I activity.

Depression and diagnosis of neurocognitive impairment in HIV-positive patients

Neurocognitive impairment (NCI) is frequently observed in patients infected with human immunodeficiency virus (HIV) and results from the compromise of subcortical brain structures by the virus. The manifestations of NCI range from asymptomatic impairment to dementia. In addition to cognitive impairment resulting from HIV infection, other factors such as depression are associated with the loss of cognitive functions. The aim of this study was to estimate the prevalence of NCI in HIV-positive patients in a city in southern Brazil and to establish possible associations for the prevalence of NCI with HIV-related and other risk factors. This cross-sectional study of HIV-positive outpatients was conducted in a specialized care service in the city of Pelotas in Southern Brazil. Sociodemographic data and HIV-related information were collected, and all patients underwent psychiatric and neurocognitive evaluations. The prevalence of NCI among the 392 patients was 54.1% when tracked using the IHDS (International HIV Dementia Scale) and 36.2% when the IHDS was associated with a battery of complementary tests. A bivariate analysis suggested an association of NCI with gender, age, educational level, depression, current CD4 count and lowest CD4 count. The association of NCI with depression remained in the Poisson regression (PR=1.96, 95%CI=1.12-3.42). The prevalence of cognitive impairment in HIV-positive patients estimated in this study is in accordance with international and Brazilian data. Of the factors analyzed, depression showed the greatest evidence of association with neurocognitive loss. Based on our findings, the inclusion of instruments to evaluate depression in our services for patients with HIV and acquired immunodeficiency syndrome (AIDS) is recommended.

Frequency of the cystic fibrosis delta F 508 mutation in a population from S ao Paulo State, Brazil

Cystic fibrosis (CF) nonrelated patients (N = 24) from S ao Paulo State, Brazil, were screened for the presence of the delta F 508 mutation by PCR amplification of the deletion region with the primers C16B (5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGATGACGCTTC 3'), and by acrylamide gel electrophoresis. The allelic frequency of the delta F 508 mutation was 33 per cent (15/48 chromosomes). The genotype distribution among the patients showed 12.5 per cent (N = 3) of delta F 508 homozygotes, 37.5 per cent (N = 9) of delta F heterozygotes and 50 per cent (N = 12) of non-carriers of the mutation. The frequency observed in this study is lower than that estimated for the North American and North European population (75 per cent to 80 per cent ) and is similar to that described in Southern Europe (25 per cent to 50 per cent ) which is consistent with the origins of this population