Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 60
Filtrar
1.
Chinese Journal of Obstetrics and Gynecology ; (12): 368-377, 2023.
Artigo em Chinês | WPRIM | ID: wpr-985660

RESUMO

Objective: To investigate the mechanism of signal transducer and activator of transcription 3 (STAT3) and cancer associated fibroblasts (CAF) jointly generate chemo-resistance in epithelial-ovarian cancer and their effect on prognosis. Methods: A total of 119 patients with high-grade ovarian serous cancer who received surgery in Cancer Hospital of Chinese Academy of Medical Sciences from September 2009 to October 2017 were collected. The clinico-pathological data and follow-up data were complete. Multivariate Cox regression model was used to analyze the prognostic factors. Ovarian cancer tissue chips of patients in our hospital were prepared. EnVision two-step method immunohistochemistry was used to detect the protein expression levels of STAT3, the specific markers of CAF activation, fibroblast activating protein (FAP), and type Ⅰ collagen (COL1A1) secreted by CAF. The relationship between the expression of STAT3, FAP, COL1A1 protein and drug resistance and prognosis of ovarian cancer patients was analyzed, and the correlation between the expression of three proteins was analyzed. These results were verified through the gene expression and prognostic information of human ovarian cancer tissues collected in the GSE26712 dataset of gene expression omnibus (GEO) database. Results: (1) Multivariate Cox regression model analysis showed that chemotherapy resistance was an independent risk factor for overall survival (OS) of ovarian cancer (P<0.001). (2) The expression levels of STAT3, FAP, and COL1A1 proteins in chemotherapy resistant patients were significantly higher than those in chemotherapy sensitive patients (all P<0.05). Patients with high expression of STAT3, FAP, and COL1A1 had significantly shorter OS than those with low expression (all P<0.05). According to the human ovarian cancer GSE26712 dataset of GEO database, patients with high expression of STAT3, FAP, and COL1A1 also showed shorter OS than patients with low expression (all P<0.05), the verification results were consistent with the detection results of ovarian cancer patients in our hospital. (3) Correlation analysis showed that the protein level of STAT3 was positively correlated with FAP and COL1A1 in our hospital's ovarian cancer tissue chips (r=0.47, P<0.001; r=0.30, P=0.006), the analysis of GEO database GSE26712 dataset showed that the expression of STAT3 gene and FAP, COL1A1 gene were also significantly positively correlated (r=0.31, P<0.001; r=0.52, P<0.001). Conclusion: STAT3 and CAF could promote chemotherapy resistance of ovarian cancer and lead to poor prognosis.


Assuntos
Feminino , Humanos , Fibroblastos Associados a Câncer/patologia , Carcinoma Epitelial do Ovário , Neoplasias Ovarianas/patologia , Prognóstico , Fator de Transcrição STAT3/metabolismo , Resistencia a Medicamentos Antineoplásicos
2.
Chinese Journal of Applied Clinical Pediatrics ; (24): 457-460, 2023.
Artigo em Chinês | WPRIM | ID: wpr-990060

RESUMO

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

3.
Biomedical and Environmental Sciences ; (12): 903-916, 2023.
Artigo em Inglês | WPRIM | ID: wpr-1007865

RESUMO

OBJECTIVE@#To investigate the fate and underlying mechanisms of G2 phase arrest in cancer cells elicited by ionizing radiation (IR).@*METHODS@#Human melanoma A375 and 92-1 cells were treated with X-rays radiation or Aurora A inhibitor MLN8237 (MLN) and/or p21 depletion by small interfering RNA (siRNA). Cell cycle distribution was determined using flow cytometry and a fluorescent ubiquitin-based cell cycle indicator (FUCCI) system combined with histone H3 phosphorylation at Ser10 (pS10 H3) detection. Senescence was assessed using senescence-associated-β-galactosidase (SA-β-Gal), Ki67, and γH2AX staining. Protein expression levels were determined using western blotting.@*RESULTS@#Tumor cells suffered severe DNA damage and underwent G2 arrest after IR treatment. The damaged cells did not successfully enter M phase nor were they stably blocked at G2 phase but underwent mitotic skipping and entered G1 phase as tetraploid cells, ultimately leading to senescence in G1. During this process, the p53/p21 pathway is hyperactivated. Accompanying p21 accumulation, Aurora A kinase levels declined sharply. MLN treatment confirmed that Aurora A kinase activity is essential for mitosis skipping and senescence induction.@*CONCLUSION@#Persistent p21 activation during IR-induced G2 phase blockade drives Aurora A kinase degradation, leading to senescence via mitotic skipping.


Assuntos
Humanos , Aurora Quinase A/metabolismo , Linhagem Celular Tumoral , Mitose , Ciclo Celular , Radiação Ionizante , RNA Interferente Pequeno/metabolismo , Inibidor de Quinase Dependente de Ciclina p21/metabolismo
4.
Chinese Journal of Oncology ; (12): 64-73, 2023.
Artigo em Chinês | WPRIM | ID: wpr-969807

RESUMO

Objective: To investigate the expression and significance of protease activated receptor 2 (PAR2) in ovarian epithelial carcinoma. Methods: PAR2 mRNA expression levels in 410 cases of epithelial ovarian carcinoma and 88 cases of human normal ovary were analyzed from cancer Genome Atlas (TCGA) database and tissue genotypic expression database (GTEx). Immunohistochemical (IHC) staining of PAR2 protein was performed in 149 patients with ovarian cancer who underwent primary surgical treatment at Cancer Hospital of Chinese Academy of Medical Sciences. Then the relationship between mRNA/protein expression of PAR2 and clinicopathological features and prognosis was analyzed. Gene functions and related signaling pathways involved in PAR2 were studied by enrichment analysis. Results: The mRNA expression of PAR2 in epithelial ovarian carcinoma was significantly higher than that in normal ovarian tissue (3.05±0.72 vs. 0.33±0.16, P=0.004). There were 77 cases showing positive and 19 showing strong positive of PAR2 IHC staining among the 149 patients, accounting for 64.4% in total. PAR2 mRNA/protein expression was closely correlated with tumor reduction effect and initial therapeutic effect (P<0.05). Survival analysis showed that the progression free survival time (P=0.033) and overall survival time (P=0.011) in the group with high PAR2 mRNA expression was significantly lower than that in the low PAR2 mRNA group. Multivariate analysis showed tumor reduction effect, initial therapeutic effect were independent prognostic factors on both progression-free survival and overall survival (P<0.05). The progression-free survival (P=0.016) and overall survival (P=0.038) of the PAR2 protein high expression group was significantly lower than that of the low group. Multivariate analysis showed PAR2 expression, initial treatment effect and chemotherapy resistance were independent prognostic factors on both progression-free survival and overall survival (P<0.05). Based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), PAR2 target genes were mainly enriched in function related to intercellular connection, accounting for 40%. Gene enrichment analysis (GSEA) showed that the Wnt/β-catenin signaling pathway (P=0.023), the MAPK signaling pathway (P=0.029) and glycolysis related pathway (P=0.018) were enriched in ovarian cancer patients with high PAR2 mRNA expression. Conclusions: PAR2 expression is closely related to tumor reduction effect, initial treatment effect and survival of ovarian cancer patients. PAR2 may be involved in Wnt/β-catenin signaling pathway and intercellular connection promoting ovarian cancer invasion and metastasis.


Assuntos
Feminino , Humanos , Carcinoma Epitelial do Ovário , Receptor PAR-2 , Neoplasias Ovarianas/patologia , Prognóstico , RNA Mensageiro/metabolismo
5.
International Journal of Biomedical Engineering ; (6): 527-531, 2022.
Artigo em Chinês | WPRIM | ID: wpr-989300

RESUMO

Objective:To explore the correlation between the serum 25-(OH)D 3, adiponectin (APN), and chemerin levels of pregnant women with gestational diabetes mellitus (GDM) and insulin resistance. Methods:28 pregnant women with GDM were selected for the study group from May 2020 to December 2021, and 45 pregnant women with normal glucose tolerance were selected for the control group. 25-(OH)D 3, APN, chemerin, islet resistance index (HOMA-IR), fasting blood glucose, fasting insulin, and HbA1c were compared between the two groups. The correlation between 25-(OH)D 3, APN, chemerin, and GDM insulin resistance was analyzed. Results:Fasting blood glucose, fasting insulin, HOMA-IR, and chemerin in the GDM group were higher than those in the control group (all P<0.05), while 25-(OH)D 3 and APN were lower than those in the control group (all P<0.05). There was no statistical difference in HbA1c between the two groups. Logistic regression analysis showed that serum 25-(OH)D 3, APN, and chemerin were all related influencing factors of GDM (all P<0.05). Spearman's correlation analysis showed that serum 25-(OH)D 3 was negatively correlated with fasting blood glucose and HOMA-IR (all P<0.05), chemerin was positively correlated with fasting insulin and HOMA-IR (all P<0.05). ROC curve analysis showed that the AUC of 25-(OH)D 3 was 0.841 (95% CI: 0.746~0.967). AUC of APN was 0.678 (95% CI: 0.545~0.812). AUC of chemerin AUC was 0.360 (95% CI: 0.233~0.487). Conclusions:The levels of 25-(OH)D 3, APN, and chemerin have a certain correlation with the pathogenesis of GDM, which has a certain reference value for the prediction of GDM.

6.
Chinese Journal of Biochemistry and Molecular Biology ; (12): 1493-1503, 2022.
Artigo em Chinês | WPRIM | ID: wpr-1015827

RESUMO

Glutamate excitotoxicity mediated by metabotropic glutamate receptor 1 (mGluR1) overexpression or overactivation plays an important role in the development of Parkinson's disease (PD). Although clinical trials support the therapeutic potential of certain mGluR negative allosteric modulators (NAMs), there are still some limitations of precise modulation of mGluR using NAMs. Thus, the identification of small molecules or endogenous genes that facilitate mGluR1 modulation might be potentially beneficial for PD treatment. We determined the role of interacting partner cystic fibrosis transmembrane conductance regulator-associated ligand (CAL) in overactivated mGluR1-mediated cell apoptosis and signaling pathway in vitro and in vivo. HEK293 cells were used as an experimental tool to directly examine the interaction between CAL and mGluR1. We found that agonist of mGluR1 significantly enhanced the interaction between CAL and mGluR1 (P< 0. 05). Furthermore, CAL suppressed overactivated mGluR1-induced cell apoptosis and the activation of mGluR1 downstream signaling pathways. CAL overexpression relieved rotenone-induced neuron death (P< 0. 001) by inhibiting the activation of mGluR1-mediated signaling pathways in rotenone-induced rat model of PD. This study may reveal a new mechanism of mGluR1 activity regulation, and hopefully provide a novel molecular mechanism for the nervous system related diseases.

7.
Chinese Pharmacological Bulletin ; (12): 552-561, 2022.
Artigo em Chinês | WPRIM | ID: wpr-1014117

RESUMO

Aim To investigate the expression of Foxos in human umbilical vein endothelial cells(HUVECs)with insulin resistance(IR)induced by high glucose and high fat(HG/HF)stress and its significance.Methods First, the IR model of endothelial cells was established by HG /HF stress.The differential expression of Foxos gene in normal(Ctrl )group and HG /HF group was observed, and the subtypes with the most significant changes in Foxos were screened out, such as Foxo6.Next, Foxo6 was silenced to observe its role in endothelial cell with IR.Finally, whether the mechanism of Foxo6-mediated IR was related to the interaction of NF-κB signaling was investigated.Results The expression increase of Foxo6 was the most significant among Foxos under the IR condition induced by HG/HF.Using a small RNA interference and plasmid transfection technique, we found that the silence effect of the siRNA3 fragments targeting Foxo6 was the most significant among the siRNAs.Moreover, the further study showed that silencing the Foxo6 gene could significantly reverse the endothelial IR induced by HG/HF, and the mechanism of the reversal effect was related to the interaction between the Foxo6 and NF-κB signal.Conclusions Foxo6 mediates the endothelial cell IR induced by the HG /HF stress.The underlying mechanism is that Foxo6 can interact with NF-κBp65 and activate NF-κB signaling pathway.Silencing Foxo6 can improve the IR of vascular endothelial cells induced by HG /HF stress.

8.
Biomedical and Environmental Sciences ; (12): 437-447, 2022.
Artigo em Inglês | WPRIM | ID: wpr-927682

RESUMO

Objective@#miR-663a has been reported to be downregulated by X-ray irradiation and participates in radiation-induced bystander effect via TGF-β1. The goal of this study was to explore the role of miR-663a during radiation-induced Epithelium-to-mesenchymal transition (EMT).@*Methods@#TGF-β1 or IR was used to induce EMT. After miR-663a transfection, cell migration and cell morphological changes were detected and the expression levels of miR-663a, TGF-β1, and EMT-related factors were quantified.@*Results@#Enhancement of cell migration and promotion of mesenchymal changes induced by either TGF-β1 or radiation were suppressed by miR-663a. Furthermore, both X-ray and carbon ion irradiation resulted in the upregulation of TGF-β1 and downregulation of miR-663a, while the silencing of TGF-β1 by miR-663a reversed the EMT process after radiation.@*Conclusion@#Our findings demonstrate an EMT-suppressing effect by miR-663a via TGF-β1 in radiation-induced EMT.


Assuntos
Regulação para Baixo , Transição Epitelial-Mesenquimal , Epitélio/metabolismo , MicroRNAs/metabolismo , Fator de Crescimento Transformador beta1/farmacologia
9.
Chinese Journal of Experimental Traditional Medical Formulae ; (24): 249-256, 2022.
Artigo em Chinês | WPRIM | ID: wpr-940610

RESUMO

The morbidity and mortality of cancer have been on the rise, making it atop the list of human health threats. It has been a conundrum of global magnitude. As the side effects of chemotherapeutics seriously affect the life quality of cancer patients, it is urgent to find effective anti-cancer drugs with small toxic and side effects. In recent years, the anti-cancer effects of traditional Chinese medicine have attracted the interest of scholars. Owing to the improvement of medical research, an increasing number of anti-cancer components with small toxic and side effects have been extracted from traditional Chinese medicine. Rutin, a unique flavonoid in Chinese medicinals and many plants, proves to inhibit the proliferation of breast cancer, colon cancer, lung cancer, and prostate cancer cells. In addition, rutin alone or in combination with other therapeutic drugs can regulate a variety of signaling pathways and signal mediators of inflammation, apoptosis, autophagy, and angiogenesis, thereby suppressing tumor progression. Moreover, it can also alleviate the drug resistance of tumors and the side effect of chemotherapeutics. Nevertheless, it is limited by the low bioavailability and low solubility, to which nano delivery system turns to be a solution. At the moment, the anti-cancer potential of rutin and the molecular targets of it against various cancers have not been summarized and comprehensively analyzed. Therefore, the authors retrieved articles on the anti-cancer effects of rutin in recent years, summed up the mechanisms and molecular targets, and discussed relevant drug delivery systems and the safety, aiming at laying a theoretical foundation for further development and application of the flavonoid.

10.
Chinese Journal of Experimental Traditional Medical Formulae ; (24): 214-220, 2022.
Artigo em Chinês | WPRIM | ID: wpr-940372

RESUMO

The occurrence and development of malignant tumors seriously affect the survival time and quality of life of people all over the world, and finding proper treatment methods has been a focus for doctors. Especially in recent years, traditional Chinese medicine (TCM) has developed and attracted the attention of doctors and patients. From the perspective of TCM syndrome differentiation and treatment, deficiency and stasis are the most fundamental causes of malignant tumors, and supplementing deficiency and removing stasis can be regarded as the basic criteria of TCM treatment of malignant tumors. TCM prescriptions can treat diseases by means of multiple components and multiple targets, with the characteristics of slight side effect and high efficacy, safety and cost performance, as well as easiness to be accepted and taken. As a classic recipe for invigorating Qi and generating blood, Danggui Buxuetang consists of Astragali Radix -Angelicae Sinensis Radix 5∶1. It has excellent effects in anti-tumor, bone marrow suppression after chemotherapy, immune function decline, anemia, heart and cerebral vessels protection, blood deficiency-led fever, diabetes, anti-atherosclerosis, anti-fatigue, anti-radiation, myocardial ischemia alleviation, inhibition of platelet aggregation, liver damage, etc. In addition, with many active anti-tumor ingredients, Danggui Buxuetang can exert anti-tumor effects via acting on multiple targets in different binding sites. However, there has been a lack of reviews on the role of Danggui Buxuetang in malignant tumors so far. Therefore, in this paper, the functions of Danggui Buxuetang in malignant tumors were reviewed. Besides, molecular docking technology was used to analyze the main active anti-tumor ingredients and action targets of Danggui Buxuetang.

