Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 4 de 4
Filtrar
Adicionar filtros








Intervalo de ano
1.
International Journal of Traditional Chinese Medicine ; (6): 517-521, 2018.
Artigo em Chinês | WPRIM | ID: wpr-693639

RESUMO

Objective To analyze the treatment and medication rules of formulae containing prepared rehmannia root in Pharmaceutical Standard of Ministry of Public Health of the People's Republic of China-Traditional Chinese Patent Medicine (referred to as Traditional Chinese Patent Medicine). Methods Through Traditional Chinese Medicine Inheritance Support Platform (V2.5), prescriptions containing prepared rehmannia root in traditional Chinese patent medicine were selected and collected to build the database. Frequency counts,association rules and other data mining methods were used to analyze the frequency of indication syndromes and medicine combination of prescription containing prepared rehmannia root, and the compatibility rule of high frequency drug pairs and the rescription rule of core syndromes were analyzed. Results There were a total of 467 prescriptions containing pepared rehmannia root, involving 28 combinations of commonly used Chinese herbals (support degree 30%). The compatibility source of high-frequency drug pairs of prepared rehmannia root and Angelicae Sinensis, prepared rehmannia root and Astragalus embranaceus were both of Shiquan-Dabu decoction in Taiping Huimin Heji Ju Fang (support degree 40%). There were a total of 81 indication syndromes, and among them, there were 16 kinds of high-frequency indication syndromes (the frequency greater than or equal to 10). The core drug combination of high-frequency indication syndromes of "deficiency of both qi and blood" (137 times) and "deficiency of kidney yang" (63 times) were the subtract of Shiquan-Dabu decoction and Yougui pill in Jingyue Quanshu respectively. Conclusions Prepared rehmannia root is mainly compatible with herbs of nourishing blood, supplementing qi and invigorating yang in the traditional Chinese patent medicine containing prepared rehmannia root. The traditional Chinese patent medicine containing prepared rehmannia root were based mainly on classical prescriptions. This study can provide reference for clinical application and new drug development of pepared rehmannia root.

2.
China Pharmacy ; (12): 2813-2816, 2018.
Artigo em Chinês | WPRIM | ID: wpr-704894

RESUMO

OBJECTIVE:To provide reference for clinical application and related new drug R&D of the couplet medicines of Platycodon grandiflorum-Glycyrrhiza uralensis. METHODS:All set prescription preparations containing P. grandiflorum-G. uralensis in Ministry of Public Health Drug Standard·TCM Set Prescription Preparation were collected;data mining and analysis for the syndrome and treatment rules of these prescriptions were performed by using TCM Inheritance System V 2.5. RESULTS:There were a total of 315 set prescription preparations containing couplet medicine of P. grandiflorum-G. uralensis , 89 main syndromes and 88 main diseases. Among of them,high frequency major syndrome were exterior syndrome attacked by wind-heat and exterior syndrome tightened by wind-cold,and dominating medicine combination were respectively Yinqiao powder and Xingsu powder. High frequency main diseases were common cold and cough. Core medicine combination in the treatment of common cold included Yinqiao powder, Xingsu powder,Huoxiang zhengqi powder and Chaihu zhijie decoction,etc. Core medicine combination in the treatment of cough included Xingsu powder,Zhisou powder,Tongxuan lifei pills and Qingjin huatan decoction,etc. CONCLUSIONS:The study confirms the syndrome and treatment rules of set prescription preparations containing couplet medicines of P. grandiflorum-G. uralensis , and could provide evidence for clinical application of the couplet medicines of P. grandiflorum-G. uralensis and new drug R&D.

3.
International Journal of Cerebrovascular Diseases ; (12): 912-916, 2018.
Artigo em Chinês | WPRIM | ID: wpr-742954

RESUMO

Objective To investigate the effect of melatonin against cerebral ischemia reperfusion injury (CIRI) in mice and its mechanism.Methods Thirty male C57BL/6 mice were randomly divided into sham operation group,CIRI group,and melatonin treatment group (n =10 in each group).A middle cerebral artery occlusion model was induced by suture method.The degree of brain injury was evaluated by neurological function score,brain water content,and cerebral infarction volume.Western blot analysis was used to detect apoptosis-related proteins Bim,Bcl-2,and endoplasmic reticuhm stress-related molecules C/ EBP homologous protein (C/EBP) expression.Results Compared with the CIRI group,the neurological function score was significantly improved,the degree of cerebral edema was significantly reduced,and the volume of cerebral infarction was significantly reduced in the melatonin treatment group (all P <0.05).In addition,the expression of Bcl-2 was significantly up-regulated in the melatonin treatment group,and the expression of Bim and CHOP was significantly down-regulated (all P < 0.05).Conclusion Melatonin may play an anti-CIRI role by regulating CHOP,and endoplasmic reticulum stress plays an important role in CIRI.

4.
Chinese Journal of Pharmacology and Toxicology ; (6): 296-301, 2014.
Artigo em Chinês | WPRIM | ID: wpr-445803

RESUMO

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA