Protective effect of sterubin against neurochemical and behavioral impairments in rotenone-induced Parkinson's disease

This study was conducted to evaluate how sterubin affects rotenone-induced Parkinson's disease (PD) in rats. A total of 24 rats were distributed into 4 equal groups: normal saline control and rotenone control were administered saline or rotenone (ROT), respectively, orally; sterubin 10 received ROT + sterubin 10 mg/kg po; and sterubin alone was administered to the test group (10 mg/kg). Rats of the normal saline and sterubin alone groups received sunflower oil injection (sc) daily, 1 h after receiving the treatments cited above, while rats of the other groups received rotenone injection (0.5 mg/kg, sc). The treatment was continued over the course of 28 days daily. On the 29th day, catalepsy and akinesia were assessed. The rats were then euthanized, and the brain was extracted for estimation of endogenous antioxidants (MDA: malondialdehyde, GSH: reduced glutathione, CAT: catalase, SOD: superoxide dismutase), nitrative (nitrite) stress markers, neuroinflammatory cytokines, and neurotransmitter levels and their metabolites (3,4-dihydroxyphenylacetic acid (DOPAC), dopamine (DA), norepinephrine (NE), serotonin (5-HT), 5-hydroxyindoleacetic acid (5-HIAA), and homovanillic acid (HVA)). Akinesia and catatonia caused by ROT reduced the levels of endogenous antioxidants (GSH, CAT, and SOD), elevated the MDA level, and altered the levels of nitrites, neurotransmitters, and their metabolites. Sterubin restored the neurobehavioral deficits, oxidative stress, and metabolites of altered neurotransmitters caused by ROT. Results demonstrated the anti-Parkinson's activities of sterubin in ROT-treated rats.

Porfiria cutánea tarda que simula esclerosis sistémica progresiva / Porphyria cutanea tarda mimicking progressive systemic sclerosis

Resumen Los síndromes esclerodermiformes suelen imitar muy bien una esclerosis sistémica progresiva, y es la presencia de ampollas cutáneas en áreas fotoexpuestas con hiperpigmentación los datos diferenciales para diagnosticar una porfiria. Presentamos el caso de un varón de 48 años con fotosensibilidad, fragilidad capilar, ampollas cutáneas e hiperpigmentación asociado a esclerodactilia, con pérdida cicatrizal distal de tejido en los dedos de las manos, que simuló a la perfección una esclerosis sistémica progresiva. La analítica mostró negatividad para anticuerpos antinucleares, antitopoisomerasa y anticentrómero, con valores altos de uroporfirinas en orina. El tratamiento con flebotomías e hidroxicloquina mejoró la fotosensibilidad y la fragilidad cutánea.

Abstract Sclerodermiform syndromes usually mimic progressive systemic sclerosis very well, with the presence of skin blisters in photo-exposed areas with hyperpigmentation being the differential data for diagnosing porphyria. We present the case of a 48-year old man with photosensitivity, capillary fragility, skin blisters, and hyperpigmentation associated with sclerodactyly with distal scar tissue loss on the fingers, which perfectly simulated progressive systemic sclerosis. The analysis showed negativity for antinuclear, antitopoisomerase and anticentromere antibodies, with high levels of uroporphyrins in urine. Phlebotomy and hydroxycloquine treatment improved photosensitivity and skin fragility.

Afasia primaria progresiva variante no fluente/agramática / Non-fluent/agrammatic variant of primary progressive aphasia

Introducción: Entre las enfermedades neurodegenerativas se encuentra un grupo de patologías que se caracterizan por un compromiso prominente del lenguaje, denominadas usualmente afasias primarias progresivas, las cuales se subdividen en 3 tipos: variante logopénica, variante semántica y variante no fluente o agramática. Presentación del caso: Paciente con cuadro clínico que inicia a los 65 años, con disminución en la interacción social. Un par de meses después, la esposa nota que el lenguaje del paciente se torna poco fluido, habla con palabras o frases cortas, no logra decir oraciones completas, además de presentar cambios en la entonación de las palabras y alteraciones del lenguaje escrito. El paciente manifiesta que su principal limitación en el momento es el no poder expresar lo que quiere decir, y por este motivo consulta. Discusión: En el caso de este paciente, se describe inicialmente un cambio en su personalidad que no compromete su funcionalidad, sin embargo, al poco tiempo se presenta compromiso del lenguaje como síntoma prominente y que genera mayor compromiso en su calidad de vida, con pruebas neuropsicológicas y hallazgos de neuroimagen que apoyan el diagnóstico de afasia primaria progresiva (APP) variante no fluente o agramatical, con síntomas comportamentales y motores asociados. Conclusión: Las APP son un grupo de trastornos neurocognitivos cuya característica primordial es el compromiso en el lenguaje, cada variante de APP tiene unas características clínicas y criterios diagnósticos específicos que se deben conocer para lograr sospechar el diagnóstico y hacer un abordaje apropiado en el paciente.

Introduction: In the group of neurodegenerative diseases, there is a group of pathologies that are characterized by a prominent compromise of language, normally called primary progressive aphasias, these are subdivided into 3 types: logopenic variant, semantic variant and non-fluent or agrammatic variant. Case presentation: Patient with a clinical picture that begins at age 65, with decreased social interaction, a couple of months later his wife notices that his language becomes not fluent, speaks in short words or phrases, cannot say complete sentences, in addition to changes in the intonation of words and alterations in written language, the patient states that his main limitation at the moment is not being able to express what he wants to say and for this reason they consult. Discussion: In the case of this patient, a change in his personality is initially described that does not compromise his functionality, however soon after a language involvement is presented as the main symptom and the one that generates a compromise in his quality of life, with neuropsychological tests and findings on neuroimaging that supports the diagnosis of primary progressive aphasia (PPA) non-fluent or agrammatical variant, with associated behavioral and motor symptoms. Conclusion: APPs are a group of neurocognitive disorders whose primary characteristic is language impairment. Each APP variant has specific clinical characteristics and diagnostic criteria that must be known in order to suspect the diagnosis and make an appropriate approach to the patient.

Prevention and management of childhood progressive myopia: National consensus guidelines

Myopia is a major public health problem worldwide, including India, with the global prevalence of myopia increasing rapidly over decades. The clinical and socioeconomic impact of myopia is also expected to rise with rising prevalence. Therefore, the focus has now been shifted to prevent the incidence and progression of myopia. However, there is lack of any standardized guidelines for myopia management. This document aims to generate a national-level expert consensus statement on the management of childhood myopia in the Indian scenario. The expert panel of pediatric ophthalmologists consisted of 63 members who met in a hybrid meeting. A list of topics deliberating discussion in the meeting was provided to the experts in advance and they were instructed to provide their opinions on the matter during the meet. The panel of experts then gave their views on each of the items presented, deliberated on different aspects of childhood myopia, and reached a consensus regarding the practice patterns in the Indian scenario. In case of opposing views or lack of a clear consensus, we undertook further discussion and evaluated literature to help arrive at a consensus. A written document is prepared based on recommendations explaining definition of myopia, refraction techniques, components and methods of workup, initiation of anti-myopia treatment, type and timing of interventions, follow-up schedule, and indications for revised or combination treatment. This article formulates evidence-based guidelines for progressing myopes and pre-myopes and also establishes uniformity in the management of childhood myopia in the country.

Partial-thickness compression sutures without descemetopexy for management of acute hydrops in keratoconus: A novel surgical technique

This article reports a novel surgical technique of partial-thickness compression sutures without descemetopexy with air or gas for the management of acute hydrops in keratoconus. Two patients presented with localized corneal edema with a Descemet membrane (DM) tear in the left eye. Tomography of the right eye revealed localized steepening with increased maximum keratometry and decreased central pachymetry. They were diagnosed with keratoconus in the right eye and acute corneal hydrops (ACH) in the left eye. Compression sutures were passed through the stroma without touching the DM. The anterior chamber was not entered at all at any point during the surgery. Resolution of edema was noted intraoperatively itself. Further resolution of edema was noted from the first postoperative day which markedly reduced within the first week. A corneal scar with no edema was seen at six weeks. In both the patients, vision at presentation was counting fingers close to face which improved to 20/60 and 20/50, respectively, at the last visit.

Testicular and epididymal dysfunctions: searching a new index for the differential diagnosis / Disfunciones testiculares y epididimarias: búsqueda de un nuevo índice para el diagnóstico diferencial

Objective: This proof-of-principle aims to develop an index to aid the differential diagnosis of disorders affecting testicular and/or epididymis. A total of 202 subject data were evaluated in two groups: fertile men with children naturally conceived within 1 year of unprotected intercourse (n = 36) and infertile men (n = 166) who had attempted a pregnancy more than 1 year with unprotected intercourse. Materials and methods: Semen parameters (sperm count, vitality, motility, morphology, and hypoosmotic swelling test [HOST]) were evaluated. The index was calculated by dividing the percentage HOST by the percentage of sperm progressive motility in the fertile group (n = 36). Results: A normal range from 1.23 to 1.53 was determined. Using this index, the outcomes of semen analysis from infertile men were grouped in three study groups: below 1.23 (n = 24), normal (n = 44), and higher than 1.53 (n = 98). These parameters were significantly decreased in semen with normal range (p < 0.01) and in indexes higher than 1.53 (p < 0.0001). Receiver operating characteristic curves compared progressive motility and morphology in infertile men with indexes higher than 1.53 shows that semen samples with normal sperm progressive motility and morphology did not suggest dysfunctions in testis and epididymis. Semen samples with asthenozoospermia suggested epididymal dysfunction (area under the curve [AUC] 0.889, confidence interval [CI] 0.783-1), whereas semen samples with teratoasthenozoospermia suggested dysfunction in both testicles and epididymis (AUC 0.891, CI 0.77-1). Conclusions: The current index proof-of-principle of the success of such a strategy provides valuable information about whether a disorder individually affects testicular and/or epididymal function.

Objetivo: Esta prueba de principio tiene como objetivo desarrollar un índice que ayude al diagnóstico diferencial de los trastornos testiculares y/o epidídimales. Métodos: Se evaluaron 202 individuos divididos en dos grupos: hombres fértiles con hijos concebidos de forma natural en el plazo no mayor a un año (n = 36) y hombres infértiles (n = 166), los cuales habían intentado un embarazo por más de un año. Se evaluaron los parámetros seminales (concentración, viabilidad, movilidad, morfología y prueba de hinchazón hipoosmótica [HOST]). El índice se calculó dividiendo el porcentaje de HOST por el porcentaje de movilidad espermática progresiva en el grupo fértil (n = 36). Resultados: Se determinó un rango normal de 1,23 a 1,53. Utilizando este índice, los resultados del análisis del semen de los hombres infértiles se agruparon en tres grupos de estudio: por debajo de 1,23 (n = 24), normal (n = 44) y superior a 1,53 (n = 98). En contraste, estos parámetros disminuyeron significativamente en el semen de rango normal (p < 0,01) y en los índices superiores a 1,53 (p < 0,0001). Las curvas ROC comparadas con la movilidad espermática progresiva y la morfología en los hombres infértiles con índices superiores a 1,53 muestran que las muestras de semen con movilidad progresiva y morfología normales no sugieren disfunciones en los testículos y epidídimos. Las muestras de semen con astenozoospermia sugerirían una disfunción del epidídimo (AUC 0,889, IC 0,783-1), mientras que las muestra de semen que presentaban teratoastenozoospermia sugerirían una disfunción tanto en los testículos como en el epidídimo (AUC 0,891, IC 0,77-1).

Acquired immunodeficiency syndrome-related progressive multifocal leukoencephalopathy-immune reconstitution inflammatory syndrome: prevalence, main characteristics, and outcomes in a Brazilian center / Síndrome inflamatória de reconstituição imune da leucoencefalopatia multifocal progressiva associada à síndrome da imunodeficiência adquirida: prevalência, principais características e desfecho em um hospital brasileiro

Abstract Background Progressive multifocal leukoencephalopathy (PML) - immune reconstitution inflammatory syndrome (IRIS) in people living with HIV/AIDS (PLWHA) has been rarely described in low- and middle-income countries. Objective To describe the prevalence of PML-IRIS among PLWHA with PML and its main features in a tertiary hospital in Brazil. Methods We performed a retrospective cohort study. We included PLWHA with PML-IRIS patients admitted at Instituto de Infectologia Emílio Ribas, São Paulo, Brazil, between 2011 and 2021. We retrieved information on neurological manifestations, neuroimaging findings, treatments, and outcomes. Results We identified 11 (11.8%) PML-IRIS cases among 93 patients with definite PML. Eight (73%) cases were men and had a median (IQR) age of 41 (27-50) years. Seven (63.6%) patients developed unmasking PML-IRIS and 4 (36.4%) had paradoxical PML-IRIS. The median (IQR) time from initiation of combined antiretroviral therapy (cART) to IRIS diagnosis was 49 (30-70) days. Ten (90.9%) patients received corticosteroids. There were 4 (36%) in-hospital deaths and 3 were associated with hospital-acquired pneumonia. Among the 7 (64%) patients who survived, 5 (71.5%) had sequelae at discharge. One year after the PML-IRIS diagnosis, 6 (54.5%) patients were alive. Conclusion The prevalence of PML-IRIS was 11.8%. Most patients had unmasking PML-IRIS. In-hospital mortality and morbidity were high. One-year survival was similar to that described in some high-income countries.

Resumo Antecedentes A síndrome inflamatória de reconstituição imune (SIRI) da leucoencefalopatia multifocal progressiva (LEMP) em pessoas vivendo com HIV/Aids (PVHA) foi raramente descrita em países de baixa e média renda. Objetivo Descrever a prevalência da SIRI-LEMP- em PVHA com LEMP e suas principais características em um hospital no Brasil. Métodos Foi realizado um estudo de coorte retrospectivo. Incluímos PVHA com SIRI-LEMP admitidos no Instituto de Infectologia Emílio Ribas, São Paulo, Brasil, entre 2011 e 2021. Recuperamos informações sobre manifestações neurológicas, neuroimagem, tratamento e desfecho. Resultados Identificamos 11 (11,8%) casos de SIRI-LEMP entre 93 pacientes com LEMP definitiva. Oito (73%) casos eram homens e a mediana de idade (amplitude interquartile - AIQ) foi de 41 (27-50) anos. Sete (63,6%) pacientes desenvolveram SIRI-LEMP "desmascarada" e 4 (36,4%) casos apresentaram SIRI-LEMP "paradoxal". A mediana de tempo (AIQ) desde o início da terapia antirretroviral combinada (cART) até o diagnóstico de SIRI foi de 49 (30-70) dias. Dez (90,9%) pacientes receberam corticoide. Houve 4 (36%) óbitos intra-hospitalares e 3 foram associados à pneumonia hospitalar. Dos 7 (64%) pacientes que sobreviveram, 5 (71,5%) ficaram com sequelas na alta. Um ano após o diagnóstico de SIRI-LEMP, 6 (54,5%) pacientes estavam vivos. Conclusão A prevalência de SIRI-LEMP foi de 11,8%. A maioria dos pacientes apresentava SIRI-LEMP "desmascarada". A mortalidade e morbidade hospitalar foram altas. A sobrevida em 1 ano foi semelhante à descrita em alguns países de alta renda.

Spongiform leukoencephalopathy unveiled in an autopsy of a drug abuser

ABSTRACT Toxic leukoencephalopathy (TLE) is a rare neurological debilitating and fatal condition. It has been previously associated with exposure to leukotoxic offenders such as chemotherapy, cranial radiation, certain drugs, and environmental factors. Currently, it is a commoner white matter syndrome resulting from increased substance abuse, classically by inhaled heroin and other opioids. Herein, we report a case of fatal TLE unveiled in an autopsy of a drug abuser. A 24-year-old male was found dead on the roadside. A day before, he was located in a state of delirium. In this case, the autopsy findings and histopathology characteristics of cerebral cortex involvement particularly directed to speculate the heroine as the principal offender.

Who are the speech and language therapists who work with primary progressive aphasia in Brazil? An exploratory cross-sectional survey study / Quem são os fonoaudiólogos que trabalham com afasia progressiva primária no Brasil? Um estudo de inquérito transversal exploratório

ABSTRACT Primary Progressive Aphasia (PPA) is a progressive language disorder associated with frontotemporal impairment and mainly affects the left hemisphere of the brain. In general, this condition compromises abilities related to comprehension and expression of language. The diagnosis of PPA depends on in-depth knowledge regarding functions of language, neurology, and neuropsychology. Speech and language therapists (SLTs) have a pivotal role in the diagnosis and rehabilitation of PPA. The absence of these professionals involved in the diagnosis and rehabilitation may reflect on the quality of care of people with PPA. Objective: To identify the sociodemographic, educational, and professional practice characteristics of SLTs who work with people with PPA in Brazil. Methods: An online questionnaire was disseminated to reach SLTs across Brazil. The questionnaire collected information regarding sociodemographics, training and education, practice (time, setting, service provision), and sources of referral. Results: The study included 71 participants (95.8% women). Specialization was the most frequent educational level followed by master's degree, and participants where mainly from the Southeast and South regions of Brazil. Neurologists were the professionals who most referred patients with PPA to SLTs. Finally, SLTs worked primarily in homecare settings and provided mainly individual therapy services. Conclusion: SLTs who work with PPA in Brazil can be characterized mainly as professionals with postgraduate degrees, relatively young, and from the South and Southeast regions of Brazil.

RESUMO A afasia progressiva primária (APP) é um distúrbio progressivo da linguagem associado à atrofia de regiões frontotemporais predominantemente do hemisfério esquerdo do cérebro. De modo geral, a APP afeta as capacidades compreensivas e expressivas da linguagem. O diagnóstico depende de profissionais com profundo conhecimento das funções da linguagem, neurologia e neuropsicologia. A fonoaudiologia tem papel essencial no diagnóstico e reabilitação da APP, e a ausência de fonoaudiólogos nesses processos pode refletir na qualidade do cuidado das pessoas com APP. Objetivo: Identificar as características sociodemográficas, educacionais e de atuação profissional de fonoaudiólogos que atuam com APP no Brasil. Métodos: Foi distribuído um questionário em formato online para fonoaudiólogos de todo o Brasil. O questionário coletou informações sobre aspectos sociodemográficos, de formação, atuação profissional (tempo, local de atuação, tipo de serviço oferecido) e fontes de encaminhamento. Resultados: O estudo incluiu 71 participantes (95,8% mulheres). O nível educacional mais frequente foi a especialização, e as regiões demográficas com maior incidência de profissionais que atendiam APP foram as Regiões Sudeste e Sul do país. Os neurologistas foram os profissionais que mais encaminhavam pacientes com APP para os fonoaudiólogos. Por fim, os fonoaudiólogos atuavam, principalmente, em homecare e realizando, em sua maioria, terapia individual. Conclusão: Os fonoaudiólogos que atuam com APP no Brasil podem ser caracterizados principalmente como profissionais pós-graduados, relativamente jovens e das Regiões Sul e Sudeste do Brasil.

Use of transcranial magnetic stimulation in the treatment of nonfluent primary progressive aphasia: a case report / Uso da estimulação magnética transcraniana no tratamento da afasia progressiva primária não fluente: um relato de caso

ABSTRACT Primary progressive aphasia comprises a group of neurodegenerative diseases characterized by progressive speech and language dysfunction. Neuroimaging (structural and functional), biomarkers, and neuropsychological assessments allow for early diagnosis. However, there is no pharmacological treatment for the disease. Speech and language therapy is the main rehabilitation strategy. In this case report, we describe a female patient diagnosed with nonfluent primary progressive aphasia who underwent sessions of high-frequency transcranial magnetic stimulation in the left dorsolateral prefrontal cortex and showed improvement in depression scores, naming tasks in oral and written speech, and comprehension tasks in oral and written discourse.

RESUMO As afasias progressivas primárias (APP) representam um grupo de doenças neurodegenerativas caracterizadas por disfunção progressiva da fala e da linguagem. A neuroimagem (estrutural e funcional), os biomarcadores e as avaliações neuropsicológicas permitem o diagnóstico precoce. No entanto, não há tratamento farmacológico para a doença. A terapia fonoaudiológica é a principal estratégia de reabilitação. Neste relato de caso, descrevemos uma paciente com diagnóstico de APP não fluente que foi submetida a sessões de estimulação magnética transcraniana de alta frequência no córtex pré-frontal dorsolateral esquerdo e apresentou melhora nos escores de depressão, nas tarefas de nomeação da fala oral e escrita e nas tarefas de compreensão da fala oral e escrita.

Crossed aphasia in a left-handed patient with non-fluent variant of primary progressive aphasia with left asymmetric brain SPECT / Afasia cruzada em paciente canhota com afasia progressiva primária variante não fluente com SPECT cerebral assimétrico à esquerda

ABSTRACT Primary progressive aphasia is a clinical syndrome caused by neurodegeneration of areas and neural networks involved in language, usually in the left hemisphere. The term "crossed aphasia" denotes an acquired language dysfunction caused by a lesion in the ipsilateral hemisphere to the dominant hand. Objective: To describe a case of crossed aphasia in a 60-year-old left-handed patient with a non-fluent variant of primary progressive aphasia diagnosis (age of onset=52), evidenced by a left asymmetry on brain SPECT scan. Methods: Clinical and family history, the Edinburgh Handedness Inventory, Measurement of Functional Activities in Older Adults in the Community, the "Mini-Mental State Examination", the Trail Making Test, the Tower of London, and the Neuropsychological assessment for dementia, and neuroimaging studies were carried out. Results: Neuropsychological assessment showed severe cognitive impairment, especially regarding language. The magnetic resonance imaging showed important signs of cortico-subcortical atrophy, with predominance in the frontal and temporal lobes. The single-photon emission computed tomography scan showed moderate to severe hypoperfusion in the left cerebral hemisphere, including the hippocampus. Conclusion: We described a clinical case of crossed aphasia in a left-handed woman with a non-fluent variant of primary progressive aphasia with asymmetry on brain SPECT, mainly on the left, followed up for seven years.

RESUMO A afasia progressiva primária é uma síndrome clínica causada por uma neurodegeneração de áreas e redes neurais envolvidas na linguagem, geralmente no hemisfério esquerdo. O termo "afasia cruzada" denota uma disfunção adquirida de linguagem causada por uma lesão no hemisfério ipsilateral da mão dominante. Objetivo: Relatamos um caso de afasia cruzada em uma paciente de 60 anos, canhota, com um quadro clínico de afasia progressiva primária variante não fluente (idade de início=52), evidenciada por assimetria no SPECT cerebral à esquerda. Métodos: Foram realizados para o diagnóstico do caso: história clínica e familiar, o Inventário de Dominância de Edinburgh, a Escala de Atividades Funcionais de Pfeffer, o Miniexame do Estado Mental, o Teste das Trilhas, o Teste da Torre de Londres, a Avaliação Neuropsicológica Adequada às Demências e exames de neuroimagem. Resultados: A avaliação neuropsicológica mostrou comprometimento cognitivo severo, principalmente sobre a linguagem; a ressonância magnética do crânio mostrou sinais de involução córtico-subcortical, com predominância nos lobos frontal e temporal e a cintilografia cerebral por emissão de fóton único mostrou hipoperfusão moderada a severa no hemisfério cerebral esquerdo, incluindo o hipocampo. Conclusão: Registramos um caso clínico de afasia cruzada em uma paciente canhota com afasia progressiva primária variante não fluente com assimetria no SPECT cerebral, principalmente à esquerda, seguida há sete anos.

Progressive pre-disconnection of urethral mucosal flap during transurethral plasmakinetic enucleation of prostate improves postoperative urinary continence / 浙江大学学报·医学版

OBJECTIVES@#To investigate the effect of progressive pre-disconnection of urethral mucosal flap during transurethral plasmakinetic enucleation of prostate (TUPEP) on early recovery of urinary continence.@*METHODS@#Clinical data of patients with benign prostatic hyperplasia (BPH) admitted in Zhujiang Hospital of Southern Medical University during February and May 2022 were collected. All the patients underwent TUPEP, and the progressive pre-disconnection of urethral mucosal flap was performed in the procedure. The total operation time, enucleation time, postoperative bladder irrigation time and catheter indwelling time were recorded. Urinary continence was evaluated 24 h, 1 week, and 1, 3, 6 months after the removal of urinary catheter.@*RESULTS@#All surgeries were successfully completed at one time with less intraoperative bleeding, and there were no complications such as rectal injury, bladder injury or perforation of prostate capsule. The total operation time was (62.2±6.5) min, the enucleation time was (42.8±5.2) min, the postoperative hemoglobin decrease by (9.5±4.5) g/L, the postoperative bladder irrigation time was (7.9±1.4) h, and the postoperative catheter indwelling time was 10.0 (9.2, 11.4) h. Only 2 patients (3.6%) had transient urinary incontinence within 24 h after catheter removal. No urinary incontinence occurred at 1 week, and 1, 3, 6 months after operation, and no safety pad was needed. The Qmax at 1 month after operation was 22.3 (20.6, 24.4) mL/s, international prostate symptom scores were 8.0 (7.0, 9.0), 5.0 (4.0, 6.0) and 4.0 (3.0, 4.0) at 1, 3 and 6 months after surgery, and quality of life scores at 1, 3 and 6 months after surgery were 3.0 (2.0, 3.0), 2.0 (1.0, 2.0) and 1.0 (1.0, 2.0), all of these indicators were better than those before surgery (all P<0.01).@*CONCLUSIONS@#In the treatment of