Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Crouzon disease--a case report.

The present case of a ten year old boy with craniofacial dysostosis with the features of midfacial hypoplasia is a disease known as Crouzon disease. This disease is characterised by cranial deformities, facial malformation, eye changes and occasional other associated abnormalities. The aim of this case is to discuss the clinical, radiographic features and management of the problems.

Management of teeth with open apices and necrotic pulps with single visit apexification: 3 representative cases.

Apexification is the most widely accepted procedure for the treatment of nonvital immature teeth. Single visit apexification is less time consuming, more economical and an easily acceptable technique with the aim of inducing the formation of a hard tissue barrier, thus allowing proper condensation of gutta percha in the root canal. Factors considered during this procedure are: i. Debridement of root canal minimizing the infection and filling the root canal space with resorbable calcification inducing material i.e. Ca(OH)2. ii. Minimal mechanical intervention to maintain the integrity and vascularity of apical region. Once filled, Ca(OH)2 was not changed again and the treated tooth was examined only radiographically till the desired apical closure was achieved. Three representative cases treated with this single visit apexification technique are discussed here. In all the cases successful apical closure of different types was achieved. Treatment was then concluded with gutta percha obturation in all the cases with successful follow up.

Effects of designs of Class 2 preparations on resistance of teeth to fracture.

This study was designed to evaluate the effect of isthmus width on the strength of the remaining tooth structure in maxillary first premolars restored with class 2 silver amalgam restorations. One hundred ten sound maxillary first premolars freshly extracted as a part of orthodontic treatment were collected. The teeth were then divided into 10 groups of 11 teeth each. Ideal class 2 mesio-occlusal, disto-occlusal and mesio-occlusodistal cavities with different isthmus widths i.e. one half the intercuspal distance, one third the intercuspal distance and one fourth the intercuspal distance and one fourth the intercuspal distance were prepared. Compressive forces were applied using a Universal Testing Machine and load to the point of fracture was determined. Intact teeth produced the best tooth fracture resistance i.e. 105.4 MPa, followed by preparations with isthmus width of one fourth, one third and one half intercuspal distance in the order.

Effect of chemotherapy on cell counts in peripheral blood & bronchoalveolar lavage of patients with pulmonary tuberculosis.

Cell counts in peripheral blood and bronchoalveolar lavage fluid were estimated in 38 patients with active tuberculosis; 12 patients with tuberculosis who had successfully completed more than 9 months of chemotherapy with isoniazid, rifampicin, and ethambutol; 10 Mantoux negative bronchitic subjects; and 6 control subjects. There were 50 males and 16 females aged 16-50 yr. Age, haemoglobin, total and differential serum proteins, were comparable in the various groups. Patients with active tuberculosis had higher ESR and significantly raised absolute (2.24 +/- 0.13 x 10(3); P less than 0.05), B (0.56 +/- 0.03 x 10(3); P less than 0.01) and Null lymphocyte counts (0.56 +/- 0.05 x 10(3); P less than 0.01) in blood. After chemotherapy there was no significant change in lymphocyte counts (2.43 +/- 0.21; P greater than 0.05). In bronchoalveolar lavage (BAL) total cell counts were increased five fold in patients with active disease (40.8 +/- 5.79 x 10(4)/ml) and although these showed considerable reduction after therapy they were higher (18.33 +/- 4.73 x 10(4)/ml) than those in controls (8.3 +/- 1.2 x 10(4)/ml; P greater than 0.05). In bronchitic subjects, total cell counts and macrophage counts in BAL fluid were elevated (P less than 0.01; less than 0.05 respectively) but lymphocyte counts were comparable to controls (3.4 +/- 1.35 x 10(4)/ml vs 1.09 +/- 0.19 x 10(4)/ml; P greater than 0.05). Lymphocytosis in the bronchoalveolar lavage fluid of patients with pulmonary tuberculosis persisted even after adequate treatment.

Monocyte/macrophage functions & humoral response in blood & bronchoalveolar lavage fluid of pulmonary tuberculosis patients.

Subsegmental bronchoalveolar lavage (BAL) was performed in 33 patients with active pulmonary tuberculosis and five control subjects. Phagocytosis by monocytes and alveolar macrophages was studied, and in addition serum and BAL immunoglobulin and complement levels were also determined. The phagocytic activity of blood monocytes was depressed in pulmonary tuberculosis patients as compared to controls, 37.8 +/- 2.3 per cent; 50.7 +/- 4.2 per cent and 32.9 +/- 3.6 per cent for sheep RBC's, latex and Staphylococcus aureus respectively compared to 66.7 +/- 6, 54.8 +/- 2.2 and 68.3 +/- 3.5 per cent respectively in controls; the differences being significant for sheep RBC's (P less than 0.05) and Staph. aureus (P less than 0.001). However, phagocytosis was not impaired in BAL macrophages (P greater than 0.05). In patients no significant alteration in serum immunoglobulin and complement levels was observed except that levels of C4 component of complement were increased in patients with far advanced lesions (98.5 +/- 33.7 mg/dl compared to 78.7 +/- 7.9 mg/dl; P less than 0.05). While IgM and C4 component of complement could not be detected in BAL fluid the levels of IgA were significantly increased in pulmonary tuberculosis patients (65.5 +/- 50.5 mg/dl compared to 39.9 +/- 13.3 mg/dl in control; P less than 0.05). Since IgA secreted in the BAL fluid is mostly synthesised locally, increased levels of this immunoglobulin could be of value in determining activity of the disease.