RÉSUMÉ
A young male diagnosed with severe hemophilia A since childhood, was presented with recurrent joint and urinary bleeding. Annualized bleed rates dropped below five with low dose prophylactic medication.Bleeding in the right knee joint recently aggravated. Due to coexisting HIV infection and advanced hemophilic arthritis, the patient was managed by a multi-disciplinary team(MDT).Total knee arthroplasty was performed by an experienced surgeon using modern prosthesis design and intraoperative navigation technologies.Physical and rehabilitation therapy was provided during the postoperative period, and joint function improved. The MDT managed the young patient with HIV infection and advanced hemophilic arthritis. The patient was diagnosed with osteoporosis thought to have been caused by hemophilia, HIV infection and antiviral drugs; and he received treatment. The treatment of this patient reflects the importance of multidisciplinary cooperation in the management of difficult and rare diseases.
RÉSUMÉ
Objective:To determine the minimum clinically-important difference (MCID) in the rehabilitation effect among children with haemophilic knee joint contracture.Methods:The data describing 28 children with an average age of 13.89±3.00 years and haemophilic knee joint contracture who received no less than 10 sessions of physiotherapy in the Department of Rehabilitation Medicine at the Peking Union Medical College Hospital were analyzed. The therapeutic effect of the treatement was quantified in terms of Haemophilia Joint Health Scores (HJHSs) for their knees. The MCID after the therapy was evaluated using the mean change method, multivariate linear regression, receiver operating characteristics, and the distribution-based method.Results:The MCID for the improvement of knee HJHS was 5.13 by the mean change method, 4.31 by multivariate linear regression, 3.50 according to the ROC curve and 1.64 by the distribution-based method. Taking all of them into consideration, 4.31 was found to be an appropriate value.Conclusions:The MCID after physical therapy for the improvement in knee HJHS for a child with haemophilic knee contracture is 4.31. Improvements greater than 4.31 can be considered clinically significant.
RÉSUMÉ
OBJECTIVE：To preliminarily s tudy the potential mechanism of astragaloside Ⅳ on allergic rhinitis （AR）model mice. METHODS ：C57/BL6 mice were randomly divided into blank group ，model group and astragaloside Ⅳ group，with 10 mice in each group. Except for blank group ，AR model was prepared by sensitization and challenge with ovalbumin on day 0，7，14 and 21-27. Astragaloside Ⅳ group was given astragaloside Ⅳ 40 mg/kg intraperitoneally at the dose of 0.02 mL/g on the 15th to 27th day of modeling （given the drug 1 h before challenge sensitization on the 21st to 27th day ）. Blank group and model group were given constant volume of normal saline intraperitoneally ，once a day. Twenty-four hours after sensitization from the last challenge ， the infiltration of inflammatory cells in the nasal mucosa of each group was observed ，and the contents of interleukin 4（IL-4）， IL-5 and interferon gamma （IFN-γ）in the nasal lavage fluid were measured. The levels of reactive oxygen species （ROS），and the count of phosphorylated Janus kinase 2（p-JAK2）and phosphorylation signal transduction and activation of transcription protein 6 （p-STAT6）positive cells in the nasal mucosa and spleen as well as the phosphorylation levels of JAK 2 and STAT 6 proteins in spleen tissue （i.e. p-JAK 2/JAK2 ratio，p-STAT6/STAT6 ratio）were also determined. RESULTS ：Compared with blank group ，the number of inflammatory cells in the nasal mucosa （eosinophils and mast cells ）in the model group ，the contents of IL- 4 and IL- 5 in the nasal lavage fluid ，and the levels of ROS in the nasal mucosa and spleen tissues in the model group ，the count of p-JAK 2 and p-STAT 6 positive cells increased significantly ，the p-JAK2/JAK2 ratio，p-STAT6/STAT6 ratio in the spleen tissue were significantly increased （P＜0.05），and the content of INF-γ in the nasal lavage fluid was significantly decreased（P＜0.05）. Compared with model group ，the count of inflammatory cells infiltrated in the nasal mucosa ，the contents of IL- 4 and IL- 5 in the nasal cavity lavage fluid ，the level of ROS and the number of p-JAK 2 and p-STAT 6 positive cellsin the nasal mucosa and spleen tissue as well as the p-JAK2/JAK2 ratio and p-STAT 6/STAT6 ratio in spleen tissue were decreased significantly （P＜0.05），and the content of INF-γ in nasal lavage fluid was significantly increased（P＜0.05）. CO NCLUSIONS：Astragaloside Ⅳ can effectively improve the inflammatory response in AR model mice ，the mechanism of which may be related to down-regulation of JAK2/STAT6 signaling pathway and ROS level.
RÉSUMÉ
Recently, salvia miltiorrhiza has made a great progress in research of central nervous system (CNS) injury and neurodegeneration. Salvia miltiorrhiza and its active ingredients can exert multiple effects involving reduction of cell loss, attenuation of oxidative stress, improvement of micro-circulation and promotion of neuroregeneration, and show a protective effect on CNS diseases. Regulation of oxidative stress and removing accumulated metabolite may be the important mechanisms by which salvia miltiorrhiza exerts neuroprotective effects. This study will systematically discuss the pharmacological effects and possible mechanisms of salvia miltiorrhiza based on the core pathological changes in CSN diseases, and evaluate its drug safety through combing the related toxicology researches to provide a reference for clinical transformation of Chinese medicine in threatment of CNS diseases.
RÉSUMÉ
@#Objective To explore the association between cardiorespiratory fitness and physical activities in physically active patients with type 2 diabetes mellitus. Methods From July to November, 2017, 41 physically active patients with type 2 diabetes mellitus were measured physical activities with International Physical Activity Questionnaire, and cardiorespiratory fitness with cardiopulmonary exercise testing (CPET) by bicycle ergometer. The association between cardiorespiratory fitness and physical activity was analyzed with bivariate correlation analysis and Logistic regression. Results Leisure-time physical activities positively correlated with peak oxygen consumption and oxygen consumption at anaerobic threshold (r = 0.393-0.503, P < 0.05), while leisure-time physical activities independently and positively correlated with normal cardiorespiratory fitness (OR = 5.661, P = 0.017). Conclusion Leisure-time physical activities can improve the cardiorespiratory fitness in physically active patients with type 2 diabetes mellitus, which should be encouraged rather than other activities.
RÉSUMÉ
Objective To explore the cardiopulmonary function and exercise capacity of adolescent idiopathic scoliosis (AIS) patients without pulmonary dysfunction.Methods In this retrospective study,the results of exercise tests administered to AIS patients without pulmonary dysfunction were reviewed seeking any consistent relationship between scoliosis location and severity and the test results.Correlations relating pulmonary function,body mass index (BMI),age and exercises tolerance were also sought.Results Forty-six patients were included,17with solely thoracic scoliosis,11 with solely thoracolumbar scoliosis and 18 with both thoracic and thoracolumbar scoliosis.Ten of those studied (21.74％) had normal exercise tolerance,while in 24 exercise tolerance was mildly impaired,in 11 moderately and in 1 severely.The average peak minute ventilation (MV) of the thoracic scoliosis group [(43.11±8.47) L/min] was significantly lower than that of the thoracolumbar scoliosis group [(50.81 ± 10.11)L/min].The average VO2AT/kg of the thoracic+thoracolumbar scoliosis group [(14.16±2.04) ml/kg/min] was significantly lower than that of the thoracic scoliosis group [(16.82±2.87) mL/kg/min] and of the thoracolumbar scoliosis group [(17.78±4.34) ml/kg/min].Among the thoracic scoliosis patients,no significant difference in exercise tolerance was observed between those with moderate and severe scoliosis.The peak VO2％ pred was negatively correlated with BMI,but not significantly correlated with pulmonary function or age.Conclusions Although without pulmonary dysfunction,the AIS patients showed a significantly lower tolerance for maximum exercise generally.The average peak ME was significantly lower in the thoracic scoliosis group than in the thoracolumbar scoliosis group,while the average VO2AT/kg was significantly lower in the thoracic + thoracolumbar scoliosis group than in the solely thoracic and thoracolumbar scoliosis groups.Exercise tolerance was negatively correlated with BMI,but uncorrelated with the severity of the scoliosis,pulmonary function or age.
RÉSUMÉ
Objective To find the frequencies of FcγRIIIA polymorphisms in Chinese people and the potential role of these polymorphisms(SNPs) in systemic lupus erythermatosus(SLE) and lupus nephritis(LN).Methods The investigation covers 324 unrelated Chinese SLE patients and 319 controls.FcγRIIIA F158V polymorphism was genotyped by specific primer-polymerase chain reaction(PCR).Results The frequency of F allele of FcγRIIIA polymorphism is 60.8% in Chinese people.FcγRIIIA polymorphism revealed a significant difference of both genotype and allele distribution in SLE patients and controls.LN patients have a significant increase in carrier frequency of the FF genotype, while the VV genotype reveals a significant decreased risk of early onset of LN.ConclusionsFcγRIIIA polymorphisms is potentially related with SLE in Chinese people.The homozygous FF genotype of FcγRIIIA might be the risk factor for LN, while the homozygous VV genotype might be the protective factor for late onset lupus nephritis.
RÉSUMÉ
Objective To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia .Method A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing .The enrollment criteria were faculty member of the hospital with signed consent .The exclusion criteria were tumor , previous renal diseases , renal function damage , pregnancy , currently taking medicines that could increase or decrease serum uric acid level , and those who had gout.Males with serum uric acid >416.4 μmol/L and females with serum uric acid >359.6 μmol/L were enrolled as hyperuricemia group .Subjects with normal serum uric acid were randomly enrolled at 1:2 ratio after matching for gender , age, renal function and body mass index .Rs2231142( C>A) was assayed by amplification refractory mutation system polymerase chain reaction , with common forward primer:5′GGCTTTGCAGACATCTATGG 3′, C specific reverse primer:5′CGAAGAGCTGCTGAGAAATG 3′, and A specific reverse primer:5′CGAAGAGCTGCTGAGAAATT 3′.Association between rs 2231142 and hyperuricemia was analyzed in the general study group , as well as different gender and age groups .Results A total of 198 subjects with hyperuricemia and 370 controls were enrolled .The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001).After adjustment for hypertension, hyperglycemia and dyslipidemia , the OR was 2.99 (95%CI 1.94 -4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female.In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female.While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females.Interaction study between gender and rs 2231142 did not reach significant level in both the gender group and two age groups . Conclusion Single nucleotide polymorphism rs 2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort .The ORs are higher in male than those in female , especially in those less than 55 years old .
RÉSUMÉ
Lower back pain refers to the pain in the lower back. It usually refers to the region below the lower costal margin on the back. The pain mostly occurs on L4 and L5, or L5 and L1, which is usually called as lower back pain. For the treatment of low back pain, it has lacked the effective and objective measurement methods based on the functional and structural features of spinal muscles. This article discussed on the core stability and core strength, the identification and classification of core muscle group, the relation between core stabilizing muscle group and low back pain. It also discussed the characteristics and effects of training motion therapy in the improving of core strength. The core of human body was consisted of waist, pelvis and hip joint. Core stabilizing training can effectively stabilize the spine and transmit power. The question of how to train and improve the core strength to relieve low back pain and make effective evaluation according to its therapeutic results are the key points in the future study.
RÉSUMÉ
Objective To establish the screening platform of circulating tumor cells (CTCs) using acridine orange fluo?rescent (AO-F) dyeing method, and to apply it in the screening of peripheral blood CTCs in patients with kidney cancer. Methods Twenty-seven patients with metastatic renal cell carcinoma was included in this study. Primitive tumor cells and kidney cancer cell line 769-P were cultured with different concentrations of fetal bovine serum. Smears were prepared and observed under fluorescence microscopy. The percentage of AO-F positive staining of 769-P cells under 5 random sights was calculated. The sensitivity of AO-F staining to cells was evaluated. The 5 mL morning fasting venous blood was obtained from 10 subjects with healthy check-up. The 1×106 cell suspension was prepared. The logarithmic phase of renal tumor cells was used to prepare tube containing 500, 200, 100, 50 and 10 tumor cell suspension, which were mixed with 1×106 nucleated cells to establish CTCs model of renal cancer. AO-F staining method was used to detect the expression of AO-F positive cells. The correlation between expression of AO-F positive cells and clinical parameters was analyzed. Results The prima?ry cells and cell line 769-P showed similar bright color and morphological characteristics. The percentage of AO-F positive staining in 769-P cells was 93%±3%under 5 random sights. The recovery rates (%) of four groups (500, 200, 100 and 50 tu?mor cell suspension) were 10.2±3.8, 9.2±2.3, 10.8±2.6 and 10.5±1.9, respectively. There were no significant differences in recovery rates between four groups (P>0.05). The group of 10 tumor cell suspension could find AO-F positive staining cells occasionally. Zero case was positive in controls. Nine of 27 patients were positive and the rate was 33.33%. There were no significant statistical differences in AO-F positive rates between gender, age, tumor size, pathological pattern, Furhman stage, metastasis of lung and presence of tumor (P>0.05). Conclusion It is confirmed that the method of CTCs staining with AO-F, which has high specificity and reproducibility, is feasible to detect CTCs and worthy of being studied. There is a certain reference value to predict tumor recurrence and metastasis.
RÉSUMÉ
Objective To observe the effects of loaded swimming exercise on articular cartilage and the serum superoxide dismutase (SOD) and malondialdehyde (MDA) levels in knees modelling osteoarthritis in rats.Also to explore how loaded swimming might be useful in treating knee osteoarthritis (KOA) in clinical practice.Methods Fifty male Wistar rats were divided randomly into a normal group (20 rats) and a model group (30 rats).A model of knee osteoarthritis was created in the rats of the model group by papain injection.Ten rats from the normal group and 10 from the model group were sacrificed for:① gross and optical microscopic observations of pathological changes in their knee articular cartilage; ② quantifying the expression of MMP-13 in the knee articular cartilage using immunohistochemistry; ③ determining serum SOD and MDA content using enzyme-linked immunosorbet assays.The remaining 20 rats of the model group were divided into a loaded swimming group (10 rats) and a control group (10 rats).There were no extra interventions involving the rats in the normal and control groups.The rats in the loaded swimming group took loaded swimming exercise for 6 weeks.After that,the same 3 indicators were again surveyed in all groups.Results The scores of pathological changes and the expression of MMP-13 in knee articular cartilage decreased significantly more in the loaded swimming group than in the control group.Serum SOD content also increased significantly more.Conclusions Loaded swimming exercise can delay articular cartilage damage and increase the serum SOD content of osteoarthritic knees,at least in rats.
RÉSUMÉ
Objective To improve the ability of rheumatologist to diagnose systemic lupus erythematosus (SLE) complicated with ureterohydronephrosis by analyzing the characteristics of clinical manifestations.Methods Patients with ureterohydronephrosis hospitalized in Peking Union Medical College Hospital between 2000 to 2008 were analyzed retrospectively. The clinical characteristics, serological findings, treatment and prognosis of these patients were reviewed. Comparisons between the groups were performed with X2 test and t-test. Results SLE patient with ureterohydronephrosis accounted for 1.26% of the SLE patients hospitalized in the same period. Twenty-eight patients presented with gastrointestinal symptoms, 14 patients suffered from bladder irritative symptoms. Nineteen patients were with bilateral ureterohydronephrosis, and 8 patients were with unilateral ureterohydronephrosis. Fourteen patients had stype positive ANA, 14 patients had positive antiSSA antibodies. All patients were treated with steroid and immune suppressive therapy, 11 patients were cured, while 3 patients had no improvement. Conclusion Ureterohydronephrosis isn't a very rare complication of SLE. SLE patients with ureterohydronephrosis often present with gastrointestinal symptoms and have high incidence of chronic intestinal pseudo obstruction. High ratio of stype ANA antibody and high positive rate of anti-SSA are most important characteristics in this subtype of SLE patients. The complications can be reversed if the patients are treated early and appropritaely.