Résumé
Congenital microphthalmia (CM) is a rare anomaly of the fetal orbit, results from developmental defects of the primary optic vesicle, and is characterized by a reduced eyeball volume and axial diameter. Fetal CM cases have rarely been reported. Herein, we present a case of two fetuses with bilateral CM from the same parents, diagnosed using ultrasonography (US) and magnetic resonance imaging (MRI). We found that the antepartum US and MRI measurements were smaller than the postpartum ones. Genetic testing of the parents and fetuses revealed that GL12 gene mutation may be associated with CM.
Résumé
Background: As an immune checkpoint, upregulation of B and T lymphocyte attenuator (BTLA) contributes to T-cell exhaustion in chronic infection. However, the characteristics of BTLA on T cells of patients with pulmonary tuberculosis (PTB) are still uncovered. Aims: The aim of the study was to elucidate the dynamics and clinical significance of BTLA expression on circulating CD4+ and CD8+ T cells of PTB patients. Materials and Methods: BTLA expression on T cells from PTB patients with smear positivity (n = 86) and healthy controls (HCs) (n = 40) were determined using flow cytometry. Results: The levels of BTLA expression on circulating CD4+ and CD8+ T cells of PTB patients with smear positivity were both upregulated, compared with HC. At the same time, the levels of BTLA expression on CD4+ and CD8+ T cells of patients with retreatment were both higher than that of those with initial treatment and gradually upregulated along with the increase of the bacillary load in sputum. In addition, the patients with lung cavity were discovered to present higher levels of BTLA expression on CD4+ and CD8+ T cells than those without lung cavity. Whereas we noted that there was no correlation between the levels of BTLA expression and the positivity or negativity of anti-Mycobacterium tuberculosis antibody. Conclusions: The levels of BTLA expression were upregulated on CD4+ and CD8+ T cells of PTB patients and associated with disease progression. Thereby, BTLA expression on T cells may be considered as a potential clinical indicator and utilized as a therapeutic target for PTB.
Résumé
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.