11.
Chinese journal of integrative medicine ; (12): 833-839, 2022.
Artigo em Inglês | WPRIM | ID: wpr-939795

RESUMO

OBJECTIVE@#To study the effect of electroacupuncture (EA) on oxaliplatin-induced peripheral neuropathy (OIPN) in rats.@*METHODS@#Male Sprague-Dawley rats were equally divided into 3 groups using a random number table: the control group, the OIPN group, and the EA (OIPN + EA) group, with 10 rats in each. The time courses of mechanical, cold sensitivity, and microcirculation blood flow intensity were determined. The morphology of the dorsal root ganglion (DRG) was observed by electron microscopic examination. The protein levels of nuclear factor E2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), and the transient receptor potential (TRP) protein family in DRGs were assayed by Western blot.@*RESULTS@#EA treatment significantly reduced mechanical allodynia and cold allodynia in OIPN rats (P<0.01). Notably, oxaliplatin treatment resulted in impaired microcirculatory blood flow and pathomorphological defects in DRGs (P<0.01). EA treatment increased the microcirculation blood flow and attenuated the pathological changes induced by oxaliplatin (P<0.01). In addition, the expression levels of Nrf2 and HO-1 were down-regulated, and the TRP protein family was over-expressed in the DRGs of OIPN rats (P<0.01). EA increased the expression levels of Nrf2 and HO-1 and decreased the level of TRP protein family in DRG (P<0.05 or P<0.01).@*CONCLUSION@#EA may be a potential alternative therapy for OIPN, and its mechanism may be mainly mediated by restoring the Nrf2/HO-1 signaling pathway.


Assuntos
Animais , Masculino , Ratos , Eletroacupuntura/métodos , Hiperalgesia/terapia , Microcirculação , Fator 2 Relacionado a NF-E2 , Oxaliplatina/efeitos adversos , Doenças do Sistema Nervoso Periférico/induzido quimicamente , Ratos Sprague-Dawley
12.
Journal of Forensic Medicine ; (6): 332-337, 2021.
Artigo em Inglês | WPRIM | ID: wpr-985222

RESUMO

Objective To test the feasibility and accuracy of with sarcosaprophagous insects postmortem interval (PMI) estimation with sarcosaprophagous insects and provide references for estimation practice. Methods Eleven cases confirmed by the detection results, with complete entomological evidence were selected. The insect species, estimation results and true results involved in the cases were statistically analyzed and compared. Results Thirteen species of insects were found at the criminal scene, including Chrysomya megacephala (Fabricius), Chrysomya rufifacies (Macquart), Chrysomya nigripes (Aubertin), Lucilia sericata (Meigen), Hydrotaea spinigera Stein, Muscina stabulans (Fallén), Sarcophagid (species were not identified), Megaselia scalaris (Loew), Hermetia illucens (Linnaeus), Saprinus splendens (Paykull), Creophilus maxillosus (Linnaeus), Dermestes maculatus (De Geer) and Necrobia ruficollis (Fabricius). The PMI of all eleven cases was within the range of estimated PMI. The estimated results of 72.73% cases were on the same day of the true results. Conclusion Sarcosaprophagous insects can estimate the PMI simply and conveniently. In cases where the PMI is within the time range of one generation of flies or beetles, the estimation results are relatively accurate. However, the estimation is less accurate when the PMI is beyond the time range.


Assuntos
Animais , Autopsia , Dípteros , Entomologia , Insetos , Larva , Mudanças Depois da Morte
13.
China Journal of Chinese Materia Medica ; (24): 767-771, 2021.
Artigo em Chinês | WPRIM | ID: wpr-878938

RESUMO

Based on the characteristics of clinical symptoms of secretory otitis media in traditional Chinese and Western medicine,by reference to clinical diagnostic criteria,efforts were made to analyze and establish the Western medical diagnostic criteria and traditional Chinese medicine( TCM) syndrome differentiation criteria for secretory otitis media,and summarize the modeling methods and model characteristics of secretory otitis media animal models. According to the clinical diagnostic criteria and symptom characteristics,the coincidence degree between the existing animal models and clinical symptoms was evaluated,and its advantages and disadvantages were defined. On the basis of the statistical results,there were fewer methods for modeling secretory otitis media animal models,and only a specific relevant pathogenic mechanism could be revealed. Among them,the model with a higher coincidence degree was genetic engineering technology modeling and injection into the middle ear vesicles. The two modeling methods of bacterial factors highly coincided with the clinical symptoms of Western medicine,but both failed to reflect the TCM syndrome type. Therefore,establishing an animal model that simultaneously reflects the characteristics of clinical symptoms of secretory otitis media in traditional Chinese and Western medicine,and improving the evaluation criteria of secretory otitis media based on animal models are the main tasks of future studies on secretory otitis media.


Assuntos
Animais , China , Modelos Animais de Doenças , Medicina , Medicina Tradicional Chinesa , Otite Média com Derrame/tratamento farmacológico
14.
West China Journal of Stomatology ; (6): 260-266, 2021.
Artigo em Inglês | WPRIM | ID: wpr-878441

RESUMO

OBJECTIVES@#To study the effect and mechanism of low-level laser irradiation (LLLI) on lipopolysaccharide (LPS)-induced inflammatory injury of human periodontal ligament fibroblasts (hPDLFs).@*METHODS@#hPDLFs were inoculated into well plates and randomly divided into the normal group, LPS group, and LPS+LLLI group. The cells in the normal group were cultured in conventional medium. The hPDLFs in the LPS and LPS+LLLI groups were cultured in RPMI1640 medium containing 1 mg·L@*RESULTS@#Compared with the normal group, the LPS group showed increased apoptosis rate of hPDLFs and intracellular free Ca@*CONCLUSIONS@#LLLI has a protective effect on the inflammatory injury of hPDLFs induced by LPS, and the effect is most obvious when the irradiation intensity is 4 J·cm


Assuntos
Humanos , Células Cultivadas , Fibroblastos , Interleucina-1beta , Lasers , Lipopolissacarídeos , Ligamento Periodontal , Fator de Necrose Tumoral alfa
15.
Chinese Journal of Experimental Traditional Medical Formulae ; (24): 244-250, 2021.
Artigo em Chinês | WPRIM | ID: wpr-906323

RESUMO

This paper collated the western medicine and traditional Chinese medicine (TCM) diagnostic criteria of pulmonary fibrosis (PF) based on its clinical characteristics and relevant literature reports and summarized the inductive agents, methods, objects, and mechanisms for replicating the PF animal models as well as their respective advantages and disadvantages. By analyzing the consistency of symptoms among successfully modeled animal models with the clinical characteristics in TCM and western medicine, we found that the intratracheal injection of bleomycin was the most frequently employed method for modeling, and the resulting outcomes were very similar to clinical characteristics in TCM and Western Medicine. Besides, considering the time-saving process, high stability, good repeatability, and low cost, such method was suitable for the rapid screening of drugs. The second preferred method was intraperitoneal injection of paraquat, which exhibited the advantages of high degree of consistency with clinical characteristics of PF caused by paraquat poisoning, low cost, high success rate, and easy operation, which allowed it to be suitable for exploring the mechanism of paraquat poisoning and developing the antidotes. The existing PF animal models shared a fairly high degree of consistency in symptoms with patients diagnosed as having PF in western medicine. However, the criteria for TCM syndrome differentiation remained unclear, and the animal models failed to reflect TCM pathogenesis. It is necessary to establish more accurate TCM diagnostic criteria that focus on syndrome differentiation and reveal TCM etiology and pathogenesis and carry out more experiments concerning TCM syndromes of PF in the future, so as to better treat PF with integrated TCM and Western Medicine.

16.
Chinese Journal of Experimental Traditional Medical Formulae ; (24): 223-231, 2021.
Artigo em Chinês | WPRIM | ID: wpr-905978

RESUMO

Betulinic acid (BA) is a lupane pentacyclic triterpene extracted from a variety of Chinese herbs such as Betulae Platyphyllae Cortex, Astragali Radix, Paeoniae Radix Alba, Jujubae Fructus, Sanguisorbae Radix, Eucommiae Cortex, Glycrrhizae Radix et Rhizoma, Aucklandiae Radix, and Ziziphi Spinosae Semen. It has attracted wide attention from doctors because of its low toxicity, high efficacy, and multiple functions. BA has been found to possess a significant anti-tumor biological activity, and it is expected to become a potential drug for the treatment of malignant tumors. So far, a number of studies have shown that BA is able to promote apoptosis, inhibit proliferation, metastasis and invasion, and induce cell cycle arrest via multiple mechanisms, thus resisting various malignant tumors such as ovarian cancer, breast cancer, gastric cancer, lung cancer, colorectal cancer, and prostate cancer. It exerts the anti-tomor effect by regulating the expression of cancer suppressor genes p53 and p21, triggering the generatoipn of reactive oxygen species (ROS), down-regulating the expression of nuclear transcription factor-κB (NF-κB), adjusting the B lymphocytoma-2 (Bcl-2) family to cause tumor cell apoptosis, and regulating transcription factor Sp1/3/4 to induce apoptosis. Its anti-proliferative activity is mainly achieved via the regulation of cyclin B, cyclin D and cyclin dependent kinases CDK and CDC. Its efficacy in inhibiting metastasis and invasion is mainly realized by regulating matrix metalloproteinase (MMP) and matrix metalloproteinase inhibitor (TIMP), up-regulating E-cadherin, down-regulating N-cadherin and blocking the epithelial-mesenchymal transformation (EMT). In addition, BA also induces cell cycle arrest, affects tumor metabolic reprogramming, and activates autophagy to inhibit tumor. Although there are a large number of studies on BA against tumors and its efficacy has been proved strong, the systematic review on its anti-tumor effect is still lacking. Therefore, this study reviewed the anti-tumor effect and mechanism of BA, in order to provide reference for its subsenquent research.

17.
Chinese Journal of Experimental Traditional Medical Formulae ; (24): 210-217, 2021.
Artigo em Chinês | WPRIM | ID: wpr-905883

RESUMO

Calycosin (CA), a functional phytoestrogenic isoflavone extracted from Chinese herb Astragali Radix, is characterized by high efficiency, low toxicity, and multiple targets and has multiple pharmacological activities such as anti-oxidation, anti-radiation, anti-bacteria, cardio-cerebrovascular protection, and immunity enhancement. A number of studies have proved its significant anti-tumor effect, making it expected to become a potential component for the treatment of malignant tumors. Research shows that CA exerts the anti-tumor effect via multiple mechanisms like inducing tumor cell apoptosis and inhibiting tumor cell proliferation, migration, and invasion. It has been proved to be effective in suppressing breast cancer, colorectal cancer, lung cancer, cervical cancer, ovarian cancer, nasopharyngeal cancer, and other common malignant tumors. Its anti-tumor activity is mainly related to the regulation of B-cell lymphoma-2 (Bcl-2) family genes, microRNA (miRNA), and estrogen receptor β (ERβ) to trigger tumor cell apoptosis. Its anti-proliferation activity is mainly reflected in the regulation of cyclin family, WD repeat-containing protein 7 (WDR7-7), and Ewing sarcoma-associated transcript 1 (EWSAT1). By blocking the epithelial mesenchymal transformation (EMT), vascular endothelial growth factor (VEGF), matrix metalloproteinases (MMPs), CA inhibits tumor cell metastasis and invasion. In addition, it inhibits tumors by regulating autophagy marker Beclin-1 induced tumor cell autophagy and increases the sensitivity to chemotherapy drugs, thus improving the treatment effect. Although there are many reports about the wide range of applications and good effects of CA in anti-tumor, the systematic review of its anti-tumor mechanism is still lacking. Therefore, this study reviewed the anti-tumor effects and mechanisms of CA, aiming to provide reference for researchers and clinical workers.

18.
Chinese Journal of Cardiology ; (12): 680-686, 2021.
Artigo em Chinês | WPRIM | ID: wpr-941335

RESUMO

Objective: To investigate the association between trimethylamine-N-oxide (TMAO) and the degree of coronary atherosclerosis in coronary heart diseases (CHD) patients with type 2 diabetes mellitus. Methods: Consecutive patients, who underwent coronary angiography due to suspected CHD in Beijing Hospital from November 2016 to January 2018, were screened in this cross-sectional study. According to blood glucose level, previous medical history and coronary angiography results, they were divided into CHD without type2 diabetes mellitus(CHD-nDM) group and CHD with type2 diabetes mellitus(CHD-DM) group. Plasma TMAO levels in each group were measured by LC-MS/MS. Spearman correlation analysis was used to evaluate the correlation between TMAO and the number of diseased vessels and Gensini scores. Multivariate logistic regression was used to analyze the correlation between TMAO and high Gensini scores. Results: A total of 590 patients were enrolled in the study, including 238 patients in CHD-DM group and 352 patients in CHD-nDM group. Patients were older, body mass index, blood pressure level, prevalence of history of hypertension and statins use were higher in CHD-DM group than in CHD-nDM group (all P<0.05). The proportion of patients with multivessel disease (2 or more vessels) was also higher in CHD-DM group than in CHD-nDM group (P<0.001). Gensini score was higher in CHD-DM group than in CHD-nDM group (P<0.05). Fasting blood glucose, glycosylated hemoglobin and urea were significantly higher, while low-density lipoprotein cholesterol and hemoglobin were significantly lower in CHD-DM group than in CHD-nDM group (all P<0.05). The levels of TMAO was significantly higher in CHD-DM group than in CHD-nDM group (P<0.001). Spearman correlation analysis showed that TMAO was positively correlated with the number of diseased vessels, Gensini score, age and blood glucose level (r=0.178, 0.189, 0.260, 0.111, respectively, all P<0.01). Multivariate logistic regression analysis showed that, TMAO level was still positively correlated with high Gensini score in CHD-DM group (OR=2.25, 95%CI 1.16-4.38, P=0.017), but not in CHD-nDM group (OR=1.29, 95%CI 0.72-2.31, P=0.386) after adjusting for age, sex, body mass index, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, total cholesterol, triglyceride, history of hypertension, hyperlipidemia, smoking and statin use. Conclusions: In CHD patients with tupe 2 diabetes mellitus, the plasma TMAO level is significantly increased and is independent and positively correlated with the degree of coronary artery disease.

19.
Chinese Journal of Experimental Traditional Medical Formulae ; (24): 92-98, 2020.
Artigo em Chinês | WPRIM | ID: wpr-872862

RESUMO

Patients with low immune function are prone to novel coronavirus infection, which is consistent with the traditional Chinese medicine (TCM) concept of deficiency of vital Qi and invasion of toxin. At present, it is necessary to focus on the development of antiviral drugs, but it is also urgent to study the preparation for regulating the immune system. Mucosal tissue is an important barrier of human immune system. It has an independent immune system with unique functions and structures. It is the body's first line of defense against infection, and is in direct contact with external antigens (such as food, symbiotic bacteria, viruses, etc.). In the resistance to viruses and infections, the mucosal immune system (such as respiratory mucosa, intestinal mucosa, etc.) plays an extremely important role, which can eliminate foreign pathogenic microorganisms or other foreign antigens, so that the virus does not invade the body tissue and cause damage to the body. There are more and more reports on the therapeutic effects of TCM through the mucosal immune system. This paper aims to explore the relationship between mucosal immunity and coronavirus disease-2019 (COVID-19) and the intervention mechanism of TCM, so as to provide useful research methods and therapeutic ideas for the prevention and treatment of COVID-19.

20.
International Journal of Biomedical Engineering ; (6): 65-69,74, 2020.
Artigo em Chinês | WPRIM | ID: wpr-863192

RESUMO

Objective:To investigate the disinfection effectiveness of photodynamic therapy (PDT) combined with ethylenediaminetetraacetic acid (EDTA) disodium salt solution on enterococcus faecalis in lateral root canals.Methods:Sixty-four human single root canal premolars were selected to prepare artificial root canal collaterals, and E. faecalisin root canal collateral infection models were established. The infection model was divided into PDT group ( n=16), PDT combined with EDTA group ( n=16), positive control group ( n=16) and negative control group ( n=16) according to random number table method. In the PDT group, 40 μg/ml hematoporphyrin monomethyl ether was injected into the root canal, and then the root canal was irradiated with a 45 mW laser for 90 s after 5 min incubation. In the PDT combined with EDTA group, the root canal was given 5 ml EDTA solution with 17% mass fraction for 1 min, and then treated with the method same as the PDT group. In the positive control group, the root canal were given 5 ml NaClO solution with a mass fraction of 5.25 % for 1 min. In the negative control group, the root canal were given NaCl solution with a mass concentration of 9 g/L for 1 min. Before and after the treatments, samples were taken in the lateral branches of the root canal with a K file to count plate colonies. After treatments, the roots of each group were placed in sterile brain heart infusion broth (BHI) medium for anaerobic culture for 24 h, and then sampled with a K file, and the number of root canal collaterals was detected statistically. Scanning electron microscopy was used to observe the morphology of the inner wall of lateral branches of root canals after treatments. Results:The sterilization rate of PDT combined with EDTA group was 99.56%, which was significantly higher than that of negative control group (1.98%), positive control group (85.87%) and PDT group (87.53%), the differences were statistically significant (all P<0.05). The reply experiment shows that the number of infection root canals was only 5, which was less than the negative control group (15), positive control group (12) and PDT group (11), and the differences were statistically significant (all P<0.05). Scanning electron microscopy observations showed that no obvious E. faecalis adhered to the inner wall of root canal of PDT combined with EDTA group. Conclusions:PDT combined with EDTA has a good disinfection effectiveness on E. faecalis in lateral canals, and it is expected to provide a new method for the effective killing of E. faecalis in lateral canals in clinical root canal therapy.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA