Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 2 de 2
Filtrar
Adicionar filtros








Intervalo de ano
1.
Chinese Journal of Medical Genetics ; (6): 170-173, 2021.
Artigo em Chinês | WPRIM | ID: wpr-879548

RESUMO

OBJECTIVE@#To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction.@*METHODS@#The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis.@*RESULTS@#The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic.@*CONCLUSION@#The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.


Assuntos
Criança , Feminino , Humanos , Erros Inatos do Metabolismo dos Carboidratos/genética , Coloboma , Microcefalia/genética , Mutação , Fenótipo , Fosfoglicerato Desidrogenase/genética , Transtornos Psicomotores/genética , Convulsões/genética , Sequenciamento do Exoma
2.
Chinese Journal of Medical Genetics ; (6): 42-46, 2021.
Artigo em Chinês | WPRIM | ID: wpr-879519

RESUMO

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.


Assuntos
Criança , Humanos , Síndrome CHARGE/genética , DNA Helicases/genética , Proteínas de Ligação a DNA/genética , Variação Genética , Mutação , Fenótipo
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA