Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Low efficacy of delthamethrin-treated net against Singapore Aedes aegypti is associated with kdr-type resistance

There has been a worldwide surge in the number and severity of dengue in the past decades. In Singapore, relentless vector control efforts have been put in to control the disease since the 1960’s. Space spraying, fogging, chemical treatment and source reduction are some commonly used methodologies for controlling its vectors, particularly Aedes aegypti. Here, as we explored the use of a commercially available delthamethrin-treated net as an alternative strategy and the efficacy of the treated net was found to be limited. Through bioassays and molecular studies, the failure of the treated net to render high mortality rate was found to be associated with the knockdown resistance (kdr) mutation. This is the first report of kdr- mutations in Singapore’s Ae. aegypti. At least one point mutation, either homozygous or heterozygous, at amino acid residue V1016G of DIIS6 or F1269C of DIIIS6 was detected in 93% of field strains of Ae. aegypti. Various permutations of wild type and mutant amino acids of the four alleles were found to result in varying degree of survival rate among local field Ae. aegypti when exposed to the deltamethrin treated net. Together with the association of higher survival rate with the presence of both V1016G and F1269C, the data suggest the role of these mutations in the resistance to the deltamethrin. The high prevalence of these mutations were confirmed in a country wide survey where 70% and 72% of the 201 Ae. aegypti analysed possessed the mutations at residues 1016 and 1269 respectively. The highest mutated frequency combination was found to be heterozygous alleles (VG/FC) at both residues 1016 and 1269 (37.8%), followed by homozygous mutation at allele 1269 (24.4%) and homozygous mutation at allele 1016 (22.9%). The kdr- type of resistance among the vector is likely to undermine the effectiveness of pyrethroids treated materials against these mosquitoes.

Efectos del ayuno y la realimentacion sobre las concentraciones de glucosa, insulina y glucagon en adolescentes obesos. / Effects of fasting and refeeding on concentrations of glucose, insulin and glucagon in obese adolescents

Se estudiaron seis pacientes adolescentes con obesidad grave. Su estancia en el hospital se dividio en cuatro periodos dieteticos de una semana cada uno: dieta normal, ayuno total, realimentacion con 200 calorias y realimentacion con 400 calorias. Se realizo una prueba de tolerancia a la glucosa al principio y otra al final del periodo de hospitalizacion.Al final de cada periodo de variacion dietetica se les practico una prueba de arginina e insulina. Las concentraciones de la glucosa se conservaron sin diferencia en todas las condiciones experimentales cuando se les estimulo con glucosa o con arginina e insulina.Las concentraciones de la insulina plasmatica fueron mayores durante la dieta normal y disminuyeron significativamente durante el periodo de ayuno. La reaccion del glucagon fue mas baja durante la dieta normal que durante el periodo de ayuno. Estas interacciones entre insulina y glucagon permiten conservar la homeostasia de la glucosa. Los cambios observados en estas dos hormonas parecen ser secundarios a las variaciones del estado nutricional