RESUMO
Three 2,3-diketoquinoxaline alkaloids were isolated from Heterosmilax yunnanensis Gagnep. Their structures were determined through 1D and 2D NMR, HR-ESI-MS, UV, and IR as 1-[5′-(3″-hydroxy-3″-methyl) glutaryl] ribityl-2,3-diketo-1,2,3,4-tetrahydro-6,7-dimethylquinoxaline (1), 1-[2′-(3″-hydroxy-3″-methyl) glutaryl]ribityl-2,3-diketo-1,2,3,4-tetrahydro-6,7-dimethylquinoxaline (2), and 1-ribityl-2,3-diketo-1,2,3,4-tetrahydro-6,7-dimethylquinoxaline (3). Compounds 1 and 2 are novel compounds, and 3 was isolated from H. yunnanensis for the first time. The hepatoprotective activity of these three compounds was evaluated, with compound 3 showing promising hepatoprotective activity.
RESUMO
ObjectiveTo observe the effect of enriched environment (EE) combined with acupuncture at head point (HA) on behavior in rats with autism spectrum disorder. MethodsHealthy female Wistar rats were given peritoneal injection of sodium valproate at 12.5 days of gestation. Twenty-four male offspring rats were randomly selected and then randomly divided into model group (n = 6), EE group (n = 6), HA group (n = 6) and EE combined with HA group (the combined group, n = 6). Six male offspring rats born from female mice injected with the same amount of saline intraperitoneally were as control group. After four weeks of treatment, all the five groups were tested with three-chamber test and marble burying test, and the sociability index, the social novelty index and the number of buried marbles were recorded. The levels of interleukin (IL)-1β and IL-6 in peripheral blood were determined by enzyme-linked immunosorbent assay (ELISA). ResultsAfter treatment, compared with the model group, the sociability index and the social novelty index improved (P < 0.05), the number of buried marbles reduced (P < 0.05), and the levels of IL-6 and IL-1β in peripheral blood decreased in EE group, HA group and the combined group (P < 0.05); while the combined group was the best (P < 0.01). ConclusionBoth EE or acupuncture at HA could improve behavioral symptoms, and reduce the expression of inflammatory factors in rats with autism spectrum disorder. The combination of the two methods showed the best result.
RESUMO
OBJECTIVE@#To explore the effect of chitosan (CS) hydrogel loaded with tendon-derived stem cells (TDSCs; hereinafter referred to as TDSCs/CS hydrogel) on tendon-to-bone healing after rotator cuff repair in rabbits.@*METHODS@#TDSCs were isolated from the rotator cuff tissue of 3 adult New Zealand white rabbits by Henderson step-by-step enzymatic digestion method and identified by multidirectional differentiation and flow cytometry. The 3rd generation TDSCs were encapsulated in CS to construct TDSCs/CS hydrogel. The cell counting kit 8 (CCK-8) assay was used to detect the proliferation of TDSCs in the hydrogel after 1-5 days of culture in vitro, and cell compatibility of TDSCs/CS hydrogel was evaluated by using TDSCs alone as control. Another 36 adult New Zealand white rabbits were randomly divided into 3 groups ( n=12): rotator cuff repair group (control group), rotator cuff repair+CS hydrogel injection group (CS group), and rotator cuff repair+TDSCs/CS hydrogel injection group (TDSCs/CS group). After establishing the rotator cuff repair models, the corresponding hydrogel was injected into the tendon-to-bone interface in the CS group and TDSCs/CS group, and no other treatment was performed in the control group. The general condition of the animals was observed after operation. At 4 and 8 weeks, real-time quantitative PCR (qPCR) was used to detect the relative expressions of tendon forming related genes (tenomodulin, scleraxis), chondrogenesis related genes (aggrecan, sex determining region Y-related high mobility group-box gene 9), and osteogenesis related genes (alkaline phosphatase, Runt-related transcription factor 2) at the tendon-to-bone interface. At 8 weeks, HE and Masson staining were used to observe the histological changes, and the biomechanical test was used to evaluate the ultimate load and the failure site of the repaired rotator cuff to evaluate the tendon-to-bone healing and biomechanical properties.@*RESULTS@#CCK-8 assay showed that the CS hydrogel could promote the proliferation of TDSCs ( P<0.05). qPCR results showed that the expressions of tendon-to-bone interface related genes were significantly higher in the TDSCs/CS group than in the CS group and control group at 4 and 8 weeks after operation ( P<0.05). Moreover, the expressions of tendon-to-bone interface related genes at 8 weeks after operation were significantly higher than those at 4 weeks after operation in the TDSCs/CS group ( P<0.05). Histological staining showed the clear cartilage tissue and dense and orderly collagen formation at the tendon-to-bone interface in the TDSCs/CS group. The results of semi-quantitative analysis showed that compared with the control group, the number of cells, the proportion of collagen fiber orientation, and the histological score in the TDSCs/CS group increased, the vascularity decreased, showing significant differences ( P<0.05); compared with the CS group, the proportion of collagen fiber orientation and the histological score in the TDSCs/CS group significantly increased ( P<0.05), while there was no significant difference in the number of cells and vascularity ( P>0.05). All samples in biomechanical testing failed at the repair site during the testing process. The ultimate load of the TDSCs/CS group was significantly higher than that of the control group ( P<0.05), but there was no significant difference compared to the CS group ( P>0.05).@*CONCLUSION@#TDSCs/CS hydrogel can induce cartilage regeneration to promote rotator cuff tendon-to-bone healing.
Assuntos
Coelhos , Animais , Manguito Rotador/cirurgia , Quitosana , Hidrogéis , Lesões do Manguito Rotador/cirurgia , Cicatrização , Tendões/cirurgia , Colágeno , Células-Tronco , Fenômenos BiomecânicosRESUMO
Introduction: Seed-based analysis has shown that transcutaneous auricular vagus nerve stimulation (taVNS) can modulate the dysfunctional brain network in patients with major depressive disorder (MDD). However, the voxel-based neuropsychological mechanism of taVNS on patients with first-episode MDD is poorly understood. The objective of this study was to assess the effects of an 8-week course of taVNS on patients with first-episode MDD. Methods: Twenty-two patients with first-episode MDD accepted an 8-week course of taVNS treatment. Resting-state functional magnetic resonance imaging (rs-fMRI) scans were performed before and after treatment. Voxel-based analyses were performed to characterize spontaneous brain activity. Healthy controls (n=23) were recruited to minimize test-retest effects. Analysis of covariance (ANCOVA) was performed to ascertain treatment-related changes. Then, correlations between changes in brain activity and the Hamilton Depression Rating Scale (HAM-D)/Hamilton Anxiety Scale (HAM-A) remission rate were estimated. Results: Significant group-by-time interactions on voxel-based analyses were observed in the inferior ventral striatum (VSi) and precuneus. Post-hoc analyses showed that taVNS inhibited higher brain activity in the VSi, while upregulating it in the precuneus. Functional connectivity (FC) between the VSi and precuneus decreased. Positive correlations were found between the HAM-D remission rate and changes in brain activity in the VSi. Conclusion: taVNS reduced the FC between VSi and precuneus by normalizing the abnormal spontaneous brain activity of VSi in first-episode MDD patients.
RESUMO
Small interfering RNA (siRNA) is the initiator of RNA interference and inhibits gene expression by targeted degradation of specific messenger RNA. siRNA-mediated gene regulation has high efficiency and specificity and exhibits great significance in the treatment of diseases. However, the naked or unmodified siRNA has poor stability, easy to degrade by nuclease, short half-life, and low intracellular delivery. As an emerging non-viral nucleic acid delivery system, ionizable lipid nanoparticles play an important role in improving the druggability of siRNA. At present, one siRNA drug based on ionizable lipid nanoparticles has been approved for the treatment of rare disease. This review introduces the research progress in ionizable lipid nanoparticles for siRNA delivery, focusing on the effect of each component of lipid nanoparticles on the efficiency of siRNA-mediated gene silencing, which provides new references for the studies on ionizable lipid nanocarriers for siRNA delivery.
RESUMO
ObjectiveTo explore the correlation of index of standing balance tester to score of Berg Balance Scale (BBS) and Fugl-Meyer Assment-Lower Extremites (FMA-LE) in stroke patients with hemiplegia, and analyze the predictive effect to BBS. MethodsFrom March to October, 2022, 66 stroke hemiplegic patients in the Affiliated Hospital of Shandong University of Traditional Chinese Medicine were selected. The elliptical area and length of motion were measured with a balance tester when they were standing with eyes open or closed, respectively. They were also evaluated with BBS and FMA-LE. The correlation between the test results and the scores of BBS and FMA-LE was analyzed with Pearson's correlation analysis, and the predictive effect of the test results to the score of BBS was also analyzed with receiver operating characteristic (ROC) curve. ResultsHypertension, diabetes, coronary heart disease, smoking and alcohol drinking were not significant for the scores of BBS and FMA-LE (|t| < 1.124, P > 0.05). In the balance test, the eye opening movement ellipse area, eye opening movement length, eye closing movement ellipse area and eye closing movement length were negatively correlated with the scores of BBS and FMA-LE (|r| > 0.250, P < 0.05). The area under the ROC curve of eye opening movement ellipse area to the score of BBS was 0.685 (P = 0.019), and the area under the ROC curve of the eye opening movement length to the score of BBS was 0.764 (P < 0.001). ConclusionThe open eye movement ellipse area, open eye movement length, closed eye movement ellipse area and closed eye movement length are significantly negatively correlated with the scores of BBS and FMA-UE. The indexes of the balance test with eyes open may predict the score of BBS.
RESUMO
ObjectiveTo explore the effect of intervention based on theory of planned behavior on muscle attenuation and balance of the elderly with sarcopenia. MethodsFrom September, 2022 to February, 2023, 124 elderly people with sarcopenia were conveniently sampled from Lishuiwan Community and Shuxiangyuan Community in Shijiazhuang City, Hebei Province. According to the coin toss, 62 elderly people from Shuxiangyuan Community were designated as control group, and 62 elderly people from Lishuiwan Community were as intervention group. The intervention group implemented the intervention based on the theory of planned behavior, including behavior attitude, behavior, subjective norms, perceived behavior control and behavior awareness; the control group maintained their original lifestyle, for twelve weeks. Before and after intervention, the grip strength, time of Five-Times-Sit-to-Stand Test, relative appendicular skeletal muscle index (RASM), 6-minute walking speed and the score of Berg Balance Scale (BBS) were compared. ResultsAfter intervention, the grip strength, RASM, 6-minute walking speed, and the score of BBS significantly increased, and the time of Five-Times-Sit-to-Stand Test shortened in the intervention group (|Z| > 6.257, |t| > 28.643, P < 0.001), and they were better in the intervention group than in the control group (|Z| > 2.288, |t| > 3.177, P < 0.05). ConclusionThe intervention based on theory of planned behavior can effectively relieve the muscle attenuation of the elderly with sarcopenia, and improve their balance ability.
RESUMO
ObjectiveTo investigate the relationship among spontaneous turning direction, balance ability and fall risk in patients with stroke during walking. MethodsFrom December, 2021 to November, 2022, 94 patients with stroke were recruited from Beijing Bo'ai Hospital. They were assessed with simple Timed 'Up and Go' Test (TUGT, TUGT1), TUGT with a cup in hand (TUGT2), and TUGT with calculation task (TUGT3). The spontaneous turning directions at the turn point were recorded, and the patients were divided into no-same group (n = 34) and same group, and the same group was further divided into affected group (n = 33) and unaffected group (n = 27), according to the spontaneous turning direction. After a spontaneous turning of each TUGT, the patients were asked to finish another TUGT turning to the opposite direction. And then, they were assessed with single leg standing test, Functional Reach Test (FRT), 360° turning test and the Morse Fall Scale (MFS). ResultsThere were the most patients with left hemiplegia in the affected group (χ2 = 7.995, P < 0.05). The time of TUGT1, TUGT2 and TUGT3 was the most in the affected group and the least in the unaffected group (F > 4.009, P < 0.05), and it was more in the affected group than in the unaffected group as post-hoc test (P < 0.05). The one leg standing time (H = 9.403, P = 0.009) and FRT distance (F = 4.300, P = 0.016) were the least in the affected group and the most in the unaffected group, and it was less in the affected group than in the unaffected group as post-hoc test (P < 0.05). The turning time (F = 4.134, P = 0.019) and turning steps (F = 5.611, P = 0.003) were the most in the affected group and the least in the unaffected group, and it was more in the affected group than in the unaffected group as post-hoc test (P < 0.05). The score of MFS was the most in the affected group and the least in the unaffected group (H = 8.192, P = 0.017), and it was more in the affected group than in the unaffected group as post-hoc test (P < 0.05). ConclusionThe stroke patients spontaneously turning to the affected side during walking usually are poorer in balance function, and in a risk of fall.
RESUMO
BackgroundThe diagnosis of Alzheimer's disease (AD) still faces great challenges, and the advantage of electroencephalogram (EEG) diagnosis lies in its portable and non-invasive nature, so the EEG diagnosis of AD has occupied an important place in clinical research. ObjectiveTo evaluate the value of resting state EEG for AD diagnosis, and to provide references for early recognition of AD in clinical practice. MethodsClinical data of AD patients (n=59) in an Inpatient Geriatric Psychiatry Unit of Shenzhen Kangning Hospital from May 2019 to May 2022 were retrospectively analyzed, and healthy elderly individuals attending outpatient clinics at the hospital during the same period were enrolled as control group (n=54). Eight-channel resting state EEG data were acquired, and the absolute power values in the α, β, θ and δ frequency bands and the α/θ ratio were obtained and calculated using Fast Fourier Transform (FFT). Cognitive function assessments of patients were done by Mini-Mental State Examination (MMSE) and Montreal Cognitive Assessment (MoCA). Spearman correlation analysis was used to examine the correlation between EEG findings and MMSE and MoCA scores of AD patienrs. Logistic regression prediction model for AD was built using currently available EEG and clinical variables, and the model performance was assessed using the receiver operating characteristic (ROC) curve and the area under curve (AUC). ResultsThe θ-band absolute powers in the right mid-frontal (F4) and mid-lateral (F7, F8) regions were higher in AD patients than those in healthy controls, with statistically significant difference (t=-2.844, -2.825, -3.014, P<0.05 or 0.01). The absolute powers of α/θ ratio in prefrontal (Fp1, Fp2), mid-frontal (F3, F4) and mid-lateral (F7, F8) regions showed a notable reduction in AD patients compared with healthy controls, with statistical difference (t=2.081, 2.327, 3.423, 2.358, 3.272, 2.445, P<0.05 or 0.01). Spearman correlation analysis denoted that MMSE score was positively correlated with the absolute powers of α-band, β-band and α/θ ratio (r=0.206, 0.288, 0.372, P<0.05 or 0.01). MoCA score was positively correlated with β absolute powers and α/θ ratio (r=0.201, 0.315, P<0.05 or 0.01), and negatively correlated with θ absolute power (r=-0.218, P<0.05). ROC curve revealed an AUC of 0.882 (95% CI: 0.820~0.943), a sensitivity of 0.966 and a specificity of 0.673 for the AD prediction model based on EEG variables, while the prediction model for AD using comprehensive variables achieved better predictive efficacy, reaching an AUC, sensitivity and specificity of 0.946 (95% CI: 0.905~0.986), 0.948 and 0.873, respectively. ConclusionResting state EEG of AD patients is correlated with cognitive function, and are of great value in the diagnosis of AD, with θ absolute power and α/θ ratio in EEG being the most strongly correlated with AD.
RESUMO
Objective: This cross-sectional investigation aimed to determine the incidence, clinical characteristics, prognosis, and related risk factors of olfactory and gustatory dysfunctions related to infection with the SARS-CoV-2 Omicron strain in mainland China. Methods: Data of patients with SARS-CoV-2 from December 28, 2022, to February 21, 2023, were collected through online and offline questionnaires from 45 tertiary hospitals and one center for disease control and prevention in mainland China. The questionnaire included demographic information, previous health history, smoking and alcohol drinking, SARS-CoV-2 vaccination, olfactory and gustatory function before and after infection, other symptoms after infection, as well as the duration and improvement of olfactory and gustatory dysfunction. The self-reported olfactory and gustatory functions of patients were evaluated using the Olfactory VAS scale and Gustatory VAS scale. Results: A total of 35 566 valid questionnaires were obtained, revealing a high incidence of olfactory and taste dysfunctions related to infection with the SARS-CoV-2 Omicron strain (67.75%). Females(χ2=367.013, P<0.001) and young people(χ2=120.210, P<0.001) were more likely to develop these dysfunctions. Gender(OR=1.564, 95%CI: 1.487-1.645), SARS-CoV-2 vaccination status (OR=1.334, 95%CI: 1.164-1.530), oral health status (OR=0.881, 95%CI: 0.839-0.926), smoking history (OR=1.152, 95%CI=1.080-1.229), and drinking history (OR=0.854, 95%CI: 0.785-0.928) were correlated with the occurrence of olfactory and taste dysfunctions related to SARS-CoV-2(above P<0.001). 44.62% (4 391/9 840) of the patients who had not recovered their sense of smell and taste also suffered from nasal congestion, runny nose, and 32.62% (3 210/9 840) suffered from dry mouth and sore throat. The improvement of olfactory and taste functions was correlated with the persistence of accompanying symptoms(χ2=10.873, P=0.001). The average score of olfactory and taste VAS scale was 8.41 and 8.51 respectively before SARS-CoV-2 infection, but decreased to3.69 and 4.29 respectively after SARS-CoV-2 infection, and recovered to 5.83and 6.55 respectively at the time of the survey. The median duration of olfactory and gustatory dysfunctions was 15 days and 12 days, respectively, with 0.5% (121/24 096) of patients experiencing these dysfunctions for more than 28 days. The overall self-reported improvement rate of smell and taste dysfunctions was 59.16% (14 256/24 096). Gender(OR=0.893, 95%CI: 0.839-0.951), SARS-CoV-2 vaccination status (OR=1.334, 95%CI: 1.164-1.530), history of head and facial trauma(OR=1.180, 95%CI: 1.036-1.344, P=0.013), nose (OR=1.104, 95%CI: 1.042-1.171, P=0.001) and oral (OR=1.162, 95%CI: 1.096-1.233) health status, smoking history(OR=0.765, 95%CI: 0.709-0.825), and the persistence of accompanying symptoms (OR=0.359, 95%CI: 0.332-0.388) were correlated with the recovery of olfactory and taste dysfunctions related to SARS-CoV-2 (above P<0.001 except for the indicated values). Conclusion: The incidence of olfactory and taste dysfunctions related to infection with the SARS-CoV-2 Omicron strain is high in mainland China, with females and young people more likely to develop these dysfunctions. Active and effective intervention measures may be required for cases that persist for a long time. The recovery of olfactory and taste functions is influenced by several factors, including gender, SARS-CoV-2 vaccination status, history of head and facial trauma, nasal and oral health status, smoking history, and persistence of accompanying symptoms.
Assuntos
Feminino , Humanos , Adolescente , SARS-CoV-2 , Olfato , COVID-19/complicações , Estudos Transversais , Vacinas contra COVID-19 , Incidência , Transtornos do Olfato/etiologia , Distúrbios do Paladar/etiologia , PrognósticoRESUMO
To study of premature/early death of autistic patients from the perspective of life course can help families, medical institutions and policy makers better deal with the adverse effects of autism. Several studies have shown that autistic patients have a high risk of death, however, the results are still inconsistent. To assess the risk of mortality among the autistic patients, we undertook a comprehensive search of MEDLINE, Web of Science and EMBASE databases. This paper reviewed the studies on the negative disease outcomes of autism spectrum disorders, including the risk of death, causes of death and several research hotspots in this field. Strict inclusion/exclusion criteria were used. Information was extracted from selected papers, tabulated and synthesized. In the study, 15 studies were included, with a total of 216 045 individuals. The main outcome was all-cause mortality in association with autism and the secondary outcome was cause-specific mortality. The results showed that all-cause mortality was higher for the autistic patients (RR=2.32, 95%CI: 1.98-2.72, I2=87.1%, P < 0.001). Risk ratio showed a greater inequality for female than male (male: RR=2.00, 95%CI: 1.57-2.55, I2=93.2%, P < 0.001; female: RR=4.66, 95%CI: 3.30-6.58, I2=92.0%, P < 0.001). Compared with the unnatural death, the risk of natural death was higher (RR=3.44, 95%CI: 1.27-9.26, I2=80.2%, P=0.025). As autism had many comorbidities, which would bring more health risks and natural deaths possibilities. There were some structural differences in unnatural death. Accidental injury death and suicide were two kinds of causes. Lacking social skills would weaken the ability to ask for help when encountering injuries. This paper put forward some suggestions for futures. First, to well study the comorbidity can reduce the risk of death from a medical point of view. Second, the scientists and policymakers should pay attention to the social environment and provide a safer environment for the autistic patients. Third, for women and for adolescents without cognitive impairment, due to their high risk of suicide, the society should provide them with more supportive social networks and improve their life satisfaction. Fourth, it is necessary to balance the rehabilitation resources in various regions in China and provide more high-quality lifelong rehabilitation monitoring and care services.
Assuntos
Adolescente , Humanos , Masculino , Feminino , Transtorno do Espectro Autista , Causas de Morte , Comorbidade , Transtorno Autístico , ChinaRESUMO
Interleukin 6 (IL-6), an important component of cardiac microenvironment, favors cardiac repair by improving cardiomyocyte regeneration in different models. This study aimed to investigate the effects of IL-6 on stemness maintenances and cardiac differentiation of mouse embryonic stem cells (mESCs). The mESCs were treated with IL-6 for two days, and then subjected to CCK-8 essay for proliferation analysis and quantitative real-time PCR (qPCR) to evaluate the mRNA expression of genes related to stemness and germinal layers differentiation. Phosphorylation levels of stem cell-related signal pathways were detected by Western blot. siRNA was used to interfere the function of STAT3 phosphorylation. Cardiac differentiation was investigated by the percentage of beating embryoid bodies (EBs) and qPCR analysis of cardiac progenitor markers and cardiac ion channels. IL-6 neutralization antibody was applied to block the endogenous IL-6 effects since the onset of cardiac differentiation (embryonic day of 0, EB0). The EBs were collected on EB7, EB10 and EB15 to investigate the cardiac differentiation by qPCR. On EB15, Western blot was applied to investigate the phosphorylation of several signaling pathways, and immunochemistry staining was adopted to trace the cardiomyocytes. IL-6 antibody was administered for two days (short term) on EB4, EB7, EB10 or EB15, and percentages of beating EBs at late developmental stage were recorded. The results showed that exogenous IL-6 promoted mESCs proliferation and favored maintenances of pluripotency, evidenced by up-regulated mRNA expression of oncogenes (c-fos, c-jun) and stemness markers (oct4, nanog), down-regulated mRNA expression of germ layer genes (branchyury, FLK-1, pecam, ncam, sox17), and increased phosphorylation of ERK1/2 and STAT3. siRNA targeting JAK/STAT3 partially attenuated the effects of IL-6 on cell proliferation and mRNA expression of c-fos and c-jun. During differentiation, long term IL-6 neutralization antibody application decreased the percentage of beating EBs, down-regulated mRNA expression of ISL1, GATA4, α-MHC, cTnT, kir2.1, cav1.2, and declined the fluorescence intensity of cardiac α actinin in EBs and single cell. Long term IL-6 antibody treatment decreased the phosphorylation of STAT3. In addition, short term (2 d) IL-6 antibody treatment starting from EB4 significantly reduced the percentage of beating EBs in late development stage, while short term IL-6 antibody treatment starting from EB10 significantly increased the percentage of beating EBs on EB16. These results suggest that exogenous IL-6 promotes mESCs proliferation and favors stemness maintenance. Endogenous IL-6 regulates mESC cardiac differentiation in a development-dependent manner. These findings provide important basis for the study of microenvironment on cell replacement therapy, as well as a new perspective for understanding the pathophysiology of heart diseases.
Assuntos
Animais , Camundongos , Interleucina-6 , Células-Tronco Embrionárias Murinas , Diferenciação Celular , Proteínas Proto-Oncogênicas c-fos , RNA MensageiroRESUMO
Focusing on the phenomenon of "de-acupoints" of the needle insertion sites in Fu's subcutaneous needling (FSN), the authors allocated the evolution and characteristics of the needle insertion sites of FSN. From six aspects, named morphology and structure, location, nomenclature, numbers and meridian tropism, indications and acupuncture manipulations, the comparison was made between the insertion sites of FSN and traditional acupoints. It is believed: ①The needle insertion sites of FSN has the basic attributes of acupoint, which not only refers to the operation site, but also indicates the reaction of disease; moreover, it is the treatment site with significant therapeutic effect. ②The optimized sites of insertion in FSN should be named differently and their locations and numbers should be specified relatively. ③The insertion sites of FSN should be further intersected and integrated with traditional acupoints, and a part of traditional acupoints should become the insertion sites of FSN. ④Accepting and integrating the insertion sites of FSN, and expanding the scope of traditional acupoints may be the new project in the research of traditional acupoints.
Assuntos
Moxibustão , Pontos de Acupuntura , Terapia por Acupuntura , Acupuntura , MeridianosRESUMO
Childhood obesity is a global public health problem, which can not only endangers children's health, but also might be an important cause of chronic diseases in adulthood. In recent years, with the in-depth development of precision medicine research, more and more research evidences have shown that there are interactions between environmental factors, such as early intrauterine environment, children's diet, physical activity and children's gene factor on the incidence of childhood obesity, which can result in or inhibit the incidence and development of childhood obesity. This paper summarizes the progress in research in this field to reveal the effects and potential mechanisms of genetic factors and environmental factors on the incidence of childhood obesity in order to provide reference for the precise prevention and control of childhood obesity under different genetic backgrounds.
Assuntos
Criança , Humanos , Obesidade Infantil/genética , Dieta , Causalidade , Exercício Físico , Saúde PúblicaRESUMO
OBJECTIVES@#To summarize the clinical phenotype and genetic characteristics of children with autosomal dominant mental retardation type 5 caused by SYNGAP1 gene mutations.@*METHODS@#A retrospective analysis was performed on the medical data of 8 children with autosomal dominant mental retardation type 5 caused by SYNGAP1 gene mutations who were diagnosed and treated in the Department of Pediatrics, Xiangya Hospital of Central South University.@*RESULTS@#The mean age of onset was 9 months for the 8 children. All children had moderate-to-severe developmental delay (especially delayed language development), among whom 7 children also had seizures. Among these 8 children, 7 had novel heterozygous mutations (3 with frameshift mutations, 2 with nonsense mutations, and 2 with missense mutations) and 1 had 6p21.3 microdeletion. According to the literature review, there were 48 Chinese children with mental retardation caused by SYNGAP1 gene mutations (including the children in this study), among whom 40 had seizures, and the mean age of onset of seizures was 31.4 months. Frameshift mutations (15/48, 31%) and nonsense mutations (19/48, 40%) were relatively common in these children. In terms of treatment, among the 33 children with a history of epileptic medication, 28 (28/33, 85%) showed response to valproic acid antiepileptic treatment and 16 (16/33, 48%) achieved complete seizure control after valproic acid monotherapy or combined therapy.@*CONCLUSIONS@#Children with autosomal dominant mental retardation type 5 caused by SYNGAP1 gene mutations tend to have an early age of onset, and most of them are accompanied by seizures. These children mainly have frameshift and nonsense mutations. Valproic acid is effective for the treatment of seizures in most children.
Assuntos
Criança , Humanos , Deficiência Intelectual/diagnóstico , Códon sem Sentido , Estudos Retrospectivos , Ácido Valproico , Proteínas Ativadoras de ras GTPase/genética , Mutação , Convulsões/genéticaRESUMO
Rejection and adverse reactions caused by long-term use of immunosuppressants severely affect the survival rate and quality of life of organ transplant recipients. Immune tolerance induction plays a key role in improving the survival rate and quality of life of organ transplant recipients. In recent years, tremendous progress has been achieved in adoptive re-transfusion of regulatory cells. In this article, research progress in regulatory T cell (Treg), myeloid-derived suppressor cell (MDSC) and regulatory B cell (Breg) in animal experiment and clinical application was reviewed, and the main clinical problems of adoptive re-transfusion of regulatory cells, the application of chimeric antigen receptor Treg and the concept of cell therapy in immune evaluation were summarized, aiming to deepen the understanding of regulatory cell therapy, promote the application of regulatory cells in immune tolerance of organ transplantation, and improve clinical efficacy of organ transplantation and the quality of life of recipients.
RESUMO
Objective:To investigate the prognosis of childhood adrenoleukodystrophy (ALD) with cognitive disorder after haploidentical allogenic hematopoietic stem cell transplantation (haplo-HSCT), and to identify risk factors affecting the prognosis.Methods:It was a single-center retrospective study involving 31 ALD children receiving haplo-HSCT in Peking University People′s Hospital from January 2014 to October 2022.Survival analysis was performed by Kaplan-Meier method. Cox regression analysis was performed to identify risk factors for the prognosis of childhood ALD following haplo-HSCT. Results:Among the 31 children with ALD, 1 case died of cardiogenic shock during the transplantation, and the remaining had a successful haplo-HSCT.Ten children with ALD had cognitive disorder before haplo-HSCT, including 3 cases with the minimal LOES score ≥10 points and 8 cases with the Neurologic Function Score (NFS)>0 point before haplo-HSCT.Six children had major functional disability (MFD) and 2 cases died due to progression of ALD after haplo-HSCT.Twenty children did not have cognitive disorder before haplo-HSCT, of whom 3 cases had the LOES score≥10 points and 6 cases had NFS>0 before haplo-HSCT.Four children had MFD and 2 cases died due to progression of ALD after haplo-HSCT.For ALD patients without cognitive disorder after haplo-HSCT, the 3-year and 5-year survival rate were 100.0% and 72.9%, respectively, and the 5-year MFD-free survival was 61.6%.For ALD patients with cognitive disorder after haplo-HSCT, the 3-year survival rate was 83.3%.Compared with ALD patients with the LOES score<10 points before haplo-HSCT, those with the LOES score≥10 points had 9.243 times the risk of developing MFD after haplo-HSCT ( P=0.024, 95% CI: 1.332-64.127). Compared with ALD patients without cognitive disorder before haplo-HSCT, ALD patients with cognitive disorder had 9.749 times the risk of developing MFD after haplo-HSCT ( P=0.023, 95% CI: 1.358-66.148). Conclusions:Cognitive disorder and LOES score≥10 points before haplo-HSCT are risk factors for developing MFD in children with ALD following haplo-HSCT.
RESUMO
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
RESUMO
ObjectiveTo assess the value of apparent diffusion coefficient (ADC) in the treatment of uterine fibroid using magnetic resonance guided focused ultrasound surgery (MRgFUS). MethodsThe MRI and clinical data of 56 patients with uterine fibroid before, at 3 and 6 months after MRgFUS treatment, at Foshan Hospital of Traditional Chinese Medicine from December 2018 to October 2022, were retrospectively analyzed. The correlation between the ADC value and lesion volume, symptoms severity score (SSS) and uterine fibroid symptoms quality of life questionnaire (UFS-QOL) were analyzed. ANOVA was used to compare the differences in related parameters before and after treatment, and Pearson’s method was performed to analyze data correlation. ResultsThere were significant differences in ADC value [(1.11±0.13), (1.84±0.09), (2.12±0.24),×10-3/(mm2/s)], lesion volume (102±35.30, 56.70±18.88, 46.93±18.99,cm3), SSS (36.73±11.74, 21.77±10.21, 17.66±9.30) and UFS-QOL score (59.05±17.48, 76.54±16.50, 82.46±12.37) between before treatment and each time point after treatment (F value was 557.837, 73.589, 53.976 and 37.606, respectively, all P<0.05). The ADC values were negatively correlated with lesion volume and SSS, and positively correlated with UFS-QOL score, with correlation coefficients of -0.586, -0.630 and 0.592, respectively (all P<0.05). ConclusionThe ADC value has clinical significance for the treatment of uterine fibroid using MRgFUS.
RESUMO
Objective: To investigate the expression and significance of protease activated receptor 2 (PAR2) in ovarian epithelial carcinoma. Methods: PAR2 mRNA expression levels in 410 cases of epithelial ovarian carcinoma and 88 cases of human normal ovary were analyzed from cancer Genome Atlas (TCGA) database and tissue genotypic expression database (GTEx). Immunohistochemical (IHC) staining of PAR2 protein was performed in 149 patients with ovarian cancer who underwent primary surgical treatment at Cancer Hospital of Chinese Academy of Medical Sciences. Then the relationship between mRNA/protein expression of PAR2 and clinicopathological features and prognosis was analyzed. Gene functions and related signaling pathways involved in PAR2 were studied by enrichment analysis. Results: The mRNA expression of PAR2 in epithelial ovarian carcinoma was significantly higher than that in normal ovarian tissue (3.05±0.72 vs. 0.33±0.16, P=0.004). There were 77 cases showing positive and 19 showing strong positive of PAR2 IHC staining among the 149 patients, accounting for 64.4% in total. PAR2 mRNA/protein expression was closely correlated with tumor reduction effect and initial therapeutic effect (P<0.05). Survival analysis showed that the progression free survival time (P=0.033) and overall survival time (P=0.011) in the group with high PAR2 mRNA expression was significantly lower than that in the low PAR2 mRNA group. Multivariate analysis showed tumor reduction effect, initial therapeutic effect were independent prognostic factors on both progression-free survival and overall survival (P<0.05). The progression-free survival (P=0.016) and overall survival (P=0.038) of the PAR2 protein high expression group was significantly lower than that of the low group. Multivariate analysis showed PAR2 expression, initial treatment effect and chemotherapy resistance were independent prognostic factors on both progression-free survival and overall survival (P<0.05). Based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), PAR2 target genes were mainly enriched in function related to intercellular connection, accounting for 40%. Gene enrichment analysis (GSEA) showed that the Wnt/β-catenin signaling pathway (P=0.023), the MAPK signaling pathway (P=0.029) and glycolysis related pathway (P=0.018) were enriched in ovarian cancer patients with high PAR2 mRNA expression. Conclusions: PAR2 expression is closely related to tumor reduction effect, initial treatment effect and survival of ovarian cancer patients. PAR2 may be involved in Wnt/β-catenin signaling pathway and intercellular connection promoting ovarian cancer invasion and metastasis.