Estudio de métodos químicos de remoción de cianuro presente en residuos de cianuración provenientes del proceso de extracción de oro de veta en el departamento de Nariño / Study f chemicall methods for cyanide removal from cyaidation waste ccoming from the gold vein extraction process in the department of narñoo

Esta investigación se centró en la neutralización a nivel de laboratorio de residuos cianurados provenientes de la mina Nueva Esparta ubicada en el municipio de los Andes-Sotomayor (Nariño), con tres neutralizantes de tipo comercial en distintas relaciones en peso (gramos de neutralizante/gramos de CN- libre/total a neutralizar): peróxido de hidrógeno H2O2 2/1, 5/1 y 8/1, hipoclorito de sodio NaOCl 7/1, 12/1 y 17/1 y sulfato ferroso FeSO4 6/1, 12/1 y 18/1. Las arenas residuales se trataron así: lavado con agua, neutralización del agua de lavado y recirculación de la misma para un nuevo lavado; esto con el objeto de minimizar la cantidad de agua empleada. Después del análisis estadístico y teniendo en cuenta consideraciones técnicas, económicas y ambientales, se encontró que los mejores tratamientos para la remoción de cianuro libre y total son respectivamente las relaciones 2/1 y 5/1 del H2O2. Se realizó una caracterización fisicoquímica de la fuente de agua afectada por la actividad de la mina en estudio, de la solución pobre de cianuro y soluciones lixiviadas en laboratorio. En la evaluación de los metales Fe, Cu, Ni, Zn, Mn y Pb se observó que luego de la neutralización con H2O2, los metales analizados disminuyeron su concentración; con NaOCl se presentó un incremento en la mayoría, con una remoción mínima de plomo y manganeso. Con FeSO4, se obtuvo remoción para la mayoría, pero plomo y manganeso se incrementaron.

This research focused on laboratory-scale neutralization of cyanide wastes from the Nueva Esparta mine in the municipality of Los Andes, Sotomayor (Nariño) with three commercial type neutralizers in different weight ratios (neutralizer grams / CN-free/total to be neutralized): hydrogen peroxide H2O2 2/1, 5/1 and 8/1, sodium hypochlorite NaOCl 7/1, 12/1 and 17/1 and ferrous sulfate FeSO4 6/1, 12/1 and 18/1. Residual sands were treated as follows: washing with water, neutralization of the washing water and circulation of the same water for a new washing process, this with the purpose of minimizing the quantity of water used. After the statistic analysis and taking into account technical, economical and environmental considerations, it was found that the best treatments for removing free and total cyanide are respectively the relations 2/1 and5/1 from H2O2. A physical-chemical characterization of the water source affected by the activity on the poor cyanide solution and solutions lixiviated in the laboratory of the mine under study was performed. In the evaluation of the metals Fe, Cu, Ni, Zn, Mn and Pbit was observed that after the neutralization with con H2O2, the analyzed metals diminished their concentration. There was an increase in the majority With NaOCl woth a minimum removal of lead and manganese. With FeSO4 there was removal for the majority but lead and manganese increased.

Extracción rápida de DNA y validación por PCR para la detección directa de Listeria monocytogenes en leche cruda

Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2 percent w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100 percent were found, predictive positive and negative values were of 100 percent respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method) provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.