Résumé
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.