Perspective of Calcium Imaging Technology Applied to Acupuncture Research / 中国结合医学杂志

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.

Altered microRNA expression profiles of human spermatozoa in normal fertile men of different ages / 亚洲男科学杂志(英文版)

MicroRNAs (miRNAs) are mediators of the aging process. The purpose of this work was to analyze the miRNA expression profiles of spermatozoa from men of different ages with normal fertility. Twenty-seven donors were divided into three groups by age (Group A, n = 8, age: 20-30 years; Group B, n = 10, age: 31-40 years; and Group C, n = 9, age: 41-55 years) for high-throughput sequencing analysis. Samples from 65 individuals (22, 22, and 21 in Groups A, B, and C, respectively) were used for validation by quantitative real-time polymerase chain reaction (qRT-PCR). A total of 2160 miRNAs were detected: 1223 were known, 937 were newly discovered and unnamed, of which 191 were expressed in all donors. A total of 7, 5, and 17 differentially expressed microRNAs (DEMs) were found in Group A vs B, Group B vs C, and Group A vs C comparisons, respectively. Twenty-two miRNAs were statistically correlated with age. Twelve miRNAs were identified as age-associated miRNAs, including hsa-miR-127-3p, mmu-miR-5100_L+2R-1, efu-miR-9226_L-2_1ss22GA, cgr-miR-1260_L+1, hsa-miR-652-3p_R+1, pal-miR-9993a-3p_L+2R-1, hsa-miR-7977_1ss6AG, hsa-miR-106b-3p_R-1, hsa-miR-186-5p, PC-3p-59611_111, hsa-miR-93-3p_R+1, and aeca-mir-8986a-p5_1ss1GA. There were 9165 target genes of age-associated miRNAs. Gene Ontology (GO) analysis of the target genes identified revealed enrichment of protein binding, membrane, cell cycle, and so on. The Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of age-related miRNAs for target genes revealed 139 enriched pathways, such as signaling pathways regulating stem cell pluripotency, metabolic pathways, and the Hippo signaling pathway. This suggests that miRNAs play a key role in male fertility changes with increasing age and provides new evidence for the study of the mechanism of age-related male fertility decline.

Development of a fluorescence resonance energy transfer (FRET) immunoassay for the measurement of serum insulin / 细胞与分子免疫学杂志

Objective To investigate the fluorescence resonance energy transfer (FRET) effect between dylight (DL) and AuNP (AuNP), and to construct a new fluorescence immunoassay for insulin in combination with the immunocompetition method. Methods Insulin antigen (Ag) and insulin antibody (Ab) were conjugated with DL and AuNP respectively to form DL-Ag conjugate and AUNp-AB conjugate. A novel fluorescence immunoassay for insulin was developed on the basis of FRET effect and the immune competition response between them. Then the performance of the method was evaluated and its application in actual samples was explored. Results The fluorescence immunoassay showed high sensitivity (0.015 ng/mL), short measurement time (4 min) and good specificity. It was successfully used in the measurement of serum insulin, and the recovery was between 96.9% and 121.1%. Conclusion FRET effect between AuNP and DL can be applied to develop a fluorescence immunoassay for the measurement of serum insulin.

Application progress on data-driven technologies in intelligent manufacturing of traditional Chinese medicine extraction / 中国中药杂志

The application of new-generation information technologies such as big data, the internet of things(IoT), and cloud computing in the traditional Chinese medicine(TCM)manufacturing industry is gradually deepening, driving the intelligent transformation and upgrading of the TCM industry. At the current stage, there are challenges in understanding the extraction process and its mechanisms in TCM. Online detection technology faces difficulties in making breakthroughs, and data throughout the entire production process is scattered, lacking valuable mining and utilization, which significantly hinders the intelligent upgrading of the TCM industry. Applying data-driven technologies in the process of TCM extraction can enhance the understanding of the extraction process, achieve precise control, and effectively improve the quality of TCM products. This article analyzed the technological bottlenecks in the production process of TCM extraction, summarized commonly used data-driven algorithms in the research and production control of extraction processes, and reviewed the progress in the application of data-driven technologies in the following five aspects: mechanism analysis of the extraction process, process development and optimization, online detection, process control, and production management. This article is expected to provide references for optimizing the extraction process and intelligent production of TCM.

A novel mesenchymal stem cell-based regimen for acute myeloid leukemia differentiation therapy

Currently the main treatment of acute myeloid leukemia (AML) is chemotherapy combining hematopoietic stem cell transplantation. However, the unbearable side effect of chemotherapy and the high risk of life-threatening infections and disease relapse following hematopoietic stem cell transplantation restrict its application in clinical practice. Thus, there is an urgent need to develop alternative therapeutic tactics with significant efficacy and attenuated adverse effects. Here, we revealed that umbilical cord-derived mesenchymal stem cells (UC-MSC) efficiently induced AML cell differentiation by shuttling the neutrophil elastase (NE)-packaged extracellular vesicles (EVs) into AML cells. Interestingly, the generation and release of NE-packaged EVs could be dramatically increased by vitamin D receptor (VDR) activation in UC-MSC. Chemical activation of VDR by using its agonist 1α,25-dihydroxyvitamin D3 efficiently enhanced the pro-differentiation capacity of UC-MSC and then alleviated malignant burden in AML mouse model. Based on these discoveries, to evade the risk of hypercalcemia, we synthetized and identified sw-22, a novel non-steroidal VDR agonist, which exerted a synergistic pro-differentiation function with UC-MSC on mitigating the progress of AML. Collectively, our findings provided a non-gene editing MSC-based therapeutic regimen to overcome the differentiation blockade in AML.

Xiangsha Liu Junzitang for Prevention and Treatment of Gastric Cancer： A Review / 中国实验方剂学杂志

Gastric cancer is one of the malignancies with high incidence in the world. Xiangsha Liu Junzitang，a common prescription for the prevention and treatment of gastric cancer，has the effects of moving Qi to relieve pain，drying dampness， and invigorating the spleen. It is especially indicated for gastric cancer of the spleen and stomach qi deficiency syndrome. Based on the databases such as CNKI，Wanfang Data，and PubMed，the clinical efficacy and experimental studies of Xiangsha Liu Junzitang for the prevention and treatment of gastric cancer were summarized and sorted out，and the mechanism of Xiangsha Liu Junzitang for the prevention and treatment of gastric cancer was elaborated in order to provide useful references for the clinical and basic research on Xiangsha Liu Junzitang in the field of gastric cancer in the future. In clinical practice，Xiangsha Liu Junzitang can treat gastric precancerous lesions，increase the body immunity of patients with gastric cancer，improve the symptoms of spleen and stomach weakness after gastric cancer surgery，and reduce the adverse reactions of the digestive tract after chemotherapy for gastric cancer. Its clinical efficacy is superior to that of western medicine alone whether it is combined with western medicine or used alone. In the experimental research，Xiangsha Liu Junzitang has the effects of regulating inflammatory factors，inhibiting the proliferation of gastric cancer cells，promoting the apoptosis of gastric cancer cells，and improving the activity of pepsin. Modern pharmacological research has shown that Xiangsha Liu Junzitang can conduct a comprehensive intervention with multiple components and multiple targets. The main components of a single drug contained include saponins，polysaccharides，lactones，volatile oils，organic acids，and others， with the effects of protecting gastric mucosa，regulating endocrine，and promoting apoptosis of epithelial cells in gastric mucosal dysplasia，reflecting the advantages and values of traditional Chinese medicine in the prevention and treatment of gastric cancer.

Application of two phacoemulsification modes in cataract surgery with different hard nuclear / 国际眼科杂志(Guoji Yanke Zazhi)

AIM: To compare the clinical efficacy of the Balanced energy system versus the conventional torsional ultrasound system in phacoemulsification surgeries for cataracts with varying nuclear hardness.METHODS: In this study, 120 patients(122 eyes)with age-related cataracts scheduled for surgery between November 2021 and November 2022 at our hospital were randomly divided into two groups: 58 patients(59 eyes)in the experimental group underwent surgery using the Balanced energy system, while 62 patients(63 eyes)in the control group were treated with the conventional torsional ultrasound system. Intraoperative cumulative dissipated energy(CDE), case time(CT), aspiration time(AST), and estimated fluid used(EFU)were recorded. Patients were followed-up for 3mo to examine and record the best-corrected visual acuity(BCVA)and corneal endothelial cell density(ECD), and to calculate the rate of endothelial cell loss.RESULTS: Comparing the intraoperative parameters between the two groups, there was no significant difference in CT(P>0.05), but the CDE, AST and EFU of the patients in the experimental group were lower than those of the control group(P<0.05), and the CDE of patients with grade III nuclear hardness in the experimental group was lower than the control group(P<0.05), CDE, AST and EFU in patients with grade IV nuclear hardness were lower than those in the control group(P<0.05). After 3mo of follow-up, BCVA in both groups improved significantly, and the experimental group recovered faster than the control group. At 3mo after surgery, the ECD of the two groups of patients was reduced compared with that before surgery(P<0.01), but there were no significant differences in ECD and endothelial cell loss rates between the experimental and control groups before and at 3mo after surgery(P>0.05). In grade IV nuclear hardness cataracts, the rate of endothelial cell loss in the experimental group was significantly lower than that in the control group(4.63%±4.10% vs. 6.63%±4.49%, P<0.01).CONCLUSION: The Balanced energy system and the conventional torsional ultrasound system both show high safety and efficiency in phacoemulsification of cataracts with different nuclear hardness. However, the former demonstrates substantial advantages in cases with dense nuclei, offering lower ultrasound energy, shorter aspiration and infusion times, and reduced volume of infusion fluid.

Effect of hand controlled rhythm music therapy on unilateral spatial neglect after stroke / 中国康复理论与实践

ObjectiveTo observe the clinical effect of hand controlled rhythm music therapy on unilateral spatial neglect for stroke patients. MethodsFrom September, 2020 to September, 2022, 52 patients with unilateral spatial neglect after stroke in Wuxi Central Rehabilitation Hospital were randomly divided into control group (n = 26) and observation group (n = 26). Both groups accepted routine rehabilitation, and the observation group accepted hand controlled rhythm music therapy in addition, for eight weeks. Before and after treatment, the patients were assessed with Chinese Behavioral Inattention Test-Hong Kong version (CBIT-HK) routine tests (line crossing, letter cancellation, star cancellation, line bisection, figure and shape copying, and representational drawing) and modified Barthel Index (MBI). ResultsAfter treatment, six scores of CBIT-HK routine tests and the scores of MBI increased in both groups (|t| > 3.077, P < 0.05), and they were higher in the observation group than in the control group (|t| > 2.639, P < 0.05). ConclusionHand controlled rhythm music therapy could effectively alleviate the symptoms of unilateral spatial neglect after stroke, and improve the activities of daily living.

Comparison of the Nerve Regeneration Capacity and Characteristics between Sciatic Nerve Crush and Transection Injury Models in Rats / 生物医学与环境科学（英文）

OBJECTIVE@#To provide useful information for selecting the most appropriate peripheral nerve injury model for different research purposes in nerve injury and repair studies, and to compare nerve regeneration capacity and characteristics between them.@*METHODS@#Sixty adult SD rats were randomly divided into two groups and underwent crush injury alone (group A, n = 30) or transection injury followed by surgical repair (group B, n = 30) of the right hind paw. Each group was subjected to the CatWalk test, gastrocnemius muscle evaluation, pain threshold measurement, electrophysiological examination, retrograde neuronal labeling, and quantification of nerve regeneration before and 7, 14, 21, and 28 days after injury.@*RESULTS@#Gait analysis showed that the recovery speed in group A was significantly faster than that in group B at 14 days. At 21 days, the compound muscle action potential of the gastrocnemius muscle in group A was significantly higher than that in group B, and the number of labeled motor neurons in group B was lower than that in group A. The number of new myelin sheaths and the g-ratio were higher in group A than in group B. There was a 7-day time difference in the regeneration rate between the two injury groups.@*CONCLUSION@#The regeneration of nerve fibers was rapid after crush nerve injury, whereas the transection injury was relatively slow, which provides some ideas for the selection of clinical research models.

Effect of dual task walking on spatiotemporal gait in patients with cerebral small vessel disease / 中华神经科杂志

Objective:To compare the gait characteristics of cognitive and motor dual task walking (DTW) in patients with cerebral small vessel disease (CSVD), and determine the best gait parameters to diagnose CSVD and judge the severity of the disease.Methods:A total of 106 patients with CSVD and 21 healthy individuals were included from September 1, 2020 to July 1, 2021 in the Seventh Medical Center of Chinese People′s Liberation Army General Hospital. According to the Fazekas scores, the subjects were divided into mild ( n=34, 1 point), moderate ( n=34, 2 points), severe ( n=38,3 points) groups and control group ( n=21). Participants were recorded parameters under single task walking (STW) and DTW conditions, and calculated dual task effect (DTC) through the difference between single task and dual task. The differences in gait variances and their DTC were shown by generalized estimation equations when performed in STW and DTW and 4 groups of the severity of disease. Post-hoc comparisons were corrected using Bonferroni′s method. Spearman analyses were applied to explore the correlations between gait parameters and their DTC during STW or DTW and severity of disease. Based on the Logistic model, combining predictors or probabilities were gained and applied to establish receiver operating characteristic curve in order to calculate sensitivity, specificity, and the area under the curve. Results:In the control group, there was no statistically significant difference in gait parameters between STW and DTW. In the CSVD group, the gait parameters of STW were significantly better than cognitive or motor DTW (all P<0.05). In the control group, there was no statistically significant difference in basic gait parameters under different tasks (all P>0.05). In cognitive DTW, temporal gait parameters (stride frequency and stride time) deteriorated significantly only in moderate and severe groups [stride frequency:moderate group 100.220±1.795/min,severe group 94.525±2.139/min;stride time:moderate group (1.227±0.024) s, severe group (1.299±0.031) s], but spatial parameters [stride length: control group (1.050±0.021) m, mild group (0.974±0.022) m, moderate group (0.903±0.025) m, severe group (0.793±0.026) m; stride speed: control group (0.944±0.028) m/s, mild group (0.866±0.030) m/s, moderate group (0.751±0.027) m/s, severe group (0.606±0.022) m/s] were significantly different among all groups (except the control group and mild group;all P<0.05). The DTC of all gait parameters during cognitive DTW was higher than that during motor DTW (all P<0.05) for CSVD patients. While no any difference was found between cognitive DTW and motor DTW in the control group (all P>0.05). Similarly, the temporal parameters′ DTC of cognitive DTW was abnormal only in the late stage of disease, while the spatial parameters′ DTC showed statistically significant difference among all the groups (including the control group and the mild group;all P<0.05). Correlation coefficients of the spatial parameters and their DTC in condition of cognitive DTW were significantly higher than temporal parameters and their DTC (0.50< r<0.64 vs 0.15< r<0.39). The area under curve of the combined predictor was significantly higher than that of any single index. Conclusions:Cognitive DTW can better reflect the abnormal gait of CSVD patients. The spatial parameters and DTC of cognitive DTW could effectively diagnose CSVD and distinguish the disease of severity. And DTC might be better indicators. For diagnosis of CSVD, there was no significant discrepancy between the spatial parameters and DTC, but the combined predictor could significantly improve the sensitivity and reduce the false negative rate.

The 500th case: pain in both hip joints, headache, and diplopia / 中华内科杂志

A male child, aged 5 years and 3 months, was admitted to the Oncology Department with a history of pain in both hip joints, headache, and diplopia lasting for 40 days. Physical examination did not reveal definitive signs or obvious abnormalities in the nervous system. Imaging studies showed only abnormalities in the craniocerebrum and spinal cord. Routine cerebrospinal fluid (CSF) analysis revealed elevation in the total number of white blood cells, mainly mononuclear cells. Biochemical analysis of CSF showed normal glucose and chloride levels, and increased protein concentrations. The possibility of central nervous system (CNS) infection was initially considered. Subsequently, antibacterial and antiviral therapy was administered; however, this treatment was ineffective. Further examination of CSF through immunophenotyping revealed mature B-cell lymphoma with CNS involvement; there were no neoplastic lesions detected elsewhere in the body. Thus, the patient was diagnosed with primary central nervous system lymphoma (PCNSL). Complete remission was achieved after chemotherapy with the CNCL-2017-mature B-cell lymphoma regimen. Thus far, all chemotherapy cycles have been completed, the patient remains in complete remission, and the follow-up is ongoing. Clinicians should pay close attention to PCNSL in children.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Research progress on the application of combining radiotherapy and systemic therapy in breast cancer / 国际肿瘤学杂志

Compared with single therapy, radiotherapy combined with chemotherapy, endocrine therapy, molecular targeted therapy and immunological therapy can not only shorten the treatment cycle, but also improve the local control rate and prolong the survival of patients. However, the safety of combined therapy still needs to be further clarified to comprehensively evaluate the feasibility. Therefore, exploring the efficacy and safety of radiotherapy combined with systematic therapy will provide evidence for clinical benefits.

Clinical analysis of 5 children with lymphoma complicated with Pneumocystis jirovecii pneumonia / 白血病·淋巴瘤

Objective:To explore the clinical features of childhood lymphoma complicated with Pneumocystis jirovecii pneumonia (PJP).Methods:The clinical data, diagnosis and treatment of 5 children with lymphoma complicated with PJP admitted to Beijing Children's Hospital from January 2013 to April 2022 were retrospectively analyzed.Results:Among 5 patients, there were 3 males and 2 females, the median onset age was 7 years old; 4 cases were non-Hodgkin lymphoma and 1 case was Hodgkin lymphoma. Fever and cough occurred 5-18 months after chemotherapy; typical mosaic sign could be seen in 2 cases without pneumothorax and pleural effusion as well as other pathogenic infection; all 5 cases had hypoxemia; 4 cases were diagnosed by next-generation sequencing (NGS). The CD4/CD8 ratio decreased in all cases, and the median CD4 positive T-cell was 200/μl. Trimethoprim-sulfamethoxazole (TMP-SMZ) was irregularly used in 3 cases. During the treatment, all cases received mechanical ventilation, TMP-SMZ intravenously dripping combined with caspofungin, glucocorticoid and gamma globulin. All 5 cases of PJP were cured and there was no recurrent infection.Conclusions:Lymphoma children are susceptible to PJP due to immunocompromise caused by chemotherapy, and their condition progresses rapidly. When encountering fever, shortness of breath, severe lung symptoms and mild signs of children, it is necessary to improve the vigilance of PJP. NGS can help diagnosis, and TMP-SMZ should be actively treated and prevented. Early diagnosis and active treatment can achieve a good prognosis.

Aurora A Kinase Plays a Key Role in Mitosis Skip during Senescence Induced by Ionizing Radiation / 生物医学与环境科学（英文）

OBJECTIVE@#To investigate the fate and underlying mechanisms of G2 phase arrest in cancer cells elicited by ionizing radiation (IR).@*METHODS@#Human melanoma A375 and 92-1 cells were treated with X-rays radiation or Aurora A inhibitor MLN8237 (MLN) and/or p21 depletion by small interfering RNA (siRNA). Cell cycle distribution was determined using flow cytometry and a fluorescent ubiquitin-based cell cycle indicator (FUCCI) system combined with histone H3 phosphorylation at Ser10 (pS10 H3) detection. Senescence was assessed using senescence-associated-β-galactosidase (SA-β-Gal), Ki67, and γH2AX staining. Protein expression levels were determined using western blotting.@*RESULTS@#Tumor cells suffered severe DNA damage and underwent G2 arrest after IR treatment. The damaged cells did not successfully enter M phase nor were they stably blocked at G2 phase but underwent mitotic skipping and entered G1 phase as tetraploid cells, ultimately leading to senescence in G1. During this process, the p53/p21 pathway is hyperactivated. Accompanying p21 accumulation, Aurora A kinase levels declined sharply. MLN treatment confirmed that Aurora A kinase activity is essential for mitosis skipping and senescence induction.@*CONCLUSION@#Persistent p21 activation during IR-induced G2 phase blockade drives Aurora A kinase degradation, leading to senescence via mitotic skipping.

Current situation of incision sites in laparoscopic nephrectomy for intact specimens by urologists in China / 现代泌尿外科杂志

【Objective】 To investigate the current status of incision sites to obtain intact specimens in laparoscopic nephrectomy by urologists in China, so as to provide reference for the standardized procedure. 【Methods】 During Jun.20, 2021 and Jul.4, 2021, more than 20 000 urologists in a WeChat group were surveyed with a questionnaire. The general data, incision sites and related complications were statistically analyzed. 【Results】 A total of 601 valid questionnaires were collected, covering urologists from 31 provinces, autonomous regions and municipalities. Surgical approaches: 68 urologists chose trans-abdominal approach, 432 chose posterior abdominal space approach, 101 chose both surgical approaches. Incision sites: 97 urologists chose lumbar transverse incision, 202 chose dorsal oblique incision of the waist, 119 chose ventral oblique incision, 93 chose the paramedian incision, 112 chose the lower abdominal oblique incision (Gibson), 11 chose the transverse lower abdominal incision (Pfannenstiel), 7 chose the median incision of the lower abdomen, 2 chose the median incision in the upper abdomen, 15 chose axillary midline direct incision; 399 chose to cut off the muscles, and 202 chose not to. Complications: 232 urologists reported pain after 2 weeks, 369 reported no pain; 325 reported numbness after 2 weeks, 276 reported no numbness; 66 reported incisional hernia, 535 reported no hernia. 【Conclusions】 Chinese urologists tend to choose retroperitoneoscopic nephrectomy and waist incision to obtain intact specimens. Transperitoneal laparoscopic nephrectomy has a variety of incisions for intact specimens. There is no standardized incision sites to obtain intact specimens.

Clinical study of mature B-cell lymphoma in 11 children with chromosome 11 long-arm abnormalities / 中华血液学杂志

Objective: To explore the clinical, pathological, diagnostic, treatment, and prognostic features of children with mature B-cell lymphoma (MBCL) . Methods: This retrospective study included pediatric patients with MBCL with chromosome 11 long-arm abnormalities who were diagnosed and treated at our hospital from December 2018 to February 2023. Results: Among the 11 pediatric patients with MBCL, nine were male and two were female, with a median age of 9 (2-13) years and a median disease course of 1.8 (0.5-24) months. The clinical manifestations were cervical lymph node enlargement in four patients, nasal congestion and snoring in four patients, abdominal pain in two patients, and difficulty breathing in one patient. There were seven cases of Burkitt's lymphoma, two of follicular lymphoma, and two of advanced B-cell lymphoma according to the pathological morphology examination. No patients had central nervous system or bone marrow involvement, and no extensive metastasis was observed on B-ultrasound or positron emission tomography-computed tomography (PET/CT). One patient had a huge tumor lesion. The Revised International Pediatric Non-Hodgkin Lymphoma Staging System classified four patients as stage Ⅱ, five as stage Ⅲ, and two as stage Ⅳ. 11q probe detection showed five cases of 11q gain, three of 11q loss, and three of both gain and loss. FISH showed positive MYC expression in three patients, including eight with advanced B-cell lymphoma with 11q abnormalities and three with Burkitt's lymphoma with 11q abnormalities. According to the 2019 edition of the National Health Commission's diagnostic and treatment guidelines for invasive MBCL in children, one patient was classified as Group A, two as Group B, and eight as Group C. Early evaluation of the efficacy showed complete remission. After mid-term evaluation, the intensity of chemotherapy was reduced in Group B and Group C. Among two cases of chemotherapy, the remaining nine cases had a median follow-up of 32 (6-45) months, and none had event-related survival. Conclusion: The incidence of MBCL with 11q abnormalities in children is low, clinical symptoms are mild, and progression is slow. The absence of MYC, BCL2, BCL6 rearrangements, C-MYC negative and 11q abnormalities on FISH is an important diagnostic indicator, and reducing the intensity of chemotherapy can improve prognosis.

Signal transducer and activator of transcription 3 and cancer associated fibroblasts jointly generate chemo-resistance and affect prognosis in epithelial ovarian cancer / 中华妇产科杂志

Objective: To investigate the mechanism of signal transducer and activator of transcription 3 (STAT3) and cancer associated fibroblasts (CAF) jointly generate chemo-resistance in epithelial-ovarian cancer and their effect on prognosis. Methods: A total of 119 patients with high-grade ovarian serous cancer who received surgery in Cancer Hospital of Chinese Academy of Medical Sciences from September 2009 to October 2017 were collected. The clinico-pathological data and follow-up data were complete. Multivariate Cox regression model was used to analyze the prognostic factors. Ovarian cancer tissue chips of patients in our hospital were prepared. EnVision two-step method immunohistochemistry was used to detect the protein expression levels of STAT3, the specific markers of CAF activation, fibroblast activating protein (FAP), and type Ⅰ collagen (COL1A1) secreted by CAF. The relationship between the expression of STAT3, FAP, COL1A1 protein and drug resistance and prognosis of ovarian cancer patients was analyzed, and the correlation between the expression of three proteins was analyzed. These results were verified through the gene expression and prognostic information of human ovarian cancer tissues collected in the GSE26712 dataset of gene expression omnibus (GEO) database. Results: (1) Multivariate Cox regression model analysis showed that chemotherapy resistance was an independent risk factor for overall survival (OS) of ovarian cancer (P<0.001). (2) The expression levels of STAT3, FAP, and COL1A1 proteins in chemotherapy resistant patients were significantly higher than those in chemotherapy sensitive patients (all P<0.05). Patients with high expression of STAT3, FAP, and COL1A1 had significantly shorter OS than those with low expression (all P<0.05). According to the human ovarian cancer GSE26712 dataset of GEO database, patients with high expression of STAT3, FAP, and COL1A1 also showed shorter OS than patients with low expression (all P<0.05), the verification results were consistent with the detection results of ovarian cancer patients in our hospital. (3) Correlation analysis showed that the protein level of STAT3 was positively correlated with FAP and COL1A1 in our hospital's ovarian cancer tissue chips (r=0.47, P<0.001; r=0.30, P=0.006), the analysis of GEO database GSE26712 dataset showed that the expression of STAT3 gene and FAP, COL1A1 gene were also significantly positively correlated (r=0.31, P<0.001; r=0.52, P<0.001). Conclusion: STAT3 and CAF could promote chemotherapy resistance of ovarian cancer and lead to poor prognosis.

Advances in three-dimensional tumor models for colorectal cancer / 中华肿瘤杂志

Conventional tumor culture models include two-dimensional tumor cell cultures and xenograft models. The former has disadvantages including lack of tumor heterogeneity and poor clinical relevance, while the latter are limited by the slow growth, low engraftment successful rate, and high cost. In recent years, in vitro three-dimensional (3D) tumor models have emerged as the tool to better recapitulate the spatial structure and the in vivo environment of tumors. In addition, they preserve the pathological and genetic features of tumor cells and reflect the complex intracellular and extracellular interactions of tumors, which have become a powerful tool for investigating the tumor mechanism, drug screening, and personalized cancer treatment. 3D tumor model technologies such as spheroids, organoids, and microfluidic devices are maturing. Application of new technologies such as co-culture, 3D bioprinting, and air-liquid interface has further improved the clinical relevance of the models. Some models recapitulate the tumor microenvironment, and some can even reconstitute endogenous immune components and microvasculature. In recent years, some scholars have combined xenograft models with organoid technology to develop matched in vivo/in vitro model biobanks, giving full play to the advantages of the two technologies, and providing an ideal research platform for individualized precision therapy for specific molecular targets in certain subtypes of tumors. So far, the above technologies have been widely applied in the field of colorectal cancer research. Our research team is currently studying upon the application of patient-derived tumor cell-like clusters, a self-assembly 3D tumor model, in guiding the selection of postoperative chemotherapy regimens for colorectal cancer. A high modeling success rate and satisfactory results in the drug screening experiments have been achieved. There is no doubt that with the advancement of related technologies, 3D tumor models will play an increasingly important role in the research and clinical practice of colorectal cancer.

Clinicopathological features and prognostic factors of patients with lung metastasis of stage Ⅰa~Ⅲb cervical cancer / 中华肿瘤杂志

Objective: To investigate the clinicopathological features and prognostic factors of lung metastasis in patients with cervical cancer after treatment. Methods: The clinicopathological data of 191 patients with lung metastasis of stage Ⅰa-Ⅲb cervical cancer (FIGO 2009 stage) treated in Sichuan Cancer Hospital from January 2007 to December 2020 were analyzed retrospectively. Kaplan Meier method and Log rank test were used for survival analysis, and Cox regression model was used for prognostic factors analysis. Results: Among 191 patients with lung metastasis of cervical cancer, pulmonary metastasis was found in 134 patients (70.2%) during follow-up examination, and 57 patients (29.8%) had clinical symptoms (cough, chest pain, shortness of breath, hemoptysis, and fever). The time from the initial treatment of cervical cancer to the discovery of lung metastasis was 1-144 months in the whole group, with a median time of 19 months. Univariate analysis of the prognosis of lung metastasis after treatment of cervical cancer showed that the diameter of cervical tumor, lymph node metastasis, positive surgical margin, disease-free interval after treatment of cervical cancer, whether it is accompanied by other metastasis, the number, location and maximum diameter of lung metastasis, and the treatment method after lung metastasis are related to the prognosis of patients with lung metastasis of cervical cancer. Multivariate analysis showed that the number of lung metastases and other site metastases in addition to lung metastases were independent factors affecting the prognosis of patients with lung metastases of cervical cancer (P<0.05). Conclusions: For patients with cervical cancer, attention should be paid to chest CT examination during follow-up to guard against the possibility of lung metastasis after treatment. Besides lung metastasis, other site metastasis and the number of lung metastasis are independent factors affecting the prognosis of patients with lung metastasis of cervical cancer. For patients with lung metastasis after treatment of cervical cancer, surgical treatment is an effective treatment. It is necessary to strictly grasp the surgical indications, and some patients can achieve long-term survival. For patients with lung metastasis of cervical cancer who are not suitable for resection of lung metastasis, the remedial treatment of chemotherapy with or without radiotherapy is still a recommended choice.