Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 13 de 13
Filtrar
Adicionar filtros








Intervalo de ano
1.
Journal of Experimental Hematology ; (6): 250-255, 2022.
Artigo em Chinês | WPRIM | ID: wpr-928702

RESUMO

OBJECTIVE@#To establish a based method flow cytometry to identify the antigen Jka in human red blood cells (RBCs) and verify its accuracy.@*METHODS@#A total of 96 blood samples were enrolled in the study randomly from the voluntary blood donors in Shenzhen Blood Center. The RBCs were incubated with IgG anti-Jka primary antibody, and then labeled with the secondary antibody anti-IgG-Alexa Fluor 647. The fluorescence histograms of each sample were obtained by flow cytometry. Serological agglutination test was used to compare the accuracy of flow cytometry in the detecting of antigen Jka, while PCR-SSP and gene sequencing genotyping were used to verify the accuracy of flow cytometry in the detecting of the antigen in human RBCs.@*RESULTS@#The results of flow cytometry for antigen Jka in human RBCs were consistent with those from serological tests. Samples that demonstrated higher serological agglutination intensity also showed higher fluorescence activity, which indicate more stronger of Jka antigen. The sensitivity of flow cytometry was higher than that of serological test; especially in distinguish Jka weak and negative samples. Flow cytometric results of all samples were consistent with the genotyping results, which confirmed the accuracy of flow cytometry.@*CONCLUSION@#The study established a new flow cytometry-based method successfully for the identification of Jka antigen of Kidd blood group in human RBCs. The Kidd blood group antigen Jka of different intensities can be accurately distinguished by the technique.


Assuntos
Humanos , Antígenos de Grupos Sanguíneos , Tipagem e Reações Cruzadas Sanguíneas , Eritrócitos , Citometria de Fluxo , Imunoglobulina G , Sistema do Grupo Sanguíneo Kidd
2.
Journal of Experimental Hematology ; (6): 300-306, 2020.
Artigo em Chinês | WPRIM | ID: wpr-781448

RESUMO

OBJECTIVE@#To study the single nucleotide polymorphisms (SNPs) in promoter region of the Jk gene and its allele frequency as well as distribution characteristics in the Chinese Han nationality population.@*METHODS@#127 blood samples containing 8 Jk(a-b-) and 119 samples (as control) taken randomly from voluntary blood donors of Chinese Han nationality persons in Shenzhen Blood Center were collected. The Kidd phenotypes were identified by using the serologic test and urea hemolysis test; the Jk promoter, exon 1-11 region and respective flanking area were amplified and sequenced, then the sequence information was analyzed.@*RESULTS@#8 Jk(a-b-) samples all carried JkB/JkB allele which belongs to 2 kind of Jk genotypes commonly observed in Chinese Han nationality population. 6 IVS5-1g>a and 2 896G>A were found in 8 Jk(a-b-) samples. Besides, all Jk(a-b-) samples were homozygous for JkB/JkB allele. Three SNPs-110(rs900974), -160(rs1484877) and -258(rs1484878) in promoter region of the Jk gene were found and sequenceds calculation of allele and genotype frequencies showed that the result accorded with Hardy-Weinberg equilibrium, indicating that the population in this study possesses representative characteristics of the Chinese Han nationality population.@*CONCLUSION@#The polymorphism of the Jk gene occurs in promoter region. This study calculates the allele frequencies of three SNPs-110(rs900974), -160(rs1484877) and -258(rs1484878) in promoter region of the Jk gene, and shows their distribution characteristics in distinct Kidd phenotypes. These findings provide the basic foundation for further population genetics research.

3.
Journal of Experimental Hematology ; (6): 231-234, 2017.
Artigo em Chinês | WPRIM | ID: wpr-311562

RESUMO

<p><b>OBJECTIVE</b>To establish a method for determination of glycosyltransferase and to explore the enzyme A, B glycosyltransferase activity in human serum so as to lay the foundation for the determination of enzyme level and enzyme activity.</p><p><b>METHODS</b>The glycosyltransferase activity kit was used to draw phosphate standard curves in our laboratory. The A and B glycosyltransferase activity were determined by the standard curves.</p><p><b>RESULTS</b>The standard curves (y=2671.3x-0.596 R=0.9998) for determing glycosyltransferase activity suitable for use in our laboratory were drawn. At the same time the method was set up for determination of A, B glycosyltransferase in human serum.</p><p><b>CONCLUSION</b>The establised method of the determination of glycosyltransferase is suitable for common type of enzyme activity and suitable for the A, B glycosyltransferase in human serum.</p>

4.
Journal of Experimental Hematology ; (6): 537-540, 2015.
Artigo em Chinês | WPRIM | ID: wpr-357320

RESUMO

<p><b>OBJECTIVE</b>To detect the base sequences of all exons and part of introns in the GYPA gene of the glycophorin GPA and to investigate the polymorphism of M, N alleles in Chinese population.</p><p><b>METHODS</b>A total of 225 blood sample were randomly colleeted from unrelated Chinese volunteers and were detected by serology techniques. The primers were designed by self, the seguencing of GYPA gene related with sample exon 1-7 full length sequences of bases and intron-1-7 partial sequence was performed, the polymorphism of M, N gene mutation in mucleotide sequence was analysed.</p><p><b>RESULTS</b>The results of M and N genotyping were in agreement with the results of serological detection. The 23rd base of intron-2, the 55th base of intron-3, the 63rd base of intron-4, the 55th, 189th and 190th base of intron-6, the 712th base variation of exon-7 in the gene M and N were used to subdivide the gene M and N into the mutant M103, M201, M202, N101, N102, N103, N104, and N201. At the same time, it was found that 42th and 54th base were mutated, the base T was inserted between 59th and 60th base in the intron-2, the new mutations occurred in the alleles 28, 29, 65 and 102 in intron-3 in this study.</p><p><b>CONCLUSION</b>The polymorphism of the the Chinese population's GYPA gene occurs in all the exons and partly in the introns. The gene polymorphism of M and N blood group in Chinese population might provide the theoretical basis for the studies of clinical blood transfusion, human population genetics and molecular biology.</p>


Assuntos
Humanos , Alelos , Povo Asiático , Antígenos de Grupos Sanguíneos , Tipagem e Reações Cruzadas Sanguíneas , Éxons , Genótipo , Glicoforinas , Íntrons , Polimorfismo Genético
5.
Chinese Journal of Medical Genetics ; (6): 258-262, 2009.
Artigo em Chinês | WPRIM | ID: wpr-287412

RESUMO

<p><b>OBJECTIVE</b>To establish a reliable assay for cloning and sequencing the full-length HLA-Cw gene.</p><p><b>METHODS</b>In this study, a fragment of 4.5 kb full-length HLA-Cw gene was amplified using the self-designed PCR primer pair by long template PCR, purified PCR products was cloned into the pGEM-Teasy plasmid vector and the plasmid DNA isolated from positive clones was subjected to haplotype sequencing by both directions. A total of 12 samples having been previously-genotyped by PCR sequence-based-typing (PCR-SBT) were amplified by using the TaKaRa LA Taq and Stratagene Pfu polymerase, respectively. PCR products of full length HLA-Cw gene were subjected to cloning and sequencing and the obtained haplotype sequence were compared with the PCR-SBT results.</p><p><b>RESULTS</b>The specific target fragment of HLA-Cw gene could be amplified and the full-length HLA-Cw allele sequence covering from nucleotide position -962 in 5'untranslated region (5'-UTR) to nucleotide position 3576 in downstream area of 3'-UTR region could be obtained using our method. The results of cloning and sequencing analysis indicated that the Stratagene Pfu polymerase had better fidelity than the TaKaRa LA Taq polymerase in this experiment. By comparing the sequences of Cw*07020101 with Cw*010201, 11 SNPs as well as 2 insertions/deletions in nt-962--284 of 5'-UTR, and 11 SNPs as well as 1 insertion/deletion in nt3067-3576 downstream of 3'-UTR were identified.</p><p><b>CONCLUSION</b>Our results indicate that the technique for cloning and sequencing full-length HLA-Cw gene has been established, it has a broad application in full-length HLA-Cw gene polymorphism study and the regulation and expression of HLA-Cw gene.</p>


Assuntos
Humanos , Alelos , Sequência de Aminoácidos , Sequência de Bases , China , Etnologia , Clonagem Molecular , Métodos , Primers do DNA , Antígenos HLA , Genética , Dados de Sequência Molecular , Reação em Cadeia da Polimerase , Alinhamento de Sequência , Análise de Sequência de DNA , Métodos
6.
Journal of Experimental Hematology ; (6): 691-693, 2008.
Artigo em Chinês | WPRIM | ID: wpr-267909

RESUMO

In order to study the polymorphism of Landsteiner-Wiener (LW) blood group gene in Chinese population, peripheral blood samples anticoagulated with EDTA from 160 unrelated volunteer blood donors were randomly collected, and genomic DNA were extracted. 160 DNA samples were analyzed for exon 1 of LW gene by direct DNA sequencing, and detected for LWa/LWb allele by improved PCR-SSP genotyping. The results showed that all LW allele in 160 donors were LWa homozygous, and the LWa allele occurred commonly. In conclusion, LWa allele occurs with incidence of 100% of donors in this study, while LWb allele has not been found in Chinese population.


Assuntos
Humanos , Alelos , Povo Asiático , Genética , Doadores de Sangue , Antígenos de Grupos Sanguíneos , Genética , Moléculas de Adesão Celular , Genética , Éxons , Genética , Homozigoto , Polimorfismo Genético , Análise de Sequência de DNA
7.
Journal of Experimental Hematology ; (6): 421-424, 2008.
Artigo em Chinês | WPRIM | ID: wpr-253306

RESUMO

In order to elucidate the expression and molecular genetic background of ABO gene seven samples with ABO discrepancy further identified as bi-specific ABO gene were studied. All these samples were subjected to phenotyping by monoclonal and polyclonal antisera and were then genotyped by direct DNA sequencing and haplotype-sequencing at the exon 6 and 7 of ABO gene. As a result, six ABO dual-specific alleles were identified in Chinese population. An antigen expressed by these B (A) or Cis-AB individuals varied from very low level to the normal level, compared with common A blood group samples. In conclusion, molecular genetic backgrounds of two pairs out of four samples in all samples were the same, however, the ABO expression showed diverse.


Assuntos
Humanos , Sistema ABO de Grupos Sanguíneos , Genética , Povo Asiático , Genética , Análise Mutacional de DNA , Eritrócitos , Biologia Celular , Metabolismo , Éxons , Genética , Glicosiltransferases , Química , Genética
8.
Journal of Forensic Medicine ; (6): 283-285, 2007.
Artigo em Chinês | WPRIM | ID: wpr-983299

RESUMO

OBJECTIVE@#To study the molecular genetic background of Diego blood group in Chinese Han population.@*METHODS@#A total of 2990 blood samples from unrelated blood donors were phenotyped for Dia and Dib by serological method. Twenty randomly selected samples of Di(a-b+) type and all of the samples of rare Di(a+b-) phenotype by screening were genotyped by PCR-SSP and direct DNA Sequencing.@*RESULTS@#Of the 2990 samples identified by serological method, 2821 were Di(a-b+), 167 were Di(a+b+) and 2 were Di(a+b-). All of the 20 randomly-selected samples with Di(a-b+) phenotype were DI2DI2 homozygote by PCR-SSP genotyping, with nucleotide C at nt position 2561 in exon 19 by direct sequencing of the DI gene. The 2 samples of rare Di (a+b-) phenotype were both the DI1DI1 homozygote, with nucleotide T at nt position 2561 in exon 19.@*CONCLUSION@#Our results indicate that the expression of Dia and Dib antigens in Chinese Han population most likely result from a single nucleotide T to C substitution at nucleotide position 2561 in exon 19 of the DI gene, which subsequently leads to an amino acid 854 change from Pro to Leu.


Assuntos
Humanos , Povo Asiático/genética , Sequência de Bases , Doadores de Sangue , Antígenos de Grupos Sanguíneos/metabolismo , Tipagem e Reações Cruzadas Sanguíneas/métodos , China/etnologia , Éxons/genética , Genótipo , Dados de Sequência Molecular , Fenótipo , Reação em Cadeia da Polimerase/métodos , Análise de Sequência de DNA
9.
Chinese Journal of Medical Genetics ; (6): 520-523, 2007.
Artigo em Chinês | WPRIM | ID: wpr-247278

RESUMO

<p><b>OBJECTIVE</b>Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.</p><p><b>METHODS</b>Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.</p><p><b>RESULTS</b>The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.</p><p><b>CONCLUSION</b>A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.</p>


Assuntos
Humanos , Alelos , Povo Asiático , Genética , Sequência de Bases , Etnicidade , Genética , Fucosiltransferases , Genética , Genótipo , Linhagem , Fenótipo , Reação em Cadeia da Polimerase , Análise de Sequência de DNA , Testes Sorológicos
10.
Journal of Experimental Hematology ; (6): 417-420, 2007.
Artigo em Chinês | WPRIM | ID: wpr-230255

RESUMO

In order to study the genetic status of a rare chimeric family, some samples of A(3)B(3) family were identified by sequencing of ABO gene; flow-rSSO and PCR-SSP were used to detect loci of HLA-A, B, DRB1 genes, and multiplex amplifying with fluorescence-dye were performed for 16 short tandem repeat (STR) loci. The results indicated that two individuals from A(3)B(3) family contained more than two alleles at ABO gene, HLA-B, DRB1 and some STR loci. In conclusion, analysis of chimeric blood group by using genotyping techniques clearly demonstrating genetic status of this rare chimeric blood group promotes further elucidation of the existing state of specific genetic status.


Assuntos
Adulto , Feminino , Humanos , Masculino , Sistema ABO de Grupos Sanguíneos , Genética , Alergia e Imunologia , Quimerismo , Genótipo , Antígenos HLA-A , Genética , Antígenos HLA-B , Genética , Antígenos HLA-DR , Genética , Cadeias HLA-DRB1 , Linhagem , Polimorfismo Genético , Sequências de Repetição em Tandem , Genética
11.
Chinese Journal of Medical Genetics ; (6): 652-655, 2007.
Artigo em Chinês | WPRIM | ID: wpr-229852

RESUMO

<p><b>OBJECTIVE</b>To study the distribution of ABO gene polymorphism in Uighur population in Xinjiang area of China.</p><p><b>METHODS</b>DNA was extracted from 160 Uygur unrelated donorso blood and PCR-sequence specific primer analysis was performed. Some difficult samples were further directly sequenced.</p><p><b>RESULTS</b>Six alleles were detected in a population of 160 Uighur individuals, the gene frequencies of which were 0.2062(A101), 0.0563(A102), 0.0156(A201), 0.0031(A205),0.1875(B01),0.5312(O01), respectively.</p><p><b>CONCLUSION</b>The characteristics for AB gene structure of Xinjiang Uighur suggests that genetic polymorphism is distinguished between Xinjiang Uighur nationality and Chinese Han nationality, and both of them have discrepancy and confluent characters.</p>


Assuntos
Feminino , Humanos , Masculino , Sistema ABO de Grupos Sanguíneos , Genética , Povo Asiático , Genética , Sequência de Bases , China , Etnologia , Etnicidade , Frequência do Gene , Predisposição Genética para Doença , Genótipo , Polimorfismo Genético
12.
Chinese Journal of Medical Genetics ; (6): 173-176, 2006.
Artigo em Chinês | WPRIM | ID: wpr-263826

RESUMO

<p><b>OBJECTIVE</b>To study the ABO allele molecular characteristics of Ael blood subgroup.</p><p><b>METHODS</b>Five individuals of diagnosed as Ael blood subgroup were subjected to PCR amplify ABO alleles using four pairs of sequence-specific primers. Exon 6 and exon 7 at ABO locus of all samples were sequenced. An individual with AelB phenotype was chosen for further analysis of transcript structure of ABO gene.</p><p><b>RESULTS</b>Sequence analysis indicated one Ael phenotype sample with reported Ael01 allele, one Ael phenotype sample with an Ael05 allele, and two AelB and one Ael individuals did not contain referred A allele, but contain O01 or O02 allele with 261G deletion.</p><p><b>CONCLUSION</b>Molecular bases for the Ael have highly polymorphism. The mechanism responsible for the express weak A antigen of O allele with 261G deletion awaits to be elucidated.</p>


Assuntos
Feminino , Humanos , Masculino , Sistema ABO de Grupos Sanguíneos , Genética , Alelos , Sequência de Bases , Clonagem Molecular , DNA , Dados de Sequência Molecular , Reação em Cadeia da Polimerase , Polimorfismo Genético
13.
Journal of Experimental Hematology ; (6): 135-139, 2005.
Artigo em Chinês | WPRIM | ID: wpr-347810

RESUMO

To study four A(3) subgroup samples identified by serologic tests, among which two belong to a family, three were A(3) subgroup, one was A(3)B subgroup. All four samples were genotyped by PCR-SSP method, and the nucleotide sequences of Exon 6, Exon 7 and part introns at the ABO locus for these samples were detected by ABI Prism 3100 DNA sequencer. Comparison with the consensus of A101 was performed. The results showed that haplotypes of two A(3) subgroups were common A102 allele and O1-2 allele, and haplotypes of one A(3) subgroup were common A102 allele and rare O(1v)-4 allele. Unexpectedly, a synonymous substitution 838C-->T had been found in A allele of the A(3)B subgroup sample, which predict a Leu280Phe alteration. The results suggested that molecular genetic background of the A(3) phenotypes is polymorphic. Possibly, the missense mutation 838C-->T is the molecular genetic basis of A(3)B subgroup that lead to low activity of the glycosyltransferases.


Assuntos
Humanos , Sistema ABO de Grupos Sanguíneos , Genética , Alelos , Povo Asiático , Genética , Sequência de Bases , China , Análise Mutacional de DNA , Éxons , Genótipo , Íntrons , Mutação , Fenótipo , Reação em Cadeia da Polimerase
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA