Your browser doesn't support javascript.
loading
Montrer: 20 | 50 | 100
Résultats 1 - 20 de 645
Filtre
1.
Rev. Assoc. Med. Bras. (1992, Impr.) ; 70(1): e20230720, 2024. tab
Article Dans Anglais | LILACS-Express | LILACS | ID: biblio-1529352

Résumé

SUMMARY BACKGROUND: Antioxidants have been considered a rational curative strategy to prevent and cure liver diseases involving oxidative stress. An acute obstructive jaundice rat model was established to investigate the in vivo hepatoprotective efficacy of Rosa pimpinellifolia L. METHODS: The experimental jaundice model was performed by binding the main bile duct in 25 male Sprague-Dawley rats. All rats were randomly divided into five groups: first group: laparotomy-sham-only, second group: biliary tract binding (control), and third, fourth, and fifth groups: treatment groups with 250, 500, and 750 mg/kg fruit extracts daily, respectively. RESULTS: Considering dosage, although there was no significant therapeutic effect in the 250 mg/kg of Rosa pimpinellifolia L. group, the best results were found in the 500 mg/kg dose group, while results in the 750 mg/kg dose group showed consistent correlation with proinflammatory response. With regard to biochemical parameters, lipid hydroperoxide level in the rat serum and liver tissue was significantly decreased in all treatment groups. Amadori products, which are one of the early markers of glycol-oxidative stress, showed statistical significance in the treatment. CONCLUSION: It was revealed that the antioxidant effect of Rosa pimpinellifolia L. was more prominent in the early stages of hepatic injury secondary to oxidative stress.

2.
Journal of Clinical Hepatology ; (12): 199-203, 2024.
Article Dans Chinois | WPRIM | ID: wpr-1006449

Résumé

Apical sodium-dependent bile acid transporter (ASBT) is a key transporter responsible for intestinal reabsorption of bile acid and plays an important role in maintaining bile acid and cholesterol homeostasis, and its expression is regulated by various factors including transcription factors, nuclear receptors, and intestinal microflora. The abnormal expression and function of ASBT can lead to disorders in the metabolism of bile acid and cholesterol, causing a variety of hepatobiliary diseases. At present, ASBT has attracted wide attention as a therapeutic target. This article elaborates on the biological characteristics and expression regulation mechanism of ASBT and reviews the role of ASBT in hepatobiliary diseases, in order to provide a new direction for the treatment of related diseases.

3.
Arq. gastroenterol ; 60(4): 438-449, Oct.-Nov. 2023. tab, graf
Article Dans Anglais | LILACS-Express | LILACS | ID: biblio-1527867

Résumé

ABSTRACT Background: Alpha 1-antitrypsin deficiency (AATD) is a hereditary codominant autosomal disease. This liver disease ranges from asymptomatic cases to terminal illness, which makes early recognition and diagnosis challenging. It is the main cause of pediatric liver transplantation after biliary atresia. Objective: To describe the clinical characteristics, as well as those of histologic and laboratory tests, phenotypic and/or genetic evaluation and evolution of a cohort of pediatric patients with AATD. Methods: This is a retrospective observational study of 39 patients with confirmed or probable AATD (without phenotyping or genotyping, but with suggestive clinical features, low serum alpha 1-antitrypsin (AAT) level and liver biopsy with PAS granules, resistant diastasis). Clinical, laboratory and histological varia­bles, presence of portal hypertension (PH) and survival with native liver have been analyzed. Results: A total of 66.7% of 39 patients were male (26/39). The initial manifestation was cholestatic jaundice in 79.5% (31/39). Liver transplantation was performed in 28.2% (11/39) of patients. Diagnosis occurred at an average of 3.1 years old and liver transplantation at 4.1 years of age. 89.2% (25/28) of the patients with confirmed AATD were PI*ZZ or ZZ. The average AAT value on admission for PI*ZZ or ZZ patients was 41.6 mg/dL. All transplanted patients with phenotyping or genotyping were PI*ZZ (or ZZ). Those who were jaundiced on admission were earlier referred to the specialized service and had higher levels of GGT and platelets on admission. There was no significant difference in the survival curve when comparing cholestatic jaundiced to non-cholestatic jaundiced patients on admission. Comparing patients who did or did not progress to PH, higher levels of AST and APRI score at diagnosis (P=0.011 and P=0.026, respectively) were observed and in the survival curves patients with PH showed impairment, with 20.2% survival with native liver in 15 years. Conclusion: Jaundice is an important clinical sign that motivates referral to a specialist, but it does not seem to compromise survival with native liver. Patients progressing to PH had higher AST, APRi score on admission and significantly impaired survival with native liver. It is important to pay attention to these signs in the follow-up of patients with AATD.


RESUMO Contexto: Deficiência de alfa 1-antitripsina (DAAT) é uma doença hereditária, de caráter autossômico codominante. A apresentação da doença hepática varia desde casos assintomáticos até doença terminal, o que dificulta reconhecimento e diagnóstico precoces. É a principal causa de transplante hepático pediátrico após atresia de vias biliares. Objetivo: Descrever as características clínicas, de exames laboratoriais, histológicos, avaliação fenotípica e/ou genética e sobrevida de uma coorte de pacientes pediátricos com DAAT. Métodos: Estudo observacional retrospectivo de 39 pacientes com diagnóstico de DAAT confirmada ou provável (sem fenotipagem ou genotipagem, mas com clínica sugestiva, baixo nível sérico de alfa 1-antitripsina (A1AT) e biópsia hepática com grânulos PAS, diástase resistentes). Variáveis clínicas, laboratoriais, histológicas, presença de hipertensão portal (HP) e sobrevida com fígado nativo foram analisadas. Resultados: Dos 39 pacientes, 66,7% eram do sexo masculino (26/39). A manifestação inicial foi icterícia colestática em 79,5% (31/39). Em 28,2% (11/39) houve necessidade de transplante hepático. O diagnóstico ocorreu com uma idade média de 3,1 anos e, o transplante hepático, 4,1 anos. Dos pacientes com DAAT confirmada, 89,2% (25/28) eram PI*ZZ ou ZZ. O valor médio de A1AT na admissão de pacientes PI*ZZ ou ZZ foi 41,6 mg/dL. Todos os transplantados com fenotipagem ou genotipagem eram PI*ZZ (ou ZZ). Os ictéricos à admissão foram referenciados mais cedo ao serviço especializado e apresentaram níveis mais elevados de GGT e plaquetas à admissão. Não houve diferença significativa na curva de sobrevida ao compararmos icterícia colestática ou não à admissão. Ao comparar os pacientes que progrediram ou não para HP, observou-se níveis mais elevados de AST e APRI escore ao diagnóstico (P=0,011 e P=0,026, respectivamente) e, nas curvas de sobrevida, pacientes com HP apresentaram comprometimento, com 20,2% de sobrevida com fígado nativo em 15 anos. Conclusão: Icterícia é um sinal clínico importante que motiva o encaminhamento ao especialista, mas parece não comprometer a sobrevida com fígado nativo. Pacientes com evolução para HP tiveram AST e escore APRi mais elevados à admissão e comprometimento significativo da sobrevida com fígado nativo. Importante atentar a esses sinais no seguimento de pacientes com DAAT.

4.
Rev. gastroenterol. Perú ; 43(4)oct. 2023.
Article Dans Espagnol | LILACS-Express | LILACS | ID: biblio-1536368

Résumé

La colangiopatía portal hace referencia a anomalías colangiográficas que se producen en pacientes con cavernomatosis portal, siendo progresiva, cursando con enfermedad biliar sintomática y anomalías graves de las vías biliares. Y, representa una complicación infrecuente de la hipertensión portal. Se describe el caso de un hombre de 53 años, con historia de larga data de hipertensión portal nocirrótica y cavernomatosis portal, quien presentó un episodio de enfermedad biliar obstructiva sintomática, y en estudios se documentó tejido fibrótico de extensión periportal ascendente con compresión extrínseca del colédoco distal y dilatación de la vía biliar extra e intrahepática. Por lo que se procedió a colangiopancreatografía retrógrada endoscópica, realizándose tratamiento paliativo, con papilotomía pequeña y colocación de endoprótesis biliar plástica, siendo exitoso por ausencia de complicaciones procedimentales, y mejoría clínica y parámetros bioquímicos. Finalmente, recibiendo de alta con indicación de seguimiento prioritario para recambios periódicos de endoprótesis biliares, y valoración por hepatología. La colangiopatía portal es una entidad rara que debe sospecharse en sujetos con hipertensión portal de origen no-cirrótico, con hallazgos imagenológicos de estenosis, angulaciones o dilataciones segmentarias, su tratamiento debe ser individualizado, y la terapia endoscópica es de elección en enfermedad biliar sintomática.


Portal cholangiopathy refers to cholangiographic abnormalities occurring in patients with portal cavernomatosis, being progressive, presenting with symptomatic biliary disease and severe biliary tract abnormalities. And, it represents an infrequent complication of portal hypertension. We describe the case of a 53-year-old man with a long history of non-cirrhotic portal hypertension and portal cavernomatosis, who presented an episode of symptomatic obstructive biliary disease, and studies documented fibrotic tissue of ascending periportal extension with extrinsic compression of the distal common bile duct and dilatation of the extra and intrahepatic biliary tract. Therefore, endoscopic retrograde cholangiopancreatography was performed, and palliative treatment with small papillotomy and placement of a plastic biliary endoprosthesis was successful due to the absence of procedural complications, and clinical improvement and biochemical parameters. Finally, the patient was discharged with indication of priority follow-up for periodic replacement of biliary stents, and evaluation by hepatology. Portal cholangiopathy is a rare entity that should be suspected in subjects with portal hypertension of non-cirrhotic origin, with imaging findings of stenosis, angulations or segmental dilatations, its treatment should be individualized, and endoscopic therapy is of choice in symptomatic biliary disease.

5.
Revista Digital de Postgrado ; 12(2): 362, ago. 2023. ilus, tab
Article Dans Espagnol | LILACS, LIVECS | ID: biblio-1517737

Résumé

La enfermedad de células falciformes (ECF) o anemia drepanocítica, es el trastorno hereditario más frecuente en los glóbulos rojos, y la enfermedad con más complicaciones en diferentes órganos, lo que provoca múltiples presentaciones de una misma enfermedad., se hace revisión literatura sobre ECF y colestasis intrahepática drepanocítica, y se describe un caso presentado en el Hospital General y de Especialidades Nuestra Señora de la Altagracia de Higüey Republica Dominicana en el año 2022. Es un varón de 24 años, con diagnóstico de ECF, que se complicó con una colestasis intrahepática drepanocítica muy severa que se manejó con hemodiálisis. El objetivo de publicar este caso es revisar la información respecto a la incidencia y la morbimortalidad de esta complicación, teniendo en cuenta que fue tratado por un equipo multidisciplinario usando la hemodiálisis como alternativa terapéutica(AU)


Sickle cell disease (SCD) or sickle cell anemia is the most common hereditary disorder in red blood cells, and the disease with the most complications in different organs, which causes multiple presentations of the same disease. Literature review on SCD is made and sickle cell intrahepatic cholestasis,and a case presented at the Hospital General y de Especialidades Nuestra Señora de la Altagracia de Higüey in the Dominican Republic in 2022 is described. Very severe sickle cell intrahepatic disease that was managed with hemodialysis. The purpose of publishing this case is to review the information regarding the incidence and morbidity and mortality of this complication,taking into account that it was treated by a multidisciplinary team using hemodialysis as a therapeutic alternative(AU)


Sujets)
Humains , Mâle , Adulte , Cholestase/complications , Cholestase intrahépatique/physiopathologie , Drépanocytose , Dialyse rénale , Érythrocytes , Insuffisance rénale
6.
Biomédica (Bogotá) ; 43(2): 164-170, jun. 2023. tab, graf
Article Dans Espagnol | LILACS | ID: biblio-1533933

Résumé

La hepatitis por Treponema pallidum es una entidad poco frecuente y su diagnóstico representa un reto clínico. Treponema pallidum debe considerarse como etiología presuntiva en todo paciente con enfermedad hepática aguda, en el cual se hayan descartado otras causas más frecuentes. Se presenta el caso de un paciente joven, inmunocompetente, quien presentó elevación de los valores de las pruebas hepáticas con patrón colestásico y lesiones maculopapulares en palmas y plantas. Dado su cuadro clínico, las pruebas diagnósticas y la respuesta a la terapia antimicrobiana instaurada, se estableció el diagnóstico de colestasis por una sífilis secundario sifilítiao. Es importante incluir la sífilis secundaria entre las posibles causas de enfermedad hepática aguda.


Hepatitis due to Treponema pallidum is a rare entity and its diagnosis represents a clinical challenge. Treponema pallidum should be considered as a presumptive etiology in all patients with acute liver disease, when other frequent causes have been ruled out. We present the case of a young, immunocompetent patient with elevated values in his liver tests, a cholestatic pattern, and maculopapular lesions on his palms and soles. Given his clinical picture, diagnostic tests, and response to the antimicrobial therapy, a diagnosis of cholestasis due to secondary syphilis has been established. It is important to include secondary syphilis within the possible causes of acute liver disease.


Sujets)
Treponema pallidum , Cholestase , Thérapeutique , Syphilis
7.
Rev. colomb. cir ; 38(3): 556-567, Mayo 8, 2023. fig
Article Dans Espagnol | LILACS | ID: biblio-1438590

Résumé

Introducción. Las neoplasias quísticas mucinosas del hígado son tumores poco frecuentes, equivalen a menos del 5 % de todas las lesiones quísticas hepáticas y se originan generalmente en la vía biliar intrahepática, con poco compromiso extrahepático. En la mayoría de los casos su diagnóstico es incidental dado que es una entidad generalmente asintomática con un curso benigno; sin embargo, hasta en el 30 % pueden ser malignas. En todos los casos se debe hacer una resección quirúrgica completa de la lesión. Caso clínico. Se presentan dos pacientes con diagnóstico de neoplasia quística mucinosa en la vía biliar intrahepática, así como sus manifestaciones clínicas, hallazgos imagenológicos y tratamiento. Discusión. Debido a su baja incidencia, esta patología constituye un reto diagnóstico, que se puede confundir con otro tipo de entidades más comunes. El diagnóstico definitivo se hace de forma histopatológica, pero en todos los casos, ante la sospecha clínica, se recomienda la resección completa. Conclusión. Se presentan dos pacientes con diagnóstico de neoplasias quísticas mucinosas del hígado, una entidad poco frecuente y de difícil diagnóstico


Introduction. Mucinous cystic neoplasms of the liver are rare tumors, accounting for less than 5% of all liver cystic lesions, and generally originate from the intrahepatic bile duct with little extrahepatic involvement. In most cases its diagnosis is incidental since it is a generally asymptomatic entity with a benign course; however, up to 30% can have a malignant course. In all cases, complete surgical resection of the lesion must be performed. Clinical case. Two patients with a diagnosis of mucinous cystic neoplasm in the intrahepatic bile duct are presented, as well as their clinical manifestations, imaging findings, and treatment. Discussion. Due to its low incidence, this pathology constitutes a diagnostic challenge, which can be confused with other types of more common entities. The definitive diagnosis is made histopathologically, but in all cases, given clinical suspicion, complete resection is recommended. Conclusion. Two patients with a diagnosis of mucinous cystic neoplasms of the liver are presented, a rare entity that is difficult to diagnose


Sujets)
Humains , Hépatectomie , Tumeurs de l'abdomen , Conduits biliaires , Cholestase , Foie
8.
Arch. argent. pediatr ; 121(2): e202202570, abr. 2023. tab, ilus, graf
Article Dans Anglais, Espagnol | LILACS, BINACIS | ID: biblio-1419111

Résumé

El shunt portosistémico congénito es una anomalía vascular venosa que comunica circulación portal y sistémica, por la que se deriva el flujo sanguíneo, salteando el paso hepático. Es una entidad poco frecuente, cuya incidencia varía entre 1/30 000 y 1/50 000 recién nacidos. Puede cursar de forma asintomática o presentarse con complicaciones en la edad pediátrica o, menos frecuente, en la edad neonatal. Ante el diagnóstico, se deberá definir la necesidad de intervención quirúrgica o intravascular para el cierre. Esta decisión depende de las características anatómicas de la malformación, de las manifestaciones clínicas y complicaciones presentes. Se presenta el caso de un paciente de un mes de vida derivado a nuestro centro para estudio de hepatitis colestásica neonatal, con diagnóstico de shunt portosistémico extrahepático. Se realizó cierre intravascular de la lesión con mejoría significativa posterior.


Congenital portosystemic shunt is a venous vascular abnormality that connects portal and systemic circulation, resulting in diversion of the blood flow, bypassing the hepatic passage. It is a rare malformation; its incidence varies from 1:30 000 to 1:50 000 newborns. It may be asymptomatic or present with complications in the pediatric age or, less frequently, in the neonatal age. Upon diagnosis, the need for a surgical or an intravascular intervention for closure should be defined. This decision depends on the malformation anatomical characteristics, clinical manifestations, and complications. We present the case of a 1-month-old patient referred to our center for the study of neonatal cholestatic hepatitis, with a diagnosis of extrahepatic portosystemic shunt. Intravascular closure of the defect was performed with significant subsequent improvement.


Sujets)
Humains , Mâle , Nouveau-né , Anastomose portosystémique intrahépatique par voie transjugulaire , Anomalies vasculaires/complications , Procédures endovasculaires , Hépatite/diagnostic , Hépatite/étiologie , Veine porte/malformations
9.
Article | IMSEAR | ID: sea-220103

Résumé

Background: Introduction: Intrahepatic cholestasis of pregnancy (ICP), is the most common liver disease specific to pregnancy. Previous studies of fetal effects have suggested that ICP is associated with a higher rate of adverse neonatal outcomes including preterm birth, neonatal respiratory distress syndrome (RDS), meconium-stained amniotic fluid, neonatal intensive care unit admission, and stillbirth. Material & Methods: This was a 4 year retrospective observational study including 43,344 female who delivered in our hospital out of which 1126 cases of ICP were identified, who were compared with 1136 age and parity matched controls. Results: : Previous history and family history of ICP was significant in the ICP group. Gestational diabetes and preterm labour were more frequent in the ICP group. Mean birth weight was lower in the ICP group, rate of small for gestational age foetuses was not significantly different. Cesearean section and post-partum haemorrhage was more frequent in the ICP group. Adverse neonatal outcomes i.e. respiratory distress syndrome (RDS) and need for NICU admission were more in the ICP group. Conclusion: ICP is associated with increased rate of preterm delivery, post-partum hemorrhage and increased neonatal morbidity. Management of patients with ICP should be individualized based on the severity of symptoms and associated medical complications.

10.
Article Dans Anglais | LILACS-Express | LILACS | ID: biblio-1535894

Résumé

Portal hypertensive biliopathy comprises the anatomical and functional abnormalities of the intra- and extrahepatic biliary tract, cystic duct, and gallbladder in patients with portal hypertension. The compromise of the bile duct usually occurs in portal obstruction due to the cavernous transformation of the portal vein (CTPV). We present a case of a young patient with a recent history of portal hypertension and CTPV who presented with an episode of cholestatic hepatitis. Studies documented an image of nodular appearance with extrinsic compression of the distal bile duct compatible with a tumor-like cavernoma. Effective endoscopic treatment was performed using endoscopic retrograde cholangiopancreatography (ERCP), sphincterotomy, and biliary stenting.


La biliopatía hipertensiva portal comprende las anomalías anatómicas y funcionales del tracto biliar intra- y extrahepático, el conducto cístico y la vesícula biliar en pacientes con hipertensión portal. El compromiso de la vía biliar suele presentarse en obstrucción portal debido a transformación cavernomatosa de la porta. Presentamos un caso de un paciente joven, con historia reciente de hipertensión portal y cavernomatosis de la porta, que presentó un episodio de hepatitis colestásica y en estudios se le documentó una imagen de apariencia nodular con compresión extrínseca de la vía biliar distal compatible con tumor-like cavernoma. En este caso se realizó un tratamiento endoscópico efectivo mediante colangiopancreatografía retrógrada endoscópica (CPRE), esfinterotomía y stent biliar.

11.
Article Dans Anglais | LILACS-Express | LILACS | ID: biblio-1449275

Résumé

ABSTRACT Objective: To describe the incidence and to analyze risk factors associated with cholestasis in neonates with gastroschisis. Methods: This is a retrospective cohort study in a tertiary single center analyzing 181 newborns with gastroschisis between 2009 and 2020. The following risk factors associated with cholestasis were analyzed: gestational age, birth weight, type of gastroschisis, silo closure or immediate closure, days of parenteral nutrition, type of lipid emulsion, days of fasting, days to reach a full diet, days with central venous catheter, presence of infections, and outcomes. Results: Among the 176 patients evaluated, 41 (23.3%) evolved with cholestasis. In the univariate analysis, low birth weight (p=0.023), prematurity (p<0.001), lipid emulsion with medium-chain triglycerides and long-chain triglycerides (p=0.001) and death (p<0.001) were associated with cholestasis. In the multivariate analysis, patients who received lipid emulsion with fish oil instead of medium chain triglycerides/long chain triglycerides (MCT/LCT) emulsion had a lower risk of cholestasis. Conclusions: Our study shows that lipid emulsion with fish oil is associated with a lower risk of cholestasis in neonates with gastroschisis. However, this is a retrospective study and a prospective study should be performed to confirm the results.


RESUMO Objetivo: Analisar a incidência e os fatores de risco associados à colestase em recém-nascidos com gastrosquise. Métodos: Estudo de coorte retrospectivo em um único centro terciário, que analisou 181 recém-nascidos com gastrosquise entre 2009 e 2020. Foram examinados os seguintes fatores de risco associados à colestase: idade gestacional, peso ao nascer, tipo de gastrosquise, fechamento com silo ou fechamento imediato, dias de uso nutrição parenteral, tipo de emulsão lipídica, dias de jejum, dias para atingir a dieta completa, dias com cateter venoso central, presença de infecções e desfechos. Resultados: Dos 176 pacientes avaliados, 41 (23,3%) evoluíram com colestase. Baixo peso ao nascer (p=0,023), prematuridade (p<0,001), emulsão lipídica com triglicerídeos de cadeia média e triglicerídeos de cadeia longa (p=0,001) e óbito (p<0,001) foram associados à colestase. Na análise multivariada, os pacientes que receberam emulsão lipídica com óleo de peixe em vez da emulsão diária de triglicérides de cadeia média/triglicérides de cadeia longa (MCT/LCT) apresentaram menor risco de colestase. Conclusões: Nosso estudo mostra que a emulsão lipídica com óleo de peixe está associada a menor risco de colestase em neonatos com gastrosquise, porém este é um estudo retrospectivo, e um estudo prospectivo deve ser realizado para confirmar os resultados.

12.
Rev. Col. Bras. Cir ; 50: e20233414, 2023. tab, graf
Article Dans Anglais | LILACS-Express | LILACS | ID: biblio-1431271

Résumé

ABSTRACT Neoplasms of the biliopancreatic confluence may present with obstruction of the bile tract, leading to jaundice, pruritus and cholangitis. In these cases drainage of the bile tract is imperative. Endoscopic retrograde cholangiopancreatography (ERCP) with placement of a choledochal prosthesis is an effective treatment in about 90% of cases, even in experienced hands. In cases of ERCP failure, therapeutic options traditionally include surgical bypass by hepaticojejunostomy (HJ) or percutaneous transparietohepatic drainage (DPTH). In recent years, endoscopic ultrasound-guided biliary drainage techniques have gained space because they are less invasive, effective and have an acceptable incidence of complications. Endoscopic echo-guided drainage of the bile duct can be performed through the stomach (hepatogastrostomy), duodenum (choledochoduodenostomy) or by the anterograde drainage technique. Some services consider ultrasound-guided drainage of the bile duct the procedure of choice in the event of ERCP failure. The objective of this review is to present the main types of endoscopic ultrasound-guided biliary drainage and compare them with other techniques.


RESUMO Neoplasias da confluência biliopancreática podem cursar com obstrução da via biliar, levando a icterícia, prurido e colangite. Nesses casos a drenagem da via biliar é imperativa. A colangiopancreatografia endoscópica retrógrada (CPER) com colocação de prótese coledociana constitui tratamento eficaz em cerca de 90% dos casos mesmo em mãos experientes. Nos casos de insucesso da CPER, tradicionalmente as opções terapêuticas incluem a derivação cirúrgica por hepaticojejunostomia (HJ) ou drenagem percutânea transparietohepática (DPTH). Nos últimos anos as técnicas endoscópicas ecoguiadas de drenagem biliar ganharam espaço por serem menos invasivas, eficazes e apresentarem incidência aceitável de complicações. A drenagem endoscópica ecoguiada da via biliar pode ser realizada pelo estômago (hepatogastrostomia), duodeno (coledocoduodenostomia) ou pela técnica de drenagem anterógrada. Alguns serviços consideram a drenagem ecoguiada da via biliar o procedimento de escolha no caso de insucesso da CPER. O objetivo desta revisão é apresentar os principais tipos de drenagem biliar endoscópica ecoguiada e confrontá-los com outras técnicas.

13.
Hepatología ; 4(3): 207-217, 2023. tab, fig
Article Dans Espagnol | COLNAL, LILACS | ID: biblio-1452027

Résumé

La tirotoxicosis es la manifestación clínica de una liberación excesiva de hormonas tiroideas, asociada o no a una función glandular autónoma; en este primer escenario, se denomina específicamente hipertiroidismo. Las principales etiologías son la enfermedad de Graves (EG), el adenoma tóxico, el bocio multinodular tóxico y el grupo de tiroiditis, predominando sus formas aguda y subaguda. La EG es la forma más común de hipertiroidismo, representando entre el 60 % y el 80 % de los casos, con una mayor incidencia en personas entre 40 y 60 años. Se ha descrito un compromiso hepático entre 45 % y el 90 % de pacientes con hipertiroidismo. Presentamos el caso de un hombre de 47 años con tirotoxicosis secundaria a enfermedad de Graves con compromiso bioquímico hepático manifestado como colestasis intrahepática refractaria al tratamiento médico en el corto plazo, tratado exitosamente con plasmaféresis como terapia puente a tiroidectomía total, proporcionando un análisis de la respuesta a la terapia a través de un cambio en los niveles de tiroxina libre (T4) y bilirrubina total a lo largo de su evolución.


Thyrotoxicosis is the clinical manifestation of excessive thyroid hormone release, whether or not asso-ciated with autonomous glandular function; in this first scenario, it is specifically termed hyperthyroi-dism. The main etiologies are Graves' disease (GD), toxic adenoma, toxic multinodular goiter ant the group of thyroiditis, predominantly acute and subacute forms. GD is the most common form of hyperthyroidism, accounting for 60% to 80% of cases, with a higher incidence among people aged 40 to 60 years. Liver involvement has been reported in 45% to 90% of patients with hyperthyroi-dism. We present the case of a 47-year-old man with thyrotoxicosis secondary to Graves' disease with hepatic biochemical involvement manifested as intrahepatic cholestasis refractory to medical management in the short term, successfully treated with plasmapheresis as bridge therapy to total thyroidectomy, providing an analysis of the response to therapy through a change in free thyroxine (T4) and total bilirubin levels throughout his evolutio


Sujets)
Humains
14.
Arch. pediatr. Urug ; 94(1): e302, 2023. ilus
Article Dans Espagnol | LILACS, UY-BNMED, BNUY | ID: biblio-1420114

Résumé

El síndrome de Alagille es una patología poco frecuente, de herencia autosómica dominante. Se caracteriza por la presencia de colestasis crónica progresiva ocasionada por hipoplasia de las vías biliares; anomalías vertebrales, oculares y cardíacas, y fenotipo facial particular. Entre sus diagnósticos diferenciales se incluyen las infecciones, enfermedades endocrinometabólicas, atresia biliar y causas idiopáticas. El pronóstico de este síndrome es variable y depende de la entidad de la afectación hepática y los defectos cardiovasculares. El abordaje terapéutico suele ser interdisciplinario e individualizado, enfocado en el control sintomático, prevención de la malnutrición y el déficit de vitaminas liposolubles. Se presenta el caso de un lactante de 2 meses en el que se estudiaron las causas más frecuentes de colestasis y se llegó al diagnóstico de síndrome de Alagille. Se describe su abordaje terapéutico y seguimiento.


Alagille syndrome is an inherited autosomal dominant rare disease. It is characterized by the presence of progressive chronic cholestasis caused by hypoplasia of the bile ducts; vertebral, ocular and cardiac anomalies, and particular facial phenotype. Its differential diagnoses include infections, endocrine-metabolic diseases, biliary atresia and idiopathic causes. The prognosis of this syndrome is variable and depends on the degree of liver involvement and cardiovascular defects. The therapeutic approach is usually interdisciplinary and customized, focused on symptomatic control, prevention of malnutrition and fat-soluble vitamin deficiency. We present the case of a 2-month-old infant in whom the most frequent causes of cholestasis were studied and to whom Alagille Syndrome was diagnosed. We hereby describe its therapeutic approach and follow-up.


A síndrome de Alagille é uma doença rara, hereditária, autossômica e dominante. Caracteriza-se pela presença de colestase crônica progressiva causada por hipoplasia das vias biliares; anomalias vertebrais, oculares e cardíacas e fenótipo facial particular. Seus diagnósticos diferenciais incluem infecções, doenças endócrino-metabólicas, atresia biliar e causas idiopáticas. O prognóstico desta síndrome é variável e depende do grau de envolvimento hepático e defeitos cardiovasculares. A abordagem terapêutica geralmente é interdisciplinar e personalizada, focada no controle sintomático, prevenção da desnutrição e deficiência de vitaminas lipossolúveis. Apresentamos o caso de uma criança de 2 meses de idade em que foram estudadas as causas mais frequentes de colestase e a quem foi diagnosticada Síndrome de Alagille. Descrevemos a sua abordagem terapêutica e seguimento.


Sujets)
Humains , Femelle , Nourrisson , Cholestase/diagnostic , Syndrome d'Alagille/diagnostic , Acide ursodésoxycholique/usage thérapeutique , Vitamines Liposolubles , Cholestase/étiologie , Cholestase/traitement médicamenteux , Syndrome d'Alagille/complications , Syndrome d'Alagille/thérapie , Diagnostic différentiel
15.
Acta Pharmaceutica Sinica ; (12): 3408-3420, 2023.
Article Dans Chinois | WPRIM | ID: wpr-999085

Résumé

In this study, the mechanism of Xiaoyan Lidan formula (XYLDF) against 3,5-diethoxycarbonyl-1,4-dihydro-2,4,6-collidine (DDC)-induced chronic intrahepatic cholestasis (CIHC) in mice was investigated based on metabolomics, molecular docking and pharmacological methods. In the pharmacodynamics study, a dosage of 5 g·kg-1 (clinical equivalent) XYLDF was administered in DDC-induced mice, then the effect of XYLDF against CIHC was evaluated by measuring the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (AKP) as well as total bilirubin (TBIL) in serum and observing liver histopathological changes. All experiments were approved by the Ethical Committee Experimental Animal Center of Guangzhou University of Chinese Medicine (ZYD-2021-001). The serum metabolites of mice in each group were detected and identified based on ultra-performance liquid chromatography quadrupole time-of-flight tandem mass spectrometry, and the relevant biological pathways and molecular key targets were further enriched. Molecular docking technology was used to further evaluate the binding activity of the main active ingredients of XYLDF with potential targets. Subsequently, the in vitro experiment was conducted for the validation of the vital target. The results showed that compared with the model group, XYLDF significantly decreased the levels of ALT, AST, AKP and TBIL in the serum of CIHC mice, as well as alleviated inflammatory infiltration and hepatocyte necrosis in liver tissue. According to the metabonomic study, a total of 35 differential metabolites was identified as biomarkers associated with cholestasis, 12 of which were significantly recovered by XYLDF treatment. These biomarkers were involved in the pathways of primary bile acid biosynthesis and linoleic metabolism, which are closely related to the mechanism of XYLDF against CIHC. Protein-protein interaction network indicated that cytochrome P450 3A4 (CYP3A4) and cytochrome P450 1A1 (CYP1A1) are significant potential targets with good binding properties with six major active ingredients of XYLDF. Furthermore, it was found that 4-methoxy-5-hydroxycanthin-6-one, dehydroandrographolide and isodocarpin, three of the main active components in XYLDF, markedly induced the expression of CYP3A4 mRNA in vitro. This study revealed that XYLDF mainly mediates the biosynthesis of bile acids in CIHC mice to improve liver tissue lesions and bile efflux disorders, among which, CYP3A4 is the key target in the protection of XYLDF against CIHC. This research provides a reference for further elucidation of the pharmacological mechanism of XYLDF.

16.
Chinese Journal of Applied Clinical Pediatrics ; (24): 457-460, 2023.
Article Dans Chinois | WPRIM | ID: wpr-990060

Résumé

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

17.
International Journal of Pediatrics ; (6): 410-414, 2023.
Article Dans Chinois | WPRIM | ID: wpr-989105

Résumé

Objective:To explore the multidisciplinary management that centred on gastroenterology department, and follow-up study of children with Alagille syndrome(ALGS).Methods:The clinical data of 19 children diagnosed with ALGS in Pediatric Gastroenterology Department, Shengjing Hospital of China Medical University since June 2013 to December 2022 was retrospectively analyzed, and the clinical manifestations of various systems of the body were followed up and evaluated, and then developed the personalised management strategies.Results:Among the 19 confirmed patients, 18 cases were confirmed by genetic testing.Eighteen cases(94.7%) had characteristic facial features.To follow-up node, 8 cases(42.1%) had cholestasis, with alanine aminotransferase(210.20±110.50)U/L, aspartate aminotransferase(187.86±96.70)U/L, and direct bilirubin(110.93±108.15)μmol/L.Eighteen cases(94.7%) had pruritus.Eighteen cases(94.7%) of the patients had a high risk of malnutrition, and the level of total bilirubin[(76.17±107.34)μmol/L] and total bile acid[(100.18±83.78)μmol/L] were significantly increased in the children with obvious growth retardation.Thirteen cases(68.42%) had diffuse liver injury.The clinical opinions on genetic counseling, application of new drugs, liver transplantation, cardiac medicine and surgery follow-up, spine and oral surgery orthodontics were given by multiple disciplines.Conclusion:ALGS children have a high risk of long-term malnutrition and are associated with the severity of liver injury, and pruritus and jaundice are the main clinical manifestations.The management of ALGS patients should be centered around liver disease doctors, combined with multiple disciplines, paying attention to changes in various related organs of ALGS patients, and improving their quality of life.

18.
Journal of Clinical Hepatology ; (12): 2959-2964, 2023.
Article Dans Chinois | WPRIM | ID: wpr-1003291

Résumé

Cholestatic liver disease is a common disease of the hepatobiliary system. Its etiology and pathogenesis are complex. The establishment of an appropriate animal model of cholestatic liver disease is the basis for further study of its pathogenesis and prevention. This study summarized the existing modeling methods, mechanisms, and characteristics of this model, and analyzed its alignment with the clinical disease and syndrome characteristics of integrated traditional Chinese and Western medicine based on the modern clinical diagnostic criteria and traditional Chinese medicine syndrome characteristics of cholestatic liver disease, so as to provide a reference for establishing standard animal models and evaluation methods for cholestatic liver disease that accord better with the clinical practice of integrated traditional Chinese and Western medicine.

19.
Journal of Clinical Hepatology ; (12): 864-875, 2023.
Article Dans Chinois | WPRIM | ID: wpr-971843

Résumé

Objective To investigate the therapeutic effect of Yudantong decoction in mice with α-naphthyl isothiocyanate (ANIT)-induced cholestasis, as well as its targets and mechanism based on intestinal flora and intestinal barrier function. Methods A total of 24 C57BL/6 mice were randomly divided into control group, model group, Yudantong decoction group (YDTF group), and ursodeoxycholic acid (UDCA) group, with 6 mice in each group. The mice in the model group, the YDTF group, and the UDCA group were given ANIT 35 mg/kg/day by gavage on days 1, 4, 7, 10, and 13, and those in the YDTF group and the UDCA group were given Yudantong decoction or UDCA by gavage for 15 consecutive days; related samples were collected on day 16. Liver histopathology was observed, and liver function parameters were measured; immunohistochemistry was used to measure the protein expression levels of caspase-1, interleukin-1β (IL-1β), and FXR in the liver, and flow cytometry was used to measure the percentages of CD11b + , CD86 + , and CD45 + immune cells in the liver; 16S rDNA sequencing and information analysis were performed for fecal microorganisms; immunohistochemistry was used to measure the protein expression of the intestinal FXR/NLRP3 pathway, and immunofluorescence assay was used to measure the protein expression of intestinal E-cadherin and occludin. A one-way analysis of variance was used for comparison of continuous data with homogeneity of variance between multiple groups, and the least significant difference t -test was used for further comparison between two groups; the Welch test was used for comparison of data with heterogeneity of variance between multiple groups, and the Games-Howell test was used for further comparison between two groups. Results HE staining showed that the model group had partial hepatocyte fatty degeneration, massive necrosis of hepatocytes in hepatic lobules, damage of lobular structure, and massive inflammatory cell infiltration, and the YDTF group and the UDCA group had alleviation of hepatocyte fatty degeneration and hepatocyte necrosis in hepatic lobules, with a reduction in inflammatory cells. Compared with the control group, the model group had significantly higher serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transpeptidase (GGT), alkaline phosphatase (ALP), total bilirubin (TBil), direct bilirubin (DBil), and total bile acid (TBA) (all P < 0.05); compared with the model group, the YDTF group had significant reductions in the serum levels of ALT, AST, GGT, ALP, TBil, DBil, and TBA (all P < 0.05), and the UDCA group had significant reductions in the serum levels of GGT, TBil, DBil, and TBA (all P < 0.05). Compared with the control group, the model group had significant increases in the levels of caspase-1 and IL-1β and a significant reduction in the expression of FXR in the liver (all P < 0.05); compared with the model group, the YDTF group had significant reductions in the levels of caspase-1 and IL-1β in the liver and the UDCA group had a significant reduction in the level of IL-1β in the liver, and both the YDTF group and the UDCA group had a significant increase in the expression level of FXR in the liver (all P < 0.05). The model group had a significant change in the composition of intestinal flora compared with the control group ( P < 0.05); there was a significant difference in the structure of intestinal flora between the YDTF group and the model group ( P < 0.05), and there was also a significant difference in the composition of intestinal flora between the UDCA group and the control/model groups ( P < 0.05). Compared with the control group, the model group had a significant increase in the abundance of intestinal Akkermansia muciniphila and a significant reduction in the abundance of Lactobacillus johnsonii (both P < 0.05); compared with the model group, both the YDTF group and the UDCA group had a significant reduction in the abundance of intestinal Akkermansia muciniphila , and the YDTF group had a significant increase in the abundance of Lactobacillus murinus , while the UDCA group had significant increases in the abundance of Lactobacillus murinus and Bifidobacterium pseudolongum (all P < 0.05). Compared with the control group, the model group had a significant reduction in the protein expression of intestinal FXR, a significant increase in the protein expression of intestinal NLRP3, and significant reductions in the expression of intestinal E-cadherin and occludin (all P < 0.05); compared with the model group, both the YDTF group and the UDCA group had a significant increase in the protein expression of intestinal FXR, a significant reduction in the protein expression of intestinal NLRP3, and significant increases in the expression of intestinal E-cadherin and occludin (all P < 0.05). Conclusion Yudantong decoction can alleviate liver injury in mice with ANIT-induced cholestasis, possibly by improving intestinal flora and enhancing intestinal barrier function.

20.
Chinese Journal of Contemporary Pediatrics ; (12): 639-644, 2023.
Article Dans Chinois | WPRIM | ID: wpr-982006

Résumé

OBJECTIVES@#To explore the value of the combined use of aspartate aminotransferase-to-platelet ratio index (APRI) and total bile acid (TBA) for predicting parenteral nutrition-associated cholestasis (PNAC) in preterm infants with gestational age <34 weeks.@*METHODS@#A retrospective analysis was performed on medical data of 270 preterm infants born at <34 weeks of gestation who received parenteral nutrition (PN) during hospitalization in the First Affiliated Hospital of Wannan Medical College from January 2019 to September 2022, including 128 infants with PNAC and 142 infants without PNAC. The medical data between the two groups were compared, and predictive factors for the development of PNAC were explored through multivariate logistic regression analysis. The receiver operating characteristic (ROC) curve was used to evaluate the value of APRI alone, TBA alone, and the combination of both for predicting PNAC.@*RESULTS@#TBA levels in the PNAC group after 1, 2, and 3 weeks of PN were higher than those in the non-PNAC group (P<0.05). APRI in the PNAC group after 2 and 3 weeks of PN was higher than that in the non-PNAC group (P<0.05). Multivariate logistic regression analysis showed that elevated APRI and TBA after 2 weeks of PN were predictive factors for PNAC in preterm infants (P<0.05). ROC curve analysis showed that the sensitivity, specificity, and area under the curve (AUC) for predicting PNAC by combining APRI and TBA after 2 weeks of PN were 0.703, 0.803, and 0.806, respectively. The AUC for predicting PNAC by combining APRI and TBA was higher than that of APRI or TBA alone (P<0.05).@*CONCLUSIONS@#After 2 weeks of PN, the value of combining APRI and TBA for predicting PNAC is high in preterm infants with gestational age <34 weeks.


Sujets)
Nouveau-né , Nourrisson , Humains , Âge gestationnel , Prématuré , Études rétrospectives , Acides et sels biliaires , Nutrition parentérale , Transaminases
SÉLECTION CITATIONS
Détails de la recherche