Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 613
Filtrar
1.
Chinese journal of integrative medicine ; (12): 3-9, 2024.
Artigo em Inglês | WPRIM | ID: wpr-1010284

RESUMO

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.


Assuntos
Cálcio , Terapia por Acupuntura , Acupuntura , Analgesia por Acupuntura/métodos , Pontos de Acupuntura , Tecnologia
2.
Journal of Environmental and Occupational Medicine ; (12): 788-795, 2023.
Artigo em Chinês | WPRIM | ID: wpr-979194

RESUMO

Background The prevalence of osteoporosis and osteopenia is higher among underground coal miners than surface workers. The special underground work environment and unhealthy habits such as smoking, drinking, and a high-salt diet may lead to changes in bone metabolism, increasing the risk of fragility fractures and placing a heavy economic burden on individuals and society. Objective To identify potential factors influencing fragility fractures among coal miners in different working environments and to provide a basis for targeted preventive measures to reduce the occurrence of fragility fractures. Methods Male participants who attended at least one of the physical examinations in Kailuan Group between June 2006 and December 2020 were included in the study. The participants were divided into two groups based on their working environment: surface or underground. A case-control study was conducted, where patients with new fragility fractures served as the case group and participants without fragility fractures served as the control group. The two groups were matched with a case:control ratio of 1:4 by age (±1 year) and the same year of physical examination. The matching process was repeated twice, once for the surface working population and once for the underground working population. The analysis of risk factors was conducted using conditional logistic regression models. Results Among a total of 113138 employees in Kailuan Group, 82631 surface workers and 30507 underground workers were included, respectively. The number of individuals who suffered fragility fractures was 1375, accounting for 1.22% of the total population. The incidence of fragility fractures in underground workers was significantly higher than that in surface workers (1.63%>1.07%, P<0.001). The results of conditional logistic regression model showed that current smoking (OR=1.26, 95%CI: 1.05, 1.51), manual labor (OR=1.37, 95%CI: 1.06, 1.78), diabetes (OR=1.26, 95%CI: 1.04, 1.54), sinus tachycardia (OR=1.81, 95%CI: 1.23, 2.66), history of stroke (OR=1.51, 95%CI: 1.09, 2.09), education at college and above (OR=0.65, 95%CI: 0.45, 0.95), high income level (OR=0.69, 95%CI: 0.54, 0.90), elevated hemoglobin (OR=0.91, 95%CI: 0.85, 0.98), and elevated total cholesterol (OR=0.90, 95%CI: 0.82, 0.99) were associated with fragility fractures in the surface working population of coal mines; current smoking (OR=1.48, 95%CI: 1.17, 1.87), current drinking (OR=1.26, 95%CI: 1.01, 1.56), manual labor (OR=2.64, 95%CI: 1.41, 4.94), history of dust exposure (OR=1.28, 95%CI: 1.03, 1.58), and obesity (OR=0.72, 95%CI: 0.52, 0.96) were associated with fragility fractures in the underground working population of coal mines. Conclusion In preventing fragility fractures, special attention should be paid to the bone health of underground workers engaged in manual labor or having a history of dust exposure. It is important to correct their unhealthy behaviors in a timely manner, such as smoking and drinking, and to appropriately increase body weight to prevent fragility fractures. For surface workers, particular attention should be given to the high-risk group for fragility fractures, such as low family income per capita, manual labor, and having a history of stroke or diabetes; in addition, close monitoring of their resting heart rate, hemoglobin levels, and total cholesterol levels may help prevent fragility fractures.

3.
Acta Pharmaceutica Sinica ; (12): 1441-1451, 2023.
Artigo em Chinês | WPRIM | ID: wpr-978735

RESUMO

We used network pharmacology to predict the mechanism in the treatment of rheumatoid arthritis (RA) via modified Gan Cao Fu Zi Decoction (GCFZ), and validated the results of the analysis and explored the pharmacodynamic effects of GCFZ through animal experiments. Firstly, TCMID, SymMap, HERB, STITCH and GEO databases were utilized to obtain the target genes of GCFZ for the treatment of RA, which yielded a total of 1 250 differentially expressed genes for RA, 534 genes for GCFZ targets and 83 intersecting genes. Then functional enrichment analysis of the intersecting genes was performed through GO and KEGG databases, and the results revealed that GCFZ and its active ingredients mainly functioned through cytokine pathways, where chemokine signaling pathway and tumor necrosis factor (TNF) signaling pathway were enriched with a high number of genes. Cytoscape 3.8.0 software was used to construct the drug-target-disease network and screen key proteins, which included TNF, C-X-C chemokine ligand 8 (CXCL8), C-X-C chemokine ligand 10 (CXCL10), C-C chemokine ligand 5 (CCL5), C-X-C chemokine ligand 2 (CXCL2) and C-X-C chemokine receptor type 4 (CXCR4). The molecular docking technology was used to confirm the binding ability of the main active ingredients of GCFZ to the core proteins. Additionally, the therapeutic effects of GCFZ in low (4 g·kg-1), medium (8 g·kg-1) and high (16 g·kg-1) dose groups were investigated by constructing the collagen-induced arthritis (CIA) rat model. X-ray imaging approach, HE staining and Safranin O-Fast Green staining showed that GCFZ treatment significantly improved bone destruction, synovial hyperplasia and cartilage damage in CIA rats, while immunofluorescence results showed that GCFZ treatment could regulate the expression of TNF, CXCL8 and CCL5. In summary, our results indicate that GCFZ contains a variety of small molecule pharmacodynamic substances, which can exert therapeutic effects via multiple targets and pathways, and obviously reduce the symptoms of arthritis in CIA rats. This animal experiment of our research was approved by the Experimental Animal Management and Ethics Committee of Bengbu Medical College.

4.
Chinese Journal of Stomatology ; (12): 57-63, 2023.
Artigo em Chinês | WPRIM | ID: wpr-970755

RESUMO

Objective: To preliminarily explore the mechanism of tensile stress regulating endochondral osteogenesis of condyle by analyzing the expression profiles of significantly different microRNAs (miRNAs) in exosomes of rat mandibular condylar chondrocytes (MCC) under quiescent and cyclic tensile strain (CTS) conditions. Methods: Rat condylar chondrocytes were cultured under static and CTS conditions respectively (10 SD rats, male, 2 weeks old), and exosomes were extracted. The two groups of exosomes were named as control group and CTS group respectively. The differential expression miRNAs were screened by high-throughput sequencing. Bioinformatics analysis and prediction of target genes related to osteogenesis were performed by TargetScan and miRanda website. Results: The exosomes of rat condylar chondrocytes cultured under tensile stress showed a "double concave disc" monolayer membrane structure, the expression of CD9 and CD81 were positive, and the particle size distribution accorded with the characteristics of exosomes, which was consistent with that of static cultured rat condylar chondrocytes. A total of 85 miRNAs with significantly different expression were detected by high-throughput sequencing (P<0.05). The main biological processes and molecular functions of differential miRNAs were biological processes and protein binding, respectively. Kyoto Encyclopedia of Genes and Genomes (KEGG) database pathway enrichment analysis showed that there was significant enrichment in mammalian target of rapamycin (mTOR) signal pathway. The candidate target genes of miR-199a-5p include bone morphogenetic protein 3 (BMP3), endothelin converting enzyme 1, and miR-186-5p may target Smad8 and BMP3 to exert osteogenesis-related functions. Conclusions: Compared with static state, tensile stress stimulation can change the expression of miRNAs such as miR-199a-5p, miR-186-5p in the exocrine body of rat condylar chondrocytes, which can be considered as a mean to regulate the application potential of the exosomes.


Assuntos
Animais , Masculino , Ratos , Proteína Morfogenética Óssea 3 , Condrócitos/metabolismo , Côndilo Mandibular , MicroRNAs/metabolismo , Ratos Sprague-Dawley , Transdução de Sinais , Estresse Mecânico
5.
International Eye Science ; (12): 2087-2091, 2023.
Artigo em Chinês | WPRIM | ID: wpr-998495

RESUMO

AIM: To compare the clinical efficacy of the Balanced energy system versus the conventional torsional ultrasound system in phacoemulsification surgeries for cataracts with varying nuclear hardness.METHODS: In this study, 120 patients(122 eyes)with age-related cataracts scheduled for surgery between November 2021 and November 2022 at our hospital were randomly divided into two groups: 58 patients(59 eyes)in the experimental group underwent surgery using the Balanced energy system, while 62 patients(63 eyes)in the control group were treated with the conventional torsional ultrasound system. Intraoperative cumulative dissipated energy(CDE), case time(CT), aspiration time(AST), and estimated fluid used(EFU)were recorded. Patients were followed-up for 3mo to examine and record the best-corrected visual acuity(BCVA)and corneal endothelial cell density(ECD), and to calculate the rate of endothelial cell loss.RESULTS: Comparing the intraoperative parameters between the two groups, there was no significant difference in CT(P&#x003E;0.05), but the CDE, AST and EFU of the patients in the experimental group were lower than those of the control group(P&#x003C;0.05), and the CDE of patients with grade III nuclear hardness in the experimental group was lower than the control group(P&#x003C;0.05), CDE, AST and EFU in patients with grade IV nuclear hardness were lower than those in the control group(P&#x003C;0.05). After 3mo of follow-up, BCVA in both groups improved significantly, and the experimental group recovered faster than the control group. At 3mo after surgery, the ECD of the two groups of patients was reduced compared with that before surgery(P&#x003C;0.01), but there were no significant differences in ECD and endothelial cell loss rates between the experimental and control groups before and at 3mo after surgery(P&#x003E;0.05). In grade IV nuclear hardness cataracts, the rate of endothelial cell loss in the experimental group was significantly lower than that in the control group(4.63%±4.10% vs. 6.63%±4.49%, P&#x003C;0.01).CONCLUSION: The Balanced energy system and the conventional torsional ultrasound system both show high safety and efficiency in phacoemulsification of cataracts with different nuclear hardness. However, the former demonstrates substantial advantages in cases with dense nuclei, offering lower ultrasound energy, shorter aspiration and infusion times, and reduced volume of infusion fluid.

6.
Chinese Journal of Rehabilitation Theory and Practice ; (12): 833-838, 2023.
Artigo em Chinês | WPRIM | ID: wpr-998250

RESUMO

ObjectiveTo observe the clinical effect of hand controlled rhythm music therapy on unilateral spatial neglect for stroke patients. MethodsFrom September, 2020 to September, 2022, 52 patients with unilateral spatial neglect after stroke in Wuxi Central Rehabilitation Hospital were randomly divided into control group (n = 26) and observation group (n = 26). Both groups accepted routine rehabilitation, and the observation group accepted hand controlled rhythm music therapy in addition, for eight weeks. Before and after treatment, the patients were assessed with Chinese Behavioral Inattention Test-Hong Kong version (CBIT-HK) routine tests (line crossing, letter cancellation, star cancellation, line bisection, figure and shape copying, and representational drawing) and modified Barthel Index (MBI). ResultsAfter treatment, six scores of CBIT-HK routine tests and the scores of MBI increased in both groups (|t| > 3.077, P < 0.05), and they were higher in the observation group than in the control group (|t| > 2.639, P < 0.05). ConclusionHand controlled rhythm music therapy could effectively alleviate the symptoms of unilateral spatial neglect after stroke, and improve the activities of daily living.

7.
Chinese Journal of Neurology ; (12): 646-653, 2023.
Artigo em Chinês | WPRIM | ID: wpr-994876

RESUMO

Objective:To compare the gait characteristics of cognitive and motor dual task walking (DTW) in patients with cerebral small vessel disease (CSVD), and determine the best gait parameters to diagnose CSVD and judge the severity of the disease.Methods:A total of 106 patients with CSVD and 21 healthy individuals were included from September 1, 2020 to July 1, 2021 in the Seventh Medical Center of Chinese People′s Liberation Army General Hospital. According to the Fazekas scores, the subjects were divided into mild ( n=34, 1 point), moderate ( n=34, 2 points), severe ( n=38,3 points) groups and control group ( n=21). Participants were recorded parameters under single task walking (STW) and DTW conditions, and calculated dual task effect (DTC) through the difference between single task and dual task. The differences in gait variances and their DTC were shown by generalized estimation equations when performed in STW and DTW and 4 groups of the severity of disease. Post-hoc comparisons were corrected using Bonferroni′s method. Spearman analyses were applied to explore the correlations between gait parameters and their DTC during STW or DTW and severity of disease. Based on the Logistic model, combining predictors or probabilities were gained and applied to establish receiver operating characteristic curve in order to calculate sensitivity, specificity, and the area under the curve. Results:In the control group, there was no statistically significant difference in gait parameters between STW and DTW. In the CSVD group, the gait parameters of STW were significantly better than cognitive or motor DTW (all P<0.05). In the control group, there was no statistically significant difference in basic gait parameters under different tasks (all P>0.05). In cognitive DTW, temporal gait parameters (stride frequency and stride time) deteriorated significantly only in moderate and severe groups [stride frequency:moderate group 100.220±1.795/min,severe group 94.525±2.139/min;stride time:moderate group (1.227±0.024) s, severe group (1.299±0.031) s], but spatial parameters [stride length: control group (1.050±0.021) m, mild group (0.974±0.022) m, moderate group (0.903±0.025) m, severe group (0.793±0.026) m; stride speed: control group (0.944±0.028) m/s, mild group (0.866±0.030) m/s, moderate group (0.751±0.027) m/s, severe group (0.606±0.022) m/s] were significantly different among all groups (except the control group and mild group;all P<0.05). The DTC of all gait parameters during cognitive DTW was higher than that during motor DTW (all P<0.05) for CSVD patients. While no any difference was found between cognitive DTW and motor DTW in the control group (all P>0.05). Similarly, the temporal parameters′ DTC of cognitive DTW was abnormal only in the late stage of disease, while the spatial parameters′ DTC showed statistically significant difference among all the groups (including the control group and the mild group;all P<0.05). Correlation coefficients of the spatial parameters and their DTC in condition of cognitive DTW were significantly higher than temporal parameters and their DTC (0.50< r<0.64 vs 0.15< r<0.39). The area under curve of the combined predictor was significantly higher than that of any single index. Conclusions:Cognitive DTW can better reflect the abnormal gait of CSVD patients. The spatial parameters and DTC of cognitive DTW could effectively diagnose CSVD and distinguish the disease of severity. And DTC might be better indicators. For diagnosis of CSVD, there was no significant discrepancy between the spatial parameters and DTC, but the combined predictor could significantly improve the sensitivity and reduce the false negative rate.

8.
Chinese Journal of Internal Medicine ; (12): 232-236, 2023.
Artigo em Chinês | WPRIM | ID: wpr-994401

RESUMO

A male child, aged 5 years and 3 months, was admitted to the Oncology Department with a history of pain in both hip joints, headache, and diplopia lasting for 40 days. Physical examination did not reveal definitive signs or obvious abnormalities in the nervous system. Imaging studies showed only abnormalities in the craniocerebrum and spinal cord. Routine cerebrospinal fluid (CSF) analysis revealed elevation in the total number of white blood cells, mainly mononuclear cells. Biochemical analysis of CSF showed normal glucose and chloride levels, and increased protein concentrations. The possibility of central nervous system (CNS) infection was initially considered. Subsequently, antibacterial and antiviral therapy was administered; however, this treatment was ineffective. Further examination of CSF through immunophenotyping revealed mature B-cell lymphoma with CNS involvement; there were no neoplastic lesions detected elsewhere in the body. Thus, the patient was diagnosed with primary central nervous system lymphoma (PCNSL). Complete remission was achieved after chemotherapy with the CNCL-2017-mature B-cell lymphoma regimen. Thus far, all chemotherapy cycles have been completed, the patient remains in complete remission, and the follow-up is ongoing. Clinicians should pay close attention to PCNSL in children.

9.
Chinese Journal of Applied Clinical Pediatrics ; (24): 457-460, 2023.
Artigo em Chinês | WPRIM | ID: wpr-990060

RESUMO

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

10.
Journal of International Oncology ; (12): 362-367, 2023.
Artigo em Chinês | WPRIM | ID: wpr-989572

RESUMO

Compared with single therapy, radiotherapy combined with chemotherapy, endocrine therapy, molecular targeted therapy and immunological therapy can not only shorten the treatment cycle, but also improve the local control rate and prolong the survival of patients. However, the safety of combined therapy still needs to be further clarified to comprehensively evaluate the feasibility. Therefore, exploring the efficacy and safety of radiotherapy combined with systematic therapy will provide evidence for clinical benefits.

11.
Chinese Journal of Experimental Traditional Medical Formulae ; (24): 221-227, 2023.
Artigo em Chinês | WPRIM | ID: wpr-953943

RESUMO

Gastric cancer is one of the malignancies with high incidence in the world. Xiangsha Liu Junzitang,a common prescription for the prevention and treatment of gastric cancer,has the effects of moving Qi to relieve pain,drying dampness, and invigorating the spleen. It is especially indicated for gastric cancer of the spleen and stomach qi deficiency syndrome. Based on the databases such as CNKI,Wanfang Data,and PubMed,the clinical efficacy and experimental studies of Xiangsha Liu Junzitang for the prevention and treatment of gastric cancer were summarized and sorted out,and the mechanism of Xiangsha Liu Junzitang for the prevention and treatment of gastric cancer was elaborated in order to provide useful references for the clinical and basic research on Xiangsha Liu Junzitang in the field of gastric cancer in the future. In clinical practice,Xiangsha Liu Junzitang can treat gastric precancerous lesions,increase the body immunity of patients with gastric cancer,improve the symptoms of spleen and stomach weakness after gastric cancer surgery,and reduce the adverse reactions of the digestive tract after chemotherapy for gastric cancer. Its clinical efficacy is superior to that of western medicine alone whether it is combined with western medicine or used alone. In the experimental research,Xiangsha Liu Junzitang has the effects of regulating inflammatory factors,inhibiting the proliferation of gastric cancer cells,promoting the apoptosis of gastric cancer cells,and improving the activity of pepsin. Modern pharmacological research has shown that Xiangsha Liu Junzitang can conduct a comprehensive intervention with multiple components and multiple targets. The main components of a single drug contained include saponins,polysaccharides,lactones,volatile oils,organic acids,and others, with the effects of protecting gastric mucosa,regulating endocrine,and promoting apoptosis of epithelial cells in gastric mucosal dysplasia,reflecting the advantages and values of traditional Chinese medicine in the prevention and treatment of gastric cancer.

12.
Chinese Journal of Hematology ; (12): 924-929, 2023.
Artigo em Chinês | WPRIM | ID: wpr-1012258

RESUMO

Objective: To explore the clinical, pathological, diagnostic, treatment, and prognostic features of children with mature B-cell lymphoma (MBCL) . Methods: This retrospective study included pediatric patients with MBCL with chromosome 11 long-arm abnormalities who were diagnosed and treated at our hospital from December 2018 to February 2023. Results: Among the 11 pediatric patients with MBCL, nine were male and two were female, with a median age of 9 (2-13) years and a median disease course of 1.8 (0.5-24) months. The clinical manifestations were cervical lymph node enlargement in four patients, nasal congestion and snoring in four patients, abdominal pain in two patients, and difficulty breathing in one patient. There were seven cases of Burkitt's lymphoma, two of follicular lymphoma, and two of advanced B-cell lymphoma according to the pathological morphology examination. No patients had central nervous system or bone marrow involvement, and no extensive metastasis was observed on B-ultrasound or positron emission tomography-computed tomography (PET/CT). One patient had a huge tumor lesion. The Revised International Pediatric Non-Hodgkin Lymphoma Staging System classified four patients as stage Ⅱ, five as stage Ⅲ, and two as stage Ⅳ. 11q probe detection showed five cases of 11q gain, three of 11q loss, and three of both gain and loss. FISH showed positive MYC expression in three patients, including eight with advanced B-cell lymphoma with 11q abnormalities and three with Burkitt's lymphoma with 11q abnormalities. According to the 2019 edition of the National Health Commission's diagnostic and treatment guidelines for invasive MBCL in children, one patient was classified as Group A, two as Group B, and eight as Group C. Early evaluation of the efficacy showed complete remission. After mid-term evaluation, the intensity of chemotherapy was reduced in Group B and Group C. Among two cases of chemotherapy, the remaining nine cases had a median follow-up of 32 (6-45) months, and none had event-related survival. Conclusion: The incidence of MBCL with 11q abnormalities in children is low, clinical symptoms are mild, and progression is slow. The absence of MYC, BCL2, BCL6 rearrangements, C-MYC negative and 11q abnormalities on FISH is an important diagnostic indicator, and reducing the intensity of chemotherapy can improve prognosis.


Assuntos
Humanos , Feminino , Masculino , Criança , Adolescente , Linfoma de Burkitt/genética , Cromossomos Humanos Par 11 , Tomografia por Emissão de Pósitrons combinada à Tomografia Computadorizada , Estudos Retrospectivos , Linfoma Folicular , Aberrações Cromossômicas
13.
Journal of Integrative Medicine ; (12): 205-214, 2023.
Artigo em Inglês | WPRIM | ID: wpr-971654

RESUMO

OBJECTIVE@#Anxiety is one of the most common symptoms associated with autistic spectrum disorder. The essential oil of Cananga odorata (Lam.) Hook. f. & Thomson, usually known as ylang-ylang oil (YYO), is often used in aromatherapy as a mood-regulating agent, sedative, or hypotensive agent. In the present study, the effects and mechanisms of YYO in alleviating anxiety, social and cognitive behaviors in autism-like rats were investigated.@*METHODS@#The prenatal valproic acid (VPA) model was used to induce autism-like behaviors in offspring rats. The effectiveness of prenatal sodium valproate treatment (600 mg/kg) on offspring was shown by postnatal growth observation, and negative geotaxis, olfactory discrimination and Morris water maze (MWM) tests. Then three treatment groups were formed with varying exposure to atomized YYO to explore the effects of YYO on the anxiety, social and cognitive behaviors of the autistic-like offspring through the elevated plus-maze test, three-chamber social test, and MWM test. Finally, the monoamine neurotransmitters, including serotonin, dopamine and their metabolites, in the hippocampus and prefrontal cortex (PFC) of the rats were measured using a high-performance liquid chromatography.@*RESULTS@#Offspring of VPA exposure rats showed autism-like behaviors. In the VPA offspring, medium-dose YYO exposure significantly elevated the time and entries into the open arms in the elevated plus-maze test, while low-dose YYO exposure significantly enhanced the social interaction time with the stranger rat in session 1 of the three-chamber social test. VPA offspring treated with YYO exposure used less time to reach the platform in the navigation test of the MWM test. YYO exposure significantly elevated the metabolism of serotonin and dopamine in the PFC of VPA offspring.@*CONCLUSION@#YYO exposure showed the effects in alleviating anxiety and improving cognitive and social abilities in the offspring of VPA exposure rats. The role of YYO was related to the regulation of the metabolism of serotonin and dopamine. Please cite this article as: Zhang N, Wang ST, Yao L. Inhalation of Cananga odorata essential oil relieves anxiety behaviors in autism-like rats via regulation of serotonin and dopamine metabolism. J Integr Med. 2023; 21(2): 205-214.


Assuntos
Gravidez , Feminino , Ratos , Animais , Transtorno Autístico/tratamento farmacológico , Óleos Voláteis/uso terapêutico , Serotonina/metabolismo , Cananga/metabolismo , Dopamina , Ansiedade/tratamento farmacológico , Ácido Valproico/farmacologia , Óleos de Plantas , Modelos Animais de Doenças
14.
Journal of Peking University(Health Sciences) ; (6): 149-155, 2023.
Artigo em Chinês | WPRIM | ID: wpr-971288

RESUMO

OBJECTIVE@#To evaluate the implications of the prognostic nutrition index (PNI) in non-metastatic renal cell carcinoma (RCC) patients treated with surgery and to compare it with other hematological biomarkers, including neutrophil to lymphocyte ratio (NLR), platelet to lymphocyte ratio (PLR), and systemic immune inflammation index (SII).@*METHODS@#A cohort of 328 non-metastatic RCC patients who received surgical treatment between 2010 and 2012 at Peking University First Hospital was analyzed retrospectively. Receiver operating characteristic (ROC) curve analysis was used to determine the optimal cutoff values of the hematological biomarkers. The Youden index was maximum for PNI was value of 47.3. So we divided the patients into two groups (PNI≤ 47. 3 and >47. 3) for further analysis. Categorical variables [age, gender, body mass index (BMI), surgery type, histological subtype, necrosis, pathological T stage and tumor grade] were compared using the Chi-square test and Student' s t test. The association of the biomarkers with overall survival (OS) and disease-free survival (DFS) was analyzed using Kaplan-Meier methods with log-rank test, followed by multivariate Cox proportional hazards model.@*RESULTS@#According to the maximum Youden index of ROC curve, the best cut-off value of PNI is 47. 3. Low level of PNI was significantly associated with older age, lower BMI and higher tumor pathological T stage (P < 0.05). Kaplan-Meier univariate analysis showed that lower PNI was significantly correlated with poor OS and DFS (P < 0.05). In addition, older age, lower BMI, tumor necrosis, higher tumor pathological T stage and Fuhrman grade were significantly correlated with poor OS (P < 0.05). Cox multivariate analysis showed that among the four hematological indexes, only PNI was an independent factor significantly associated with OS, whether as a continuous variable (HR=0.9, 95%CI=0.828-0.978, P=0.013) or a classified variable (HR=2.397, 95%CI=1.061-5.418, P=0.036).@*CONCLUSION@#Low PNI was a significant predictor for advanced pathological T stage, decreased OS, or DFS in non-metastatic RCC patients treated with surgery. In addition, PNI was superior to the other hematological biomar-kers as a useful tool for predicting prognosis of RCC in our study. It should be externally validated in future research before the PNI can be used widely as a predictor of RCC patients undergoing nephrectomy.


Assuntos
Humanos , Prognóstico , Avaliação Nutricional , Carcinoma de Células Renais/cirurgia , Estudos Retrospectivos , Biomarcadores , Neoplasias Renais/patologia
15.
Biomedical and Environmental Sciences ; (12): 903-916, 2023.
Artigo em Inglês | WPRIM | ID: wpr-1007865

RESUMO

OBJECTIVE@#To investigate the fate and underlying mechanisms of G2 phase arrest in cancer cells elicited by ionizing radiation (IR).@*METHODS@#Human melanoma A375 and 92-1 cells were treated with X-rays radiation or Aurora A inhibitor MLN8237 (MLN) and/or p21 depletion by small interfering RNA (siRNA). Cell cycle distribution was determined using flow cytometry and a fluorescent ubiquitin-based cell cycle indicator (FUCCI) system combined with histone H3 phosphorylation at Ser10 (pS10 H3) detection. Senescence was assessed using senescence-associated-β-galactosidase (SA-β-Gal), Ki67, and γH2AX staining. Protein expression levels were determined using western blotting.@*RESULTS@#Tumor cells suffered severe DNA damage and underwent G2 arrest after IR treatment. The damaged cells did not successfully enter M phase nor were they stably blocked at G2 phase but underwent mitotic skipping and entered G1 phase as tetraploid cells, ultimately leading to senescence in G1. During this process, the p53/p21 pathway is hyperactivated. Accompanying p21 accumulation, Aurora A kinase levels declined sharply. MLN treatment confirmed that Aurora A kinase activity is essential for mitosis skipping and senescence induction.@*CONCLUSION@#Persistent p21 activation during IR-induced G2 phase blockade drives Aurora A kinase degradation, leading to senescence via mitotic skipping.


Assuntos
Humanos , Aurora Quinase A/metabolismo , Linhagem Celular Tumoral , Mitose , Ciclo Celular , Radiação Ionizante , RNA Interferente Pequeno/metabolismo , Inibidor de Quinase Dependente de Ciclina p21/metabolismo
16.
Journal of Modern Urology ; (12): 153-156, 2023.
Artigo em Chinês | WPRIM | ID: wpr-1006105

RESUMO

【Objective】 To investigate the current status of incision sites to obtain intact specimens in laparoscopic nephrectomy by urologists in China, so as to provide reference for the standardized procedure. 【Methods】 During Jun.20, 2021 and Jul.4, 2021, more than 20 000 urologists in a WeChat group were surveyed with a questionnaire. The general data, incision sites and related complications were statistically analyzed. 【Results】 A total of 601 valid questionnaires were collected, covering urologists from 31 provinces, autonomous regions and municipalities. Surgical approaches: 68 urologists chose trans-abdominal approach, 432 chose posterior abdominal space approach, 101 chose both surgical approaches. Incision sites: 97 urologists chose lumbar transverse incision, 202 chose dorsal oblique incision of the waist, 119 chose ventral oblique incision, 93 chose the paramedian incision, 112 chose the lower abdominal oblique incision (Gibson), 11 chose the transverse lower abdominal incision (Pfannenstiel), 7 chose the median incision of the lower abdomen, 2 chose the median incision in the upper abdomen, 15 chose axillary midline direct incision; 399 chose to cut off the muscles, and 202 chose not to. Complications: 232 urologists reported pain after 2 weeks, 369 reported no pain; 325 reported numbness after 2 weeks, 276 reported no numbness; 66 reported incisional hernia, 535 reported no hernia. 【Conclusions】 Chinese urologists tend to choose retroperitoneoscopic nephrectomy and waist incision to obtain intact specimens. Transperitoneal laparoscopic nephrectomy has a variety of incisions for intact specimens. There is no standardized incision sites to obtain intact specimens.

17.
China Journal of Chinese Materia Medica ; (24): 22-29, 2023.
Artigo em Chinês | WPRIM | ID: wpr-970497

RESUMO

Owing to the advancement in pharmaceutical technology, traditional Chinese medicine industry has seen rapid development. Preferring conventional manufacturing mode, pharmaceutical enterprises of traditional Chinese medicine have no effective process detection tools and process control methods. As a result, the quality of the final products mainly depends on testing and the quality is inconsistent in the same batch. Process analytical technology(PAT) for traditional Chinese medicine manufacturing, as one of the key advanced manufacturing techniques, can break through the bottleneck in quality control of medicine manufacturing, thus improving the production efficiency and product quality and reducing the material and energy consumption. It is applicable to the process control and real-time release of advanced manufacturing modes such as intelligent manufacturing and continuous manufacturing. This paper summarized the general idea of PAT for traditional Chinese medicine manufacturing. Through the analysis of the characteristics and status quo of the technology, we summed up the methodology for the continuous application and improvement of PAT during the whole life-cycle of traditional Chinese medicine. The five key procedures(process understanding, process detection, process modeling, process control, and continuous improvement) were summarized, and the application was reviewed. Finally, we proposed suggestions for the technical and regulatory challenges in implementing PAT in traditional Chinese medicine industry. This paper aims to provide a reference for development and application of PAT in advanced manufacturing, intelligent manufacturing, and continuous manufacturing of traditional Chinese medicine industry.


Assuntos
Medicina Tradicional Chinesa , Medicamentos de Ervas Chinesas , Tecnologia Farmacêutica , Indústria Farmacêutica , Controle de Qualidade
18.
Biomedical and Environmental Sciences ; (12): 160-173, 2023.
Artigo em Inglês | WPRIM | ID: wpr-970303

RESUMO

OBJECTIVE@#To provide useful information for selecting the most appropriate peripheral nerve injury model for different research purposes in nerve injury and repair studies, and to compare nerve regeneration capacity and characteristics between them.@*METHODS@#Sixty adult SD rats were randomly divided into two groups and underwent crush injury alone (group A, n = 30) or transection injury followed by surgical repair (group B, n = 30) of the right hind paw. Each group was subjected to the CatWalk test, gastrocnemius muscle evaluation, pain threshold measurement, electrophysiological examination, retrograde neuronal labeling, and quantification of nerve regeneration before and 7, 14, 21, and 28 days after injury.@*RESULTS@#Gait analysis showed that the recovery speed in group A was significantly faster than that in group B at 14 days. At 21 days, the compound muscle action potential of the gastrocnemius muscle in group A was significantly higher than that in group B, and the number of labeled motor neurons in group B was lower than that in group A. The number of new myelin sheaths and the g-ratio were higher in group A than in group B. There was a 7-day time difference in the regeneration rate between the two injury groups.@*CONCLUSION@#The regeneration of nerve fibers was rapid after crush nerve injury, whereas the transection injury was relatively slow, which provides some ideas for the selection of clinical research models.


Assuntos
Animais , Ratos , Fibras Nervosas , Regeneração Nervosa , Ratos Sprague-Dawley , Nervo Isquiático/lesões
19.
Chinese Journal of Oncology ; (12): 64-73, 2023.
Artigo em Chinês | WPRIM | ID: wpr-969807

RESUMO

Objective: To investigate the expression and significance of protease activated receptor 2 (PAR2) in ovarian epithelial carcinoma. Methods: PAR2 mRNA expression levels in 410 cases of epithelial ovarian carcinoma and 88 cases of human normal ovary were analyzed from cancer Genome Atlas (TCGA) database and tissue genotypic expression database (GTEx). Immunohistochemical (IHC) staining of PAR2 protein was performed in 149 patients with ovarian cancer who underwent primary surgical treatment at Cancer Hospital of Chinese Academy of Medical Sciences. Then the relationship between mRNA/protein expression of PAR2 and clinicopathological features and prognosis was analyzed. Gene functions and related signaling pathways involved in PAR2 were studied by enrichment analysis. Results: The mRNA expression of PAR2 in epithelial ovarian carcinoma was significantly higher than that in normal ovarian tissue (3.05±0.72 vs. 0.33±0.16, P=0.004). There were 77 cases showing positive and 19 showing strong positive of PAR2 IHC staining among the 149 patients, accounting for 64.4% in total. PAR2 mRNA/protein expression was closely correlated with tumor reduction effect and initial therapeutic effect (P<0.05). Survival analysis showed that the progression free survival time (P=0.033) and overall survival time (P=0.011) in the group with high PAR2 mRNA expression was significantly lower than that in the low PAR2 mRNA group. Multivariate analysis showed tumor reduction effect, initial therapeutic effect were independent prognostic factors on both progression-free survival and overall survival (P<0.05). The progression-free survival (P=0.016) and overall survival (P=0.038) of the PAR2 protein high expression group was significantly lower than that of the low group. Multivariate analysis showed PAR2 expression, initial treatment effect and chemotherapy resistance were independent prognostic factors on both progression-free survival and overall survival (P<0.05). Based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), PAR2 target genes were mainly enriched in function related to intercellular connection, accounting for 40%. Gene enrichment analysis (GSEA) showed that the Wnt/β-catenin signaling pathway (P=0.023), the MAPK signaling pathway (P=0.029) and glycolysis related pathway (P=0.018) were enriched in ovarian cancer patients with high PAR2 mRNA expression. Conclusions: PAR2 expression is closely related to tumor reduction effect, initial treatment effect and survival of ovarian cancer patients. PAR2 may be involved in Wnt/β-catenin signaling pathway and intercellular connection promoting ovarian cancer invasion and metastasis.


Assuntos
Feminino , Humanos , Carcinoma Epitelial do Ovário , Receptor PAR-2 , Neoplasias Ovarianas/patologia , Prognóstico , RNA Mensageiro/metabolismo
20.
The Korean Journal of Pain ; : 60-71, 2023.
Artigo em Inglês | WPRIM | ID: wpr-969175

RESUMO

Background@#The purpose of this research was to assess the role of heparanase (HPSE)/syndecan1 (SDC1)erve growth factor (NGF) on cancer pain from melanoma. @*Methods@#The influence of HPSE on the biological function of melanoma cells and cancer pain in a mouse model was evaluated. Immunohistochemical staining was used to analyze HPSE and SDC1. HPSE, NGF, and SDC1 were detected using western blot. Inflammatory factors were detected using ELISA assay. @*Results@#HPSE promoted melanoma cell viability, proliferation, migration, invasion, and tumor growth, as well as cancer pain, while SST0001 treatment reversed the promoting effect of HPSE. HPSE up-regulated NGF, and NGF feedback promoted HPSE. High expression of NGF reversed the inhibitory effect of HPSE down-regulation on melanoma cell phenotype deterioration, including cell viability, proliferation, migration, and invasion. SST0001 down-regulated SDC1 expression. SDC1 reversed the inhibitory effect of SST0001 on cancer pain. @*Conclusions@#The results showed that HPSE promoted melanoma development and cancer pain by interacting with NGF/SDC1. It provides new insights to better understand the role of HPSE in melanoma and also provides a new direction for cancer pain treatment.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA