RESUMO
Objective:To evaluate the diagnostic value of multiparametric cardiac magnetic resonance(CMR)or detecting the occurrence of acute rejection(AR)after heart transplantation(HT).Methods:From 2019 to 2021, 44 HT recipients are prospectively recruited from Guangdong Provincial People's Hospital.Another 51 healthy volunteers are recruited from a local community as healthy controls.CMR studies are performed for obtaining baseline parameters.According to the clinicopathological diagnostic criteria of AR by the consensus of International Society for Heart and Lung Transplantation, 81 CMR studies of 44 HT recipients are further divided into two groups of AR (18 cases)and non-AR(71 cases). CMR parameters includ global ventricular structure/function, T2, T1, extracellular volume(ECV)and late gadolinium enhancement(LGE). A combined model is established by binary Logistic regression and receiver operator characteristic curve(ROC)constructed.Results:The age range is(41.8±16.8)years in 44 HT recipients and(41.8±9.7)years in 51 healthy controls.T1 mapping indicated that myocardial global ECV of left ventricle is significantly higher in AR patients than non-AR controls(32.4%±6.0% vs 28.5%±2.4%; P<0.001 9). Global native T1 is higher in AR group than that in non-AR group(49.8±3.1 vs 47.5±2.8 ms, P=0.009)and the difference is statistically significant.The cutoff value of global ECV is 30.62% with a sensitivity of 61% and a specificity of 86% for detecting AR.And T2 mapping reveale that T2 value of global left ventricle is significantly higher in AR group than that in non-AR group(49.8±3.1 vs 47.5±2.8 ms, P=0.009). LGE extent is significantly higher in AR group than those in non-AR group( P=0.004). Through including global native T1 and ECV into a logistic regression model, multiparametric CMR can yield an area under curve(AUC)of 0.794.It hints at the potential of CMR for detecting AR. Conclusions:Multiparametric cardiac magnetic resonance offers an excellent predictive capacity for a noninvasive detection of AR.
RESUMO
Objective To analyze the therapeutic effect of percutaneous transhepatic cholangial drainage (PTCD) in the treatment of bile duct obstruction in patients with malignant hilar bile duct carcinoma,and to discuss the clinical application and practical value of PTCD.Methods A total of 55 patients with malignant biliary obstruction were divided into the PTCD group (30 cases who recieved percutaneous transhepatic cholangial drainage) and the control group (25 cases who recieved endoscopic stent implantation).Observed the preoperative and postoperative biochemical indexes of PTCD group,including serum total bilirubin (TB),serum direct bilirubin (DB),serum alanine aminotransferase (ALT) and serum glutamic acid amino turn shift of aspartate aminotransferase(AST) and serum alkaline phosphatase(AKP).Compared the effect rate and postoperative survival time of the two groups through postoperative follow-up.Results The TB,DB,ALT,AST and APK of PTCD group one week after operation changed obviously compared with the relative index before opreation with statistically significant differences (P<0.05), which indicated a significant improvement of biochemical indicators.The treatment efficiency of the PTCD group and the control group were 83.3% and 64.0% respectively, and survival time of the two groups were(7.5±2.6)months and(4.8±2.8)months respectively.Results of the PTCD group was significantly better than that of the control group,and the differences were statistically significant(P<0.05).Conclusion All the patients with PTCD get better biochemical indicators and longer postoperative survival time,and the interventional therapy PTCD can be used as an effective clinical treatment method for bile duct obstruction with malignant hilar bile duct carcinoma.
RESUMO
Objective To evaluate the diagnostic and prognostic value of BRAF V600E mutation screening of ultrasound-guided fine-needle aspiration (FNA)specimens in patients with thyroid nodule. Methods The BRAF V600E mutation status were assessed in FNA specimens of 104 patients with thyroid nodules before operations.The BRAF mutation status,clinical,and pathology records of the patients were reviewed and the associations between these characteristics and papillary thyroid cancer (PTC ) were analyzed.Results Seventy-one PTC and 14 benign thyroid nodules were included in this study.BRAF V600E mutations were found in 57/71 (80%)PTC.All benign thyroid nodules had no BRAF V600E mutation.The sensitivity,specificity,positive predictive value and negative predictive value of BRAF V600E mutations in differentiation between PTC and benign thyroid nodules were 80%,100%,100% and 50%(P < 0.001 ).In 44 patients with PTC who underwent surgery,the central compartment lymph node metastases and extrathyroidal invasion were not significantly different between BRAF-positive and BRAF-negative PTC (P = 0.283 and 0.307 ).Conclusions BRAF V600E mutation may be a potential tool to facilitate ultrasound in diagnosis of PTC.In patients with PTC,the presence of the BRAFV600E mutation was not significantly associated with prognostic factors.
RESUMO
Objective:To assess the effect of rosiglitazone on inflammation in peritoneal dialysis patients. Methods:Fifty patients undergoing continuous ambulatory peritoneal dialysis were collected in our hospital. The treatment group was assigned to receive regular peritoneal dialysis and rosiglitazone 4mg once daily while the control group was received regular peritoneal dialysis for 12 weeks. Such serum examinations as fasting blood glucose (FBG), glycosylated hemoglobin A1c, haemoglobin, serum total cholesterol, high density lipoprotein cholesterol(HDL-C), low density lipoprotein cholesterol, triglycerides and high sensitivity C reactive protein (hs-CRP) were measured, tumor necrosis factorα(TNF-α) and interleukin-6 (IL-6) levels were measured by ELISA, and homeostasis model as-sessment of insulin resistance( HOMA-IR) was also evaluated before and after the treatment. Results:After the 12-week treatment by rosiglitazone, the levels of FPG, HOMA-IR, hs-CRP, TNF-αand IL-6 were declined significantly(P<0. 05), and the level of HDL-C was increased significantly(P<0. 05). Conclusion: Rosiglitazone shows significant anti-inflammatory, insulin resistance improve-ment and anti-lipidemic effects in peritoneal dialysis patients.
RESUMO
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
RESUMO
Objective To establish an HPLC method for the determination of ginsenosides Rg1 and Re in Shenqi Granula.Methods Chromasil C18 column(250 mm?4.6 mm)was used with acetonitrile-0.05% phosphoric acid solution(21∶79)as mobile phase.The flow rate was 1 mL/min and the detected wavelength was 203 nm.Results Ginsenosides Rg1 and Re could be baseline separated with in 30 min.The average recovery rates were 99.60% and 98.5%,corresponding RSD were 1.93% and 2.31% for ginsenoside Rg1 and Re,respectively(n=5).Conclusion This method is fast and accurate and can be used for quality control of Shenqi Granula.
RESUMO
Objective To determine the anatomical basis of an algorithm to safely elevate the deep circumflex iliac artery osteocutaneous perforator(DCIAP) flap. Methods 1.Six unfixed corpses underwent whole body gelatine/lead oxide injection.Specimens were dissected by layers.Angiography and photography were used to document the precise course,size,location,and type of individual perforators in the lateral lumbar region.The surface areas of cutaneous territories and perforator zones were measured and calculated with Photoshop and Scion Image.2.One specimen also underwent whole body carboxymethylcellulose/lead oxide injection,CT scan and 3D-Reconstrution. Results An average of 1.6 DCIA perforators with a diameter of 0.7mm was present in 92% of specimens.Perforators were located 5~10 cm posterior to the anterior superior iliac spine,12~35mm above the crest,with a perforator zone of 31 cm~2.The DCIA reliably perfused the medial aspect of the iliac crest.Conclusion The DCIA reliably perfused the medial aspect of the iliac crest and lateral lumbar region.It offers a large quantity of bone on a pedicle of large diameter.The mobility of the skin component allows better tissue positioning during complex reconstructions.