Research progresses on the cognitive impairment of Duchenne muscular dystrophy / 中华实用儿科临床杂志

Duchenne muscular dystrophy(DMD) is an X-linked hereditary neuromuscular disorder caused by dystrophin gene mutation.About 1/3 of DMD patients have cognitive impairment.Early detection of cognitive impairment is essential for early diagnosis and the quality of life.This review summarized the recent progress in the clinical features, pathogenesis, brain structure changes, and cognitive impairment intervention of DMD.

Comprehensive genetic diagnosis of patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and pathogenicity analysis of splice site variants in the DMD gene / 浙江大学学报（英文版）（B辑：生物医学和生物技术）

Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are caused by mutations in the DMD gene. The aim of this study is to identify pathogenic DMD variants in probands and reduce the risk of recurrence of the disease in affected families. Variations in 100 unrelated DMD/BMD patients were detected by multiplex ligation-dependent probe amplification (MLPA) and next-generation sequencing (NGS). Pathogenic variants in DMD were successfully identified in all cases, and 11 of them were novel. The most common mutations were intragenic deletions (69%), with two hotspots located in the 5' end (exons 2-19) and the central of the DMD gene (exons 45-55), while point mutations were observed in 22% patients. Further, c.1149+1G>A and c.1150-2A>G were confirmed by hybrid minigene splicing assay (HMSA). This two splice site mutations would lead to two aberrant DMD isoforms which give rise to severely truncated protein. Therefore, the clinical use of MLPA, NGS, and HMSA is an effective strategy to identify variants. Importantly, eight embryos were terminated pregnancies according to prenatal diagnosis and a healthy boy was successfully delivered by preimplantation genetic diagnosis (PGD). Early and accurate genetic diagnosis is essential for prenatal diagnosis/PGD to reduce the risk of recurrence of DMD in affected families.

Germinal mosaicism for partial deletion of the Dystrophin gene in a family affected with Duchenne muscular dystrophy / 中华医学遗传学杂志

Objective@#To carry out genetic testing and prenatal diagnosis for a family affected with Duchenne muscular dystrophy (DMD).@*Methods@#Multiplex ligation dependent probe amplification (MLPA) was used to detect potential deletion and duplication of the Dystrophin gene. Haplotype analysis was performed using five short tandem repeat polymorphism loci (3'-STR, 5'-STR, 45-STR, 49-STR, 50-STR of the DMD gene.@*Results@#A same deletional mutation (exons 51-55) of the DMD gene was detected in two brothers but not in their mother. The patients and fetus have inherited different haplotypes of the Dystrophin gene from their mother, suggesting that the fetus was unaffected.@*Conclusion@#The mother was very likely to harbor germline mosaicism for the Dystrophin gene variant. Genetic testing of peripheral blood samples cannot rule out germline mosaicism in the mother. Prenatal diagnosis should be provided for subsequent pregnancies in this family.

Comprehensive genetic diagnosis of patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and pathogenicity analysis of splice site variants in the DMD gene / 浙江大学学报（英文版）（B辑：生物医学和生物技术）

Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are caused by mutations in the DMD gene. The aim of this study is to identify pathogenic DMD variants in probands and reduce the risk of recurrence of the disease in affected families. Variations in 100 unrelated DMD/BMD patients were detected by multiplex ligation-dependent probe amplification (MLPA) and next-generation sequencing (NGS). Pathogenic variants in DMD were successfully identified in all cases, and 11 of them were novel. The most common mutations were intragenic deletions (69%), with two hotspots located in the 5′ end (exons 2–19) and the central of the DMD gene (exons 45–55), while point mutations were observed in 22% patients. Further, c.1149+1G>A and c.1150-2A>G were confirmed by hybrid minigene splicing assay (HMSA). This two splice site mutations would lead to two aberrant DMD isoforms which give rise to severely truncated protein. Therefore, the clinical use of MLPA, NGS, and HMSA is an effective strategy to identify variants. Importantly, eight embryos were terminated pregnancies according to prenatal diagnosis and a healthy boy was successfully delivered by preimplantation genetic diagnosis (PGD). Early and accurate genetic diagnosis is essential for prenatal diagnosis/PGD to reduce the risk of recurrence of DMD in affected families.

Analysis of two Chinese Han families with Duchenne/Becker muscular dystrophy / 上海交通大学学报（医学版）

Objective: To deepen the understanding of Duchenne/Becker muscular dystrophy by investigating dystrophin (DMD) gene variants in 2 Chinese Han families with this disease. Methods: Retrospective analysis of the clinical characteristics of the probands in two families with Duchnne/ Becker muscular dystrophy and the results of multiplex ligation-dependent probe amplification (MLPA) for the probands and their relatives was performed. Results: Three probands were identified by significantly-elevated creatine kinase levels. Two probands in family one are fraternal twin brothers with the same deletions of exons 8-9, while their mother has no abnormality at this site. The proband in family two is the little brother in a pair of fraternal twins with duplication of exons 48-51, and his mother has heterozygous duplication of exons 48-51. Conclusion: ① The presence of the same DMD gene mutation in the fraternal twins suggests that the mother may be a gonad chimera with this mutation if her gene detection of peripheral blood is normal. The mother must undergo prenatal gene diagnosis to reduce the risk of Duchenne/Becker muscular dystrophy in her offsprings. ② The exons 48-51 duplication of DMD gene is pathogenic mutation.

Exome sequencing discovered a novel splice donor mutation in dystrophin gene / 第二军医大学学报

Objective Todetect subtle mutations in the dystrophin gene by exome capturing using second-generation sequencing technique. Methods Exome capturing using second-generation sequencing technique was used to detect mutations of dystrophin gene in a patient with typical clinical manifestations of Duchenne muscular dystrophy (DMD), but without deletions or duplications in the dystrophin gene. The mutationswere verified by Sanger sequencing, and bioinformatics was employed to predict its influence on the coding. The patient's mother and 100 healthy volunteers were taken as controls. Results A base change in the first base of intron 50 (G>C) was found in dystrophin gene of the patient, and his mother was heterozygosis at the same site. Bioinformatics predicted that the 5' donor splicing site of intron 50 would disappear due to this base change, which would alter the amino acid sequence at the C terminal of corresponding peptide and result in the appearance of premature termination codon. Sanger sequencing confirmed that the base changewas a novil pathogenic mutation in the dystrophin gene, and it was absent in normal controls. Conclusion It is demonstrated that exome sequencing technique can effectively detect the subtle mutations in the dystrophin gene, which may contribute to bettermolecular diagnosis of DMD.

Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative / 中华神经科杂志

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Clinical Usefulness of Molecular Diagnosis in Dystrophin Gene Mutations Using the Multiplex Ligation-dependent Probe Amplification (MLPA) Method

BACKGROUND: Duchenne/Becker muscular dystrophy (DMD/BMD), which is the most common X-linked muscular dystrophy, is caused by mutations in the dystrophin gene. These mutations comprise deletions in approximately 55~65% of patients, duplications in 5~10%, and point mutations or small insertion/deletions in the remainder. Unfortunately, current diagnostic assays for dystrophin do not accurately detect duplication mutations or female carriers. In this study we employed multiplex ligation-dependent probe amplification (MLPA) analysis to detect deletions or duplications of the dystrophin gene in patients with DMD/BMD, and in potential female carriers. METHODS: A total of 41 subjects was recruited for this study, comprising 35 male DMD/BMD patients, 1 female patient with Turner syndrome, and 5 females with a family history of DMD/BMD. The MLPA method was employed to determine the copy number of each of the 79 exons of the dystrophin gene in the 41 subjects. RESULTS: MLPA analysis for dystrophin was informative in 71.4% (25/35) of patients with DMD/BMD patients, identifying deletions in 60.0% (21/35) and duplications in 11.4% (4/35). MLPA analysis showed the presence of a deletion of the DMD gene in one female patient with Turner syndrome. Of the five female patients with a family history of DMD/BMD, this assay revealed exon deletion in one and duplications in one. CONCLUSIONS: The reported findings reveal that the MLPA method is a powerful tool for detecting duplications and female carriers, as well as DMD gene deletions. MLPA should be considered the method of choice for an initial genetic analysis of DMD/BMD patients.

The development of relationship between DMD gene mutation and intelligence with Duchenne muscular dystrophy / 国际儿科学杂志

With the development of the molecular biology technic in recent years, the research about the relations between the type of gene mutation and the intelligence growth with the Duchenne muscular dystrophy (DMD) was developed.There are some connections in the intelligence and the type of gene mutation of the children with DMD. The children with DMD have lower intelligence when the mutation is after the 45 exon especially the 63 exon than before the 45 exon. It has more possibility to cause the lower intelligence when the the DMD gene mutation is closer to the end of 3'terminal.

A nonsense mutation effects mRNA splicing process of dystrophin gene

Background: Production of semi-functional dystrophin protein from the dystrophin gene encoded with a premature stop codon has been shown to modify the severe phenotype of Duchenne Muscular Dystrophy (DMD). The mutation of the dystrophin gene affects the process of complete mRNA and is important in gene therapy. Objective: To analyze the mutation of dystrophin gene in DMD cases. Subjects and methods: A patient with diagnosed with DMD when he was 2 years old, and at age 9, he was completely disabled and had to use a wheelchair. DNA and total RNA were extracted from fresh peripheral blood; cDNA was synthesized by transcript polymerase chain reaction (RT - PCR). PCR, nested PCR or sequence methods were used to determine the mutation of the dystrophin gene. Results: A nonsensical mutation (E638) due to a single nucleotide change in exon 17 of the dystrophin gene (GAA2047TAA) was identified. This mutation affects mRNA splicing process and induces complete exon 17 skipping. Conclusion: Patients, who had E638X mutation with exon 17 deletion in the dystrophin gene, had clinical symptoms of Becker Muscular Dystrophy (BMD). This discovery as a potential target for therapeutic strategies for DMD, to change the severe phenotype of DMD to a milder phenotype (BMD), in order to improve clinical conditions for the patients.

Development of Therapy for Duchenne Muscular Dystrophy / 中国修复重建外科杂志

Objective To review and summarize the latest development of the therapy for the Duchenne muscular dystrophy (DMD). Methods The recently-published articles related to the therapies for DMD were extensively reviewed and briefly summarized. Results The therapeutic approaches for DMD included the gene therapy, the cell therapy, and the pharmacological therapy.The gene therapy and the cell therapy were focused on the treatment for the cause of DMD by the delivery of the missing gene, the modification of the mutated gene, and the transfer of the normal cells including the stem cells, while the pharmacological therapy dealt with the downstream events caused by the dystrophin gene defect, slowed down the pathologic progress of DMD, and improved the DMD patient's life quality and life span, by medication and other factor treatments. Conclusion There is still no cure for DMD because of various difficulties in replacing or repairing the defected gene and of the multifaceted nature of the severe symptoms. Therefore, it is imperative for us to find out a more effective treatment that can solve these problems.

Repeating exon 2 mutation caused by trans-splicing dystrophin gene in Duchenne muscular dystrophin (DMD) patient

The dystrophin gene is the largest human gene. Mutations in this gene cause Duchenne muscular dystrophin (DMD) disease. This is complex genomic unit exhibiting many errors splicing during mRNA process. More than 10 alternative splicing products have been identified in the 5' region of the dystrophin gene. In this study, two dystrophin transcripts including one containing exon 2 and exon X duplications, other one containing single exon 2 duplication were identified in peripheral blood lymphocytes of DMD case. Interestingly, genomic Southern blot analysis ruled out the hypothesis of duplication of dystrophin at exon 2. Therefore, these data suggested that exon 2 duplication transcripts were likely generated by trans-splicing event that occurring during the mARN maturation in which RNA segments of two independent transcripts are spliced together to generate a new mRNA species. However, the mechanisms modulating the trans-splicing activity of the dystrophin exon 2 remain to be clarified.

Molecular Genetic Analysis of Dystrophin Gene in Duchenne/Becker Muscular Dystrophy / 대한소아신경학회지

PURPOSE: Duchenne/Becker muscular dystrophy(DMD/BMD) is an X-linked recessive disorder caused by mutations of dystrophin genes. The purpose of the present study is to determine the frequency and the patterns of dystrophin gene deletions and to investigate the correlation of genotypes and phenotypes. METHODS: There were included a total of 89 children(88 boys and 1 girl) diagnosed as DMD/BMD by immunohistochemistry and/or genetic analysis from 1999 to 2003 at Seoul National University Children's Hospital. We analyzed the genomic DNA by multiplex PCR using a 26 dystrophin exon primer set. Direct sequencing was performed on 23 exons(in which point mutations were detected in other previous reports) in 22 patients without deletions. Phenotype and genotype relationship analysis was performed on the basis of retrospective clinical reviews. RESULTS: The frequency of dysmorphin gene deletions was 54%(32/59), which is lower than that of European and American data. Exon deletions were detected in 59 cases and the deletion "hot spots" were exon 44-54 constituting 80% of all deletions. In 6 cases without detectable deletions, 6 point mutaions(3 nonsense mutations and 3 nucleotide variants) were detected. The patients whose deletions were in the central parts or the patients with multiple exon deletions tended to show earlier symptom onsets and more rapid progressions of weakness but there were no statistical significances. CONCLUSION: Since deletions in dystrophin genes were detected in about 50% of the patients, studies on dystrophin protein expressions using muscle biopsy samples must be done for correct diagnosis.

Molecular Genetic Analysis of Dystrophin Gene in Duchenne/Becker Muscular Dystrophy / 대한소아신경학회지

PURPOSE: Duchenne/Becker muscular dystrophy(DMD/BMD) is an X-linked recessive disorder caused by mutations of dystrophin genes. The purpose of the present study is to determine the frequency and the patterns of dystrophin gene deletions and to investigate the correlation of genotypes and phenotypes. METHODS: There were included a total of 89 children(88 boys and 1 girl) diagnosed as DMD/BMD by immunohistochemistry and/or genetic analysis from 1999 to 2003 at Seoul National University Children's Hospital. We analyzed the genomic DNA by multiplex PCR using a 26 dystrophin exon primer set. Direct sequencing was performed on 23 exons(in which point mutations were detected in other previous reports) in 22 patients without deletions. Phenotype and genotype relationship analysis was performed on the basis of retrospective clinical reviews. RESULTS: The frequency of dysmorphin gene deletions was 54%(32/59), which is lower than that of European and American data. Exon deletions were detected in 59 cases and the deletion "hot spots" were exon 44-54 constituting 80% of all deletions. In 6 cases without detectable deletions, 6 point mutaions(3 nonsense mutations and 3 nucleotide variants) were detected. The patients whose deletions were in the central parts or the patients with multiple exon deletions tended to show earlier symptom onsets and more rapid progressions of weakness but there were no statistical significances. CONCLUSION: Since deletions in dystrophin genes were detected in about 50% of the patients, studies on dystrophin protein expressions using muscle biopsy samples must be done for correct diagnosis.

Mutation analysis of dystrophin gene and clinical evaluation of phenotypes in X-linked dilated cardiomyopathy / 中国实用内科杂志

T is the etiologic mutation in this family.Screening of female carrier state and follow-up study of the confirmed carriers are important for X-liked DCM family.

Pattern of Exon Deletions of Dystrophin Gene in Korean Patients with Duchenne Muscular Dystrophy

OBJECTIVE: To investigate the pattern of exon deletions in Korean patients with Duchenne muscular dystrophy (DMD), and to find the correlation of the exon-deletion with clinical symptoms or laboratory findings. METHOD: Genomic DNA of the nine children with DMD were analyzed by the sets of multiplex PCR and one singlet PCR in total of fifteen primers of the dystrophin gene. The primers were made from the promotor, and the exons 3, 4, 6, 8, 12, 13, 43, 44, 47, 48, 50, 51, 52 and 60 of the dystrophin gene, respectively. RESULTS: Eight out of nine patients revealed exon deletions. The exon 3 was most commonly deleted (6 patients), and exon 48, 50 and 60 were second most common (2 patients). The exons 4, 6, 13, 44, 47 and 52 were not deleted in all patients. CONCLUSION: We found that the exons 3, 48, 50 and 60 are frequently deleted in Korean patients with DMD. The pattern of deletion was not correlate with clinical symptoms or laboratory findings.

Retroactive DNA analysis for sex determination and dystrophin gene by polymerase chain reaction with archived cytogenetic slides

We describe a rapid and efficient diagnostic method for sex determination and the dystrophin gene by the polymerase chain reaction (PCR) using archived cytogenetic slides. Archived cytogenetic slides stored for about 4 years at room temperature were used. To confirm whether DNA analysis is possible using the archived cytogenetic slides, we extracted the DNA from the slides and amplified the Y centromeric region (DYZ3), the X centromeric region (DXZ1) and the exon 46 of the dystrophin gene. Of the 50 cases, 24 were peripheral bloods, 13 were amniotic fluid cells, 5 were chorionic villus samplings and 8 were cord bloods. The PCR related sex determination in 22 females and 28 males, showed 100% concordance with the results of chromosome analysis, and all cases showed positive band for the exon 46 of the dystrophin gene. Of the 50 cases of the archived cytogenetic slides, we were fortunate enough to obtain the fresh blood sample from one fetus whose karyotype showed 45,X[34]/46,X,+mar[145] to compare the results of the gDNA with that from archived cytogenetic slide. To confirm whether the marker chromosome was derived from Y chromosome, we studied the six loci (PABY, SRY, RPS4Y (SY16, 17), ZFY, DYS14) on the short arm, one locus (DYZ3) on the centromere and one locus (DYZ1) on the long arm. Of the 8 loci studies, all PCR related Y chromosome showed positive band from both gDNA obtained from cord blood and archived cytogenetic slides. We could conclude from the above results that the marker chromosome was derived from the Y chromosome. We believe our experiment is rapid and efficient for studies of over 10 independent loci from a single slide which has been kept in storage for up to 4 years and that archival Giemsa-stained cytogenetic slide repositories represent valuable DNA resources for clinical and forensic studies.

Diagnosis of DMD/BMD by Multiplex PCR and Southern Blot Analysis / 대한산부인과학회잡지

Duchene and Becker muscular dystrophy(DMD/BMD) results from mutations in thedystrophin gene, and enormous genetic locus that spans more than two million base paris ofDNA on the human X chromosome. Some 60% of DMD patients exhibit deletions, which canbe found by cDNA hybridization or, were recently, by polymerase chain reaction analysis.We have used the multiplex PCR to identify deletion mutations in the human dystrophingene. By simultaneously amplifying genomic regions flanking 17 sepastrate exons inmutational hot spots, we were able to detect 16 exons in one family. The DNA encoding eachof the 17 exons in the dystrophin gene is copied a million fold to make it visible in anagarose gel. To be certain that the missing band is not artifact of the amplificationprocedure, the DNA from the blood sample was analyzed by Southern hybridization.