Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 4 de 4
Filtrar
Adicionar filtros








Intervalo de ano
1.
Artigo em Chinês | WPRIM | ID: wpr-521070

RESUMO

Objective To investigate the effects of compound bifonazole solution for the treatment of superficial mycosis.Methods The study groups were treated with compound bifonazole solution and the control group with clotrimazole solution in a double-blind controlled clinical trial.The solutions were applied to skin lesions once a day.The course of treatment was two weeks for tinea corporis and tinea cruris and four weeks for tinea manus and tinea pedis.The patients were followed up weekly for two weeks after cessation of treatment and evaluated with regard to erythema,papule,blister,scale,keratinization and pruritus.Mycologic examinations were performed before,during and right after treatment and two weeks after treatment.Results A total of434patients participated into the study.The clinical cure rates of study group were82.25%in tinea corporis and tinea cruris,and68.75%tinea manus and tinea pedis,with a total response rates of95.85%and92.5%in tinea corporis and tinea cruris,and92.5%in tinea manus and tinea pedis,respectively.The clinical cure rates of control group were58.6%in tinea corporis and tinea cruris,and44.7%in tinea manus and tinea pedis,with a total response rates of83.0%and87.2%in tinea corporis and tinea cruris,and in tinea manus and tinea pedis,respectively.The MICs to350clinical isolates of pathogenic fungi were1.6~2.5mg/L for compound bifonazole solution,and3.125~25mg/L for clotrimazole solution.Conclusions Compound bifonazole solution is a high-effective,broad-spectrum anti-fungal agent.It is keratolytic,well permeable and safe for relatively long term application.

2.
Artigo em Chinês | WPRIM | ID: wpr-516766

RESUMO

Objective To explore the pathogenic relationship between cell surface hydrophobicity (CSH) and adhesion of Cryptococcus neoformans (C.neoformans) to host cells. Method Some drugs and chemical agents were used to pre treat the yeast to observe the impact of iatrogenic factors on CSH, adhesion to host cells and capsule of the yeasts which were treated pretreated with low concentration of drugs and chemical agents for short duration in vitro. Results The results showed that both amphotericin B (AmB) and fluconazole (FCZ) decreased the adhesion of the yeasts, and caused vasiation of CSH. Ampicillin (AMP) had little influence on CSH and adhesion of the yeasts to host cells, but it caused characteristic ultrastructural changes of outer wall of yeasts and acapsulated changes which were reversible as AmB did. FCZ produced a different ultrazstructural change of the yeast′s wall and capsulated change. The chemical agents, such as PHA, ConA, fucose, mercaptoethanol and trypsin decreased CSH and adhesion level of the yeast while lectin increased adhesion level. Conclusion The above data suggest that there is no significant relationship among CSH, adhesion to host cells and the capsule of C.neoformans which are three independent biologic features of the cell wall surface of yeasts.

3.
Artigo em Chinês | WPRIM | ID: wpr-516769

RESUMO

Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

4.
Artigo em Chinês | WPRIM | ID: wpr-518228

RESUMO

Objective To evaluate the antigenic specificity of the enolase.Methods and Results The results included:(1)Western blot analysis demonstrated that enolase was a main protein in the nonglyco-proteins of C.albicans which could react with the serum of C.albicans infected rabbit.(2)The purified enolase was used to immunize rabbit for producing anti-enolase serum,and the hig hest titer of polyclonal antibody against enolase was up to 1:6400with enzyme-linked immunoadso rbent assay(ELISA).(3)Compared with three other polyclonal antibodies,anti-enola se antibody showed high specificity in detecting C.albicans antigen.Conclusion Enolase as a specific antigen,is worthy of further investigation in C.albicans cell.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA