Mechanism of salvianolic acid B protecting H9C2 from OGD/R injury based on mitochondrial fission and fusion / 药学学报

This study aims to investigate the effect of salvianolic acid B (Sal B), the active ingredient of Salvia miltiorrhiza, on H9C2 cardiomyocytes injured by oxygen and glucose deprivation/reperfusion (OGD/R) through regulating mitochondrial fission and fusion. The process of myocardial ischemia-reperfusion injury was simulated by establishing OGD/R model. The cell proliferation and cytotoxicity detection kit (cell counting kit-8, CCK-8) was used to detect cell viability; the kit method was used to detect intracellular reactive oxygen species (ROS), total glutathione (t-GSH), nitric oxide (NO) content, protein expression levels of mitochondrial fission and fusion, apoptosis-related detection by Western blot. Mitochondrial permeability transition pore (MPTP) detection kit and Hoechst 33342 fluorescence was used to observe the opening level of MPTP, and molecular docking technology was used to determine the molecular target of Sal B. The results showed that relative to control group, OGD/R injury reduced cell viability, increased the content of ROS, decreased the content of t-GSH and NO. Furthermore, OGD/R injury increased the protein expression levels of dynamin-related protein 1 (Drp1), mitofusions 2 (Mfn2), Bcl-2 associated X protein (Bax) and cysteinyl aspartate specific proteinase 3 (caspase 3), and decreased the protein expression levels of Mfn1, increased MPTP opening level. Compared with the OGD/R group, it was observed that Sal B had a protective effect at concentrations ranging from 6.25 to 100 μmol·L-1. Sal B decreased the content of ROS, increased the content of t-GSH and NO, and Western blot showed that Sal B decreased the protein expression levels of Drp1, Mfn2, Bax and caspase 3, increased the protein expression level of Mfn1, and decreased the opening level of MPTP. In summary, Sal B may inhibit the opening of MPTP, reduce cell apoptosis and reduce OGD/R damage in H9C2 cells by regulating the balance of oxidation and anti-oxidation, mitochondrial fission and fusion, thereby providing a scientific basis for the use of Sal B in the treatment of myocardial ischemia reperfusion injury.

Noninvasive Diagnostic Technique for Nonalcoholic Fatty Liver Disease Based on Features of Tongue Images / 中国结合医学杂志

OBJECTIVE@#To investigate a new noninvasive diagnostic model for nonalcoholic fatty liver disease (NAFLD) based on features of tongue images.@*METHODS@#Healthy controls and volunteers confirmed to have NAFLD by liver ultrasound were recruited from China-Japan Friendship Hospital between September 2018 and May 2019, then the anthropometric indexes and sampled tongue images were measured. The tongue images were labeled by features, based on a brief protocol, without knowing any other clinical data, after a series of corrections and data cleaning. The algorithm was trained on images using labels and several anthropometric indexes for inputs, utilizing machine learning technology. Finally, a logistic regression algorithm and a decision tree model were constructed as 2 diagnostic models for NAFLD.@*RESULTS@#A total of 720 subjects were enrolled in this study, including 432 patients with NAFLD and 288 healthy volunteers. Of them, 482 were randomly allocated into the training set and 238 into the validation set. The diagnostic model based on logistic regression exhibited excellent performance: in validation set, it achieved an accuracy of 86.98%, sensitivity of 91.43%, and specificity of 80.61%; with an area under the curve (AUC) of 0.93 [95% confidence interval (CI) 0.68-0.98]. The decision tree model achieved an accuracy of 81.09%, sensitivity of 91.43%, and specificity of 66.33%; with an AUC of 0.89 (95% CI 0.66-0.92) in validation set.@*CONCLUSIONS@#The features of tongue images were associated with NAFLD. Both the 2 diagnostic models, which would be convenient, noninvasive, lightweight, rapid, and inexpensive technical references for early screening, can accurately distinguish NAFLD and are worth further study.

Perspective of Calcium Imaging Technology Applied to Acupuncture Research / 中国结合医学杂志

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.

Predictive value of serum lactate dehydrogenase on prognosis of patients with paraquat poisoning / 中华劳动卫生职业病杂志

Objective: To investigate the predictive value of serum lactate dehydrogenase (LDH) in the prognosis of patients with paraquat (PQ) poisoning, and to provide evidence for early prognosis assessment. Methods: In February 2022, 50 patients with PQ poisoning who completed serum LDH detection admitted to the Department of Emergency Medicine, the First Affiliated Hospital of Wenzhou Medical University from January 2012 to December 2021 were selected as the observation group, and 50 healthy physical examination personnel were randomly selected as the control group. Patients with PQ poisoning were divided into survival group and death group according to the prognosis, and the differences of blood routine routine, liver and kidney function and other indicators in the first admission between the two groups were compared. Multivariate logisitic regression model was established, ROC curve was drawn, and the influencing factors of prognosis of patients with PQ poisoning were analyzed. Results: Compared with the control group, the white blood cell count (WBC), total bilirubin (TBil), alanine aminotransferase (ALT), aspartate aminotransferase (AST), LDH, glucose (GLU) and creatinine (Cr) in observation group were significantly increased, while albumin (ALB) and total cholesterol (TC) were significantly decreased (P<0.05). Univariate analysis showed that WBC, elevated LDH (>247 U/L), TBil, ALT, AST and Cr were significantly different between PQ poisoning survival group and death group (P<0.05). Multivariate logisitic regression analysis showed that elevated serum LDH was an independent risk factor for the prognosis of PQ poisoning patients (OR=9.95, 95%CI: 1.34-73.82, P=0.025). The area under the ROC curve of LDH was 0.811 (95%CI: 0.692-0.930). When the cut-off value was 340 U/L, the sensitivity was 0.889 and the specificity was 0.719. Log-rank test showed that there was a statistically significant difference in survival rate between the normal LDH group and the elevated LDH group (P=0.001) . Conclusion: Serum LDH has a good predictive value in evaluating the prognosis of patients with PQ poisoning. Elevated LDH is a risk factor for poor prognosis of patients with PQ poisoning.

Causal links between long-term exposure to NO2 and the risk of cardiovascular hospitalization / 中华流行病学杂志

Objective: To determine the causal association between long-term Nitrogen dioxide (NO2) exposure and the risk of cardiovascular hospitalization. Methods: Based on a sub-cohort of a community-based prospective cohort study, a total of 36 271 participants were recruited from 35 communities randomly selected in Guangzhou in 2015. The annual average exposure of NO2, demographic characteristics, lifestyle factors, and information on the causes of hospitalization was collected. We applied marginal structural Cox models to investigate the effect of NO2 on cardiovascular hospitalization. Demographic and behavioral factors also stratified results. Results: The mean age of participants in the present study was (50.9±17.8) years, and the cardiovascular admission rate was 8.7%, with 203 822 person-years of follow-up. The annual mean NO2 concentration was 48.7 μg/m3 during 2015-2020. For each 10 μg/m3 increase in NO2 concentrations, the HRs (95%CIs) of total cardiovascular hospitalization, cardiovascular hospitalization, and cerebrovascular hospitalization were 1.33 (1.16-1.52), 1.36 (1.16-1.60) and 1.25 (1.00-1.55), respectively. Participants who were never married/married, with secondary education, high exercise frequency, or non-smokers/current smokers may be more susceptible than their counterparts. Conclusion: Long-term exposure to NO2 significantly increased hospitalization risk for cardiovascular disease.

Improvement of China's legal system for public health emergency management from the perspective of lifecycle management / 中华流行病学杂志

A crucial lesson gained through the pandemic preparedness and response to COVID-19 is that all measures for epidemic control must be law-based. The legal system is related not only to public health emergency management per se but also to all aspects of the institutional supporting system throughout the lifecycle. Based on the lifecycle emergency management model, this article analyses the problems of the current legal system and the potential solutions. It is suggested that the lifecycle emergency management model shall be followed to establish a more comprehensive public health legal system and to gather the intelligence and consensus of experts with different expertise, including epidemiologists, sociologists, economists, jurist and others, which will collaboratively promote the science-based legislation in the field of epidemic preparedness and response for the establishment of a comprehensive legal system for public health emergency management and with Chinese characteristics.

Comparison of the predictive value of Padua and the IMPEDE assessment scores for venous thromboembolism in patients with newly diagnosed multiple myeloma: A single institution experience / 中华血液学杂志

Objective: To compare the predictive efficacy of the two thrombosis risk assessment scores (Padua and IMPEDE scores) in venous thromboembolism (VTE) within 6 months in patients with newly diagnosed multiple myeloma (NDMM) in China. Methods: This study reviewed the clinical data of 421 patients with NDMM hospitalized in Beijing Jishuitan Hospital from April 2014 to February 2022. The sensitivity, specificity, accuracy, and Youden index of the two scores were calculated to quantify the thrombus risk assessment of VTE by the Padua and IMPEDE scores. The receiver operating characteristics curves of the two evaluation scores were drawn. Results: The incidence of VTE was 14.73%. The sensitivity, specificity, accuracy, and Youden index of the Padua score were 100%, 0%, 14.7%, and 0% and that of the IMPEDE score was 79%, 44%, 49.2%, and 23%, respectively. The areas under the curve of Padua and IMPEDE risk assessment scores were 0.591 and 0.722, respectively. Conclusion: IMPEDE score is suitable for predicting VTE within 6 months in patients with NDMM.

Possible mechanisms of toxic effects of per-and polyfluoroalkyl substances exposure on thyroid / 环境与职业医学

Per- and polyfluoroalkyl substances (PFASs) are persistent organic pollutants (POPs). They are widely used in food packaging, tableware coating, stain resistant furniture, and other industrial production. Humans are exposed to PFASs on a daily basis through drinking water and intaking food, use of consumer products containing PFASs, and occupational exposure during the production of PFASs or related products. A growing body of toxicological studies has shown that PFASs exposure disrupts the thyroid hormone (TH) system and causes hypothyroidism, which is further supported by population epidemiological studies. PFASs can damage thyroid follicular cells and sodium/iodine transporters to impair iodine uptake by thyroid cells. They interfere with the synthesis of thyroglobulin, reduce the activity of thyroid peroxidase, and affect the synthesis and secretion of TH. They interfere with TH transportation and biological effects via TH competitive binding thyroid transporter or thyroid hormone receptor. They suppress TH signaling pathway and deiodinase activity, interfere negative feedback mechanism, and accelerate TH metabolism and excretion. The processes of TH synthesis, transport, degradation, and biological effects may all be affected by PFASs exposure. This paper described possible toxic mechanisms of PFASs on the thyroid from four aspects: TH biosynthesis, transport, action on target cells, and metabolic excretion stage, and summarized the thyroid toxicity associated with PFASs exposure.

Antithrombin deficiency caused by SERPINC1 gene mutations predispose to venous thrombotic events / 中华检验医学杂志

Objective:To analyze 12 antithrombins (AT) gene mutations that cause AT deficiency and discuss the relationship between the SERPINC1 gene. mutations and venous thrombotic events.Methods:This study belongs to case series of observational studies. Collected the clinical data of 12 AT deficiency cases in the First Affiliated Hospital of Wenzhou Medical University from April 2014 to April 2021 and collected the blood samples before treatment. The AT activity (AT: A) and AT antigen (AT: Ag) was detected by chromogenic substrate and immunoturbidimetry, respectively. The 7 exons and flanking sequences of the SERPINC1 gene were sequenced directly by PCR, the suspected mutations were validated by reverse sequencing. Analyzed the correlation between the SERPINC1 gene. mutations and venous thrombotic events and figured out the proportion.Results:The AT: A of the 12 patients all decreased significantly, ranging from 30% to 66%, and the AT: Ag of the 7 patients decreased accordingly, showing type Ⅰ AT deficiency, and the AT: Ag of the other 5 patients were normal, presented type Ⅱ AT deficiency. 12 mutations were found including 6 heterozygous mutations which were discovered for the first time: c.456_458delCTT(p.phe121del), c.318_319insT(p.Asn75stop), c.922G>T(p.Gly276Cys), c.938T>C (p.Met281Thr), c.1346T>A(p.Leu417Gln)and c.851T>C(p.Met252Thr). All 12 patients had venous thrombosis, and 3 cases including 2 compound heterozygotes and 1 single heterozygote all suffered from deep venous thrombosis (DVT) when they were younger without obvious triggers. The other 9 patients all combined with the other thrombotic factors including old age, hypertensive, smoking, pregnancy, and prolonged immobilization.Conclusion:Patients with AT deficiency caused by SERPINC1 gene defects are prone to venous thrombosis, especially combined with other thrombotic factors.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Endovascular treatment of ruptured lobulated anterior communicating artery aneurysms: A retrospective case series study of 24 patients / 国际脑血管病杂志

Objective:To investigate the efficacy and safety of endovascular treatment for ruptured lobulated anterior communicating artery aneurysm (ACoAA).Methods:Patients with ruptured lobulated ACoAA received endovascular treatment in Sanming First Hospital Affiliated to Fujian Medical University from June 2020 to June 2022 were retrospectively included. Their demographic, clinical and imaging characteristics, endovascular treatment methods and follow-up results were collected.Results:A total of 24 patients with ruptured lobulated ACoAA were included, including 9 males (37.5%) and 15 females (62.5%). Their age was 56.2±8.9 years old (range 39-74). The time from rupture to endovascular treatment was 10.9±12.5 h. The maximum diameter of the aneurysms was 5.1±1.0 mm and neck width was 3.0±0.7 mm. Nineteen patients (79.2%) were double-lobed and 5 (20.8%) were multilobed. Fisher's grade: grade 2 in 16 cases (66.7%), grade 3 in 6 cases (25%), and grade 4 in 2 cases (8.3%). Hunt-Hess grade: grade 0-2 in 5 cases (20.8%), grade 3-5 in 19 cases (79.2%). Glasgow Coma Scale score: 9-12 in 14 cases (58.3%), 13-15 in 10 cases (41.7%). Immediately postprocedural Raymond-Roy grade: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Raymond-Roy grade in imaging follow-up for 2 weeks to 3 months: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Follow-up for 2 to 12 months showed that 21 patients (87.5%) had good functional outcomes (modified Rankin Scale score ≤2), and there were no deaths.Conclusion:Endovascular treatment is a safe and effective treatment for ruptured lobulated AcoAA.

Risk Factors of Hypogonadism in Male Patients with Hyperuricemia in Xinjiang / 中山大学学报(医学科学版)

ObjectiveTo explore the risk factors of hypogonadism in male hyperuricemia （HUA） patients in Xinjiang. MethodsClinical data of 217 male patients with HUA admitted to the Department of Endocrinology and Metabolism of the People's Hospital of Xinjiang Uygur Autonomous Region from June 2021 to December 2022 were collected. Patients meeting the diagnostic criteria for hypogonadism were included in the case group （98 cases）， and patients with normal gonadism were included in the control group （119 cases）. The differences of different metabolic indexes between the two groups and the correlation of male hypogonadism were analyzed. ResultsCompared with those in normal gonadal function group， in hypogonadism group， age， waist circumference （WC）， body mass index （BMI）， the levels of fasting blood glucose （FPG）， fasting insulin （FINS）， insulin resistance index assessed by homeostasis model （HOMA-IR）， alanine aminotransferase （ALT）， blood uric acid （SUA） and sex hormone binding globulin （SHBG） were significantly increased； the levels of γ-glutamyltransferase （GGT）， 25-hydroxyvitamin D ［25（OH）D］， progesterone （P）， estradiol （E2）， dehydroepiandrosterone （DHEA） and serum free triiodothyronine （FT3） were significantly decreased （P < 0.05）； and the proportion of patients with obesity （OB）， non-alcoholic fatty liver （NAFLD）， hyperlipidemia （HLP）， hypertension （HBP）， coronary heart disease （CHD） and use of angiotensin receptor antagonist （ARB） and aspirin was significantly increased （P < 0.05）. Correlation analyses showed that free testosterone （FT） was negatively correlated with age， WC， BMI， FPG， FINS， HOMA-IR， SUA， SHBG and ALT， but positively correlated with 25（OH）D， P， E2， DHEA and FT3 （P < 0.05）. Logistic regression analysis showed that age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC were independent risk factors for hypogonadism （P < 0.05）. After multivariate adjustment， SUA remained an independent risk factor for hypogonadism ［OR = 1.009， 95%CI （1.004， 1.015）， P = 0.001］. ConclusionsMale HUA patients are often accompanied with hypogonadism. Age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC are independent risk factors of hypogonadism.

T cell receptor-based immunotherapy: a review / 生物工程学报

T cells play central roles in anti-tumor immune responses. Immune checkpoint therapy, which is based on modulation of T cell reactivity, has achieved breakthrough in clinical treatment of multiple tumors. Moreover, adoptive T cell therapy, which includes mainly genetically engineered T cells, has shown substantial treatment efficacy in hematoma. Immune therapy has tremendously changed the scenario of clinical tumor treatment and become critical strategies for treating multiple tumors. T cell receptor (TCR) is the fundamental molecule responsible for the specificity of T cell recognition. TCRs could recognize peptides, which are derived from intracellular or extracellular tumor antigens, presented by major histocompatibility complex (MHC) and are therefore highly sensitive to low antigen level. Thereby, TCRs are broadly recognized as promising molecules for the development of anti-tumor drugs. The approval of the first TCR drug in 2022 has initiated a new era for TCR-based therapeutics and since then, multiple TCR drugs have shown substantial treatment efficacy in multiple tumors. This review summarizes the progress of TCR-based immune therapeutic strategies, including T cell receptor-engineered T cell (TCR-T), TCR-based protein drugs, and other cell therapies based on TCR signaling, providing useful information for future design of immune therapeutics based on TCR.

Betulinic Acid Improves Cardiac Function in Septic Rats Through AKT / mTOR and AKT / AMPK -modulated Autophagy / 中国生物化学与分子生物学报

Betulinic acid (BA) exerts protective effects on organs in septic animals. However, whether BA can improve cardiac function in sepsis and the underlying mechanism remain unclear. Here, male Sprague-Dawley rats were pretreated with BA (25 mg/ kg/ d, i. g.) for 5 days and then intraperitoneally injected with lipopolysaccharide (LPS, 10 mg/ kg). The rats were anesthetized to determine transthoracic echocardiography using a high-resolution imaging system for small animals after they were treated with LPS for 6 h. Histopathologic alterations were examined by HE staining. Myocardial injury markers (cTnI and CK-MB) and inflammatory factors (TNF-α, IL-1β and IL-6) in the serum were measured by the enzyme-linked immunosorbent assay. Autophagy-related proteins (p62 and LC3 Ⅱ) and AKT-modulated autophagy pathways in the myocardium were determined by Western blotting. Pretreatment with BA markedly improved left ventricular ejection fraction (EF) and fraction shortening (FS) (P<0. 05), improved myocardial histomorphology, and significantly inhibited cTnI, CK-MB, TNF-α, IL-1β and IL-6 (P<0. 05) in the septic rat serum. BA markedly decreased p62 (P<0. 01), increased LC3 Ⅱ (P< 0. 001), and significantly down-regulated p-AKT (Thr308), p-AMPKα (Ser485/ 491), p-mTOR (Ser2448) and p-S6K (Thr389) (P<0. 05), while markedly up-regulated p-AMPKα (Thr172) and pULK1 (Ser317) (P<0. 01) in septic rat hearts. The findings indicate that BA can attenuate sepsis-induced myocardial dysfunctions associated with down-regulating autophagy inhibiting pathways mediated by AKT/ mTOR and AKT/ AMPK pathways.

ADAR1 regulates vascular remodeling in hypoxic pulmonary hypertension through N1-methyladenosine modification of circCDK17

Pulmonary hypertension (PH) is an extremely malignant pulmonary vascular disease of unknown etiology. ADAR1 is an RNA editing enzyme that converts adenosine in RNA to inosine, thereby affecting RNA expression. However, the role of ADAR1 in PH development remains unclear. In the present study, we investigated the biological role and molecular mechanism of ADAR1 in PH pulmonary vascular remodeling. Overexpression of ADAR1 aggravated PH progression and promoted the proliferation of pulmonary artery smooth muscle cells (PASMCs). Conversely, inhibition of ADAR1 produced opposite effects. High-throughput whole transcriptome sequencing showed that ADAR1 was an important regulator of circRNAs in PH. CircCDK17 level was significantly lowered in the serum of PH patients. The effects of ADAR1 on cell cycle progression and proliferation were mediated by circCDK17. ADAR1 affects the stability of circCDK17 by mediating A-to-I modification at the A5 and A293 sites of circCDK17 to prevent it from m1A modification. We demonstrate for the first time that ADAR1 contributes to the PH development, at least partially, through m1A modification of circCDK17 and the subsequent PASMCs proliferation. Our study provides a novel therapeutic strategy for treatment of PH and the evidence for circCDK17 as a potential novel marker for the diagnosis of this disease.

A case of neonatal-onset type I hyperlipoproteinemia with bloody ascites / 中国当代儿科杂志

This report presents a case of a male infant, aged 32 days, who was admitted to the hospital due to 2 days of bloody stools and 1 day of fever. Upon admission, venous blood samples were collected, which appeared pink. Blood biochemistry tests revealed elevated levels of triglycerides and total cholesterol. The familial whole genome sequencing revealed a compound heterozygous variation in the LPL gene, with one variation inherited from the father and the other from the mother. The patient was diagnosed with lipoprotein lipase deficiency-related hyperlipoproteinemia. Acute symptoms including bloody stools, fever, and bloody ascites led to the consideration of acute pancreatitis, and the treatment involved fasting, plasma exchange, and whole blood exchange. Following the definitive diagnosis based on the genetic results, the patient was given a low-fat diet and received treatment with fat-soluble vitamins and trace elements, as well as adjustments to the feeding plan. After a 4-week hospitalization, the patient's condition improved and he was discharged. Follow-up showed a decrease in triglycerides and total cholesterol levels. At the age of 1 year, the patient's growth and psychomotor development were normal. This article emphasizes the multidisciplinary diagnosis and treatment of familial hyperlipoproteinemia presenting with symptoms suggestive of acute pancreatitis, including bloody ascites, in the neonatal period.

Research progress in mechanism of puerarin in treating vascular dementia / 中国中药杂志

Vascular dementia(VD) is a condition of cognitive impairment due to acute and chronic cerebral hypoperfusion. The available therapies for VD mainly focus on mitigating cerebral ischemia, improving cognitive function, and controlling mental behavior. Achievements have been made in the basic and clinical research on the treatment of VD with traditional Chinese medicine(TCM) active components, including Ginkgo leaf extract, puerarin, epimedium, tanshinone, and ginsenoside. Most of these components have anti-inflammatory, anti-apoptotic, anti-oxidant, and neuroprotective effects, and puerarin demonstrates excellent performance in mitigating cholinergic nervous system disorders and improving synaptic plasticity. Puerarin, ginkgetin, and epimedium are all flavonoids, while tanshinone is a diterpenoid. Puerariae Lobatae Radix, pungent in nature, can induce clear Yang to reach the cerebral orifices and has the wind medicine functions of ascending, dispersing, moving, and scurrying. Puerariae Lobatae Radix entering collaterals will dredge blood vessels to promote blood flow, and that entering the sweat pore will open the mind, which is in line with the TCM pathogenesis characteristics of VD. This study reviews the progress in the mechanism of puerarin, the main active component of Puerariae Lobatae Radix, in treating VD. Puerarin can ameliorate cholinergic nervous system disorders, reduce excitotoxicity, anti-inflammation, inhibit apoptosis, alleviate oxidative stress injury, enhance synaptic plasticity, up-regulate neuroprotective factor expression, promote cerebral circulation metabolism, and mitigate Aβ injury. The pathways of action include activating nuclear factor erythroid 2-related factor 2(Nrf2)/antioxidant response element(ARE), vascular endothelial growth factor(VEGF), extracellular regulated protein kinases(ERK), phosphatidylinositol-3-kinase(PI3K)/protein kinase B(Akt), Janus-activating kinase 2(JAK2)/signal transducer and activator of transcription 3(STAT3), AMP-activated protein kinase(AMPK), as well as inhibiting the tumor necrosis factor α(TNF-α), transient receptor potential melastatin 2(TRPM2)/N-methyl-D-aspartate receptor(NMDAR), p38 mitogen-activated protein kinase(p38 MAPK), Toll-like receptor 4(TLR4)/nuclear factor-kappaB(NF-κB), early growth response 1(Egr-1), and matrix metalloproteinase 9(MMP-9). By reviewing the papers about the treatment of VD by puerarin published by CNKI, Wanfang, VIP, PubMed, and Web of Science in the last 10 years, this study aims to support the treatment and drug development for VD.

Clinical symptoms and distribution characteristics traditional Chinese medicine syndromes of pulmonary nodules / 中国中药杂志

A cross-sectional study method combined with two types of traditional Chinese medicine(TCM) syndrome differentiation methods was adopted to investigate the clinical symptoms and distribution characteristics of TCM syndromes in patients with pulmonary nodules from the perspectives of number, size, nature, and stability of pulmonary nodules by using the χ~2 test, systematic clustering and Apriori algorithm correlation analysis. The common clinical symptoms of pulmonary nodules were fatigue(77.35%) and irritability(75.40%), and 40 symptoms were clustered into 3 groups(digestive system symptoms, respiratory system symptoms, and emotional and systemic symptoms) and 8 major symptom categories. The proportion of cold and heat in complexity syndrome(63.43%) was higher based on cold-heat syndrome differentiation. The top two syndromes were Qi deficiency syndrome(88.03%) and Qi depression syndrome(83.17%) based on disease syndrome differentiation. Yang deficiency syndrome(60.52%) was more than Yin deficiency syndrome(50.16%). There were higher proportions of phlegm syndrome(78.67%) and Yang deficiency syndrome(69.33%) of so-litary pulmonary nodules in terms of the number of pulmonary nodules. In terms of size, the proportion of phlegm syndrome decreased as the mean diameter of pulmonary nodules increased, while the proportions of Yang deficiency syndrome and blood stasis syndrome increased. The distribution of Qi depression syndrome was more in those with mean diameter<10 mm(85.02%, P=0.044) and cold syndrome was more in those with mean diameter ≥10 mm(16.67%, P=0.024). In terms of the nature of pulmonary nodules, the proportions of Qi depression syndrome and heat syndrome decreased with the increase in solid components of pulmonary nodules, while the proportions of Yin deficiency syndrome and cold and heat in complexity syndrome increased. The blood stasis syndrome accounted for a higher proportion of pulmonary nodules with solid components. In terms of the stability of pulmonary nodules, dampness syndrome(72.97%), blood stasis syndrome(37.84%), and cold and heat in complexity syndrome(70.27%) accounted for higher proportions. In addition, patients with new nodules presented higher proportions in Qi inversion syndrome(52.00%, P=0.007) and cold and heat in complexity syndrome(66.00%, P=0.008). Meanwhile, 11 syndromes were associated and 4 common compound syndromes were obtained(Qi deficiency and depression syndrome, Qi depression and phlegm coagulation syndrome, Qi deficiency and phlegm coagulation syndrome, and Qi deficiency and dampness obstruction syndrome). Qi deficiency syndrome and Qi depression syndrome could be associated with other syndromes. The results show that the main clinical symptoms of pulmonary nodules are fatigue and irritability. The main TCM syndromes of pulmonary nodules are Qi deficiency syndrome, Qi depression syndrome, Yang deficiency syndrome, and cold and heat in complexity syndrome. The distribution of TCM syndromes is significantly correlated with the size of pulmonary nodules and the presence or absence of new nodules. The common compound syndromes are Qi deficiency and depression syndrome, Qi depression and phlegm coagulation syndrome, Qi deficiency and phlegm coagulation syndrome, and Qi deficiency and dampness obstruction syndrome.

Mechanism of Buyang Huanwu Decoction in protecting ischemic myocardium by regulating platelet autophagy in rats with acute myocardial infarction / 中国中药杂志

This study explored the effects of Buyang Huanwu Decoction(BYHWD) on platelet activation and differential gene expression after acute myocardial infarction(AMI). SD rats were randomly divided into a sham-operated group, a model group, a positive drug(aspirin) group, and a BYHWD group. Pre-treatment was conducted for 14 days with a daily oral dose of 1.6 g·kg~(-1) BYHWD and 0.1 g·kg~(-1) aspirin. The AMI model was established using the high ligation of the left anterior descending coronary artery method. The detection indicators included myocardial infarct size, heart function, myocardial tissue pathology, peripheral blood flow perfusion, platelet aggregation rate, platelet membrane glycoprotein CD62p expression, platelet transcriptomics, and differential gene expression. The results showed that compared with the sham-operated group, the model group showed reduced ejection fraction and cardiac output, decreased peripheral blood flow, and increased platelet aggregation rate and CD62p expression, and activated platelets. At the same time, TXB_2 content increased and 6-keto-PGF1α content decreased in serum. Compared with the model group, BYHWD increased ejection fraction and cardiac output, improved blood circulation in the foot and tail regions and cardiomyocytes arrangement, reduced myocardial infarct size and inflammatory infiltration, down-regulated platelet aggregation rate and CD62p expression, reduced serum TXB_2 content, and increased 6-keto-PGF1α content. Platelet transcriptome sequencing results revealed that BYHWD regulated mTOR-autophagy pathway-related genes in platelets. The differential gene expression levels were detected using real-time quantitative PCR. BYHWD up-regulated mTOR, down-regulated autophagy-related FUNDC1 and PINK genes, and up-regulated p62 gene expression. The results demonstrated that BYHWD could regulate platelet activation, improve blood circulation, and protect ischemic myocardium in AMI rats, and its mechanism is related to the regulation of the mTOR-autophagy pathway in platelets.

The rules of acupoint selection of acupuncture and moxibustion for scrofula in ancient times / 中国针灸

Based on data mining technology, the rules of acupoint selection of acupuncture-moxibustion for scrofula in ancient times were analyzed. The relevant articles of acupuncture and moxibustion for scrofula were searched in the Chinese Medical Code, and the original article, acupoint name, acupoint characteristic, and acupoint meridian tropism, etc. were screened and extracted. The Microsoft Excel 2019 was used to establish a acupoint prescription database, and the frequency of acupoints as well as their meridian tropism and characteristics were analyzed. The SPSS21.0 was applied to perform cluster analysis of acupuncture prescriptions; the SPSS Modeler 18.0 was used to perform the association rules analysis of the neck and the chest-armpit acupoints, respectively. As a result, 314 acupuncture prescriptions were extracted, including 236 single-acupoint prescriptions and 78 multiple-acupoints prescriptions (53 for neck and 25 for chest-armpit). A total of 54 acupoints were involved, with a total frequency of 530. The top 3 commonly-used acupoints were Tianjing (TE 10), Zulinqi (GB 41) and Taichong (LR 3); the most commonly-used meridians were hand shaoyang meridian, foot shaoyang meridian, hand yangming meridian and foot yangming meridian; the most commonly-used special acupoints were he-sea points and shu-stream points. The cluster analysis obtained 6 clusters, and the association rule analysis obtained that the core prescriptions of the neck were Quchi (LI 11), Jianyu (LI 15), Tianjing (TE 10) and Jianjing (GB 21), while the core prescriptions of the chest-armpit were Daling (PC 7), Yanglingquan (GB 34), Danzhong (CV 17), Jianjing (GB 21), Waiguan (TE 5), Zhigou (TE 6), Yuanye (GB 22) and Zhangmen (LR 13). The core prescriptions obtained from association rule analysis by difference areas were basically consistent with those by cluster analysis of total prescriptions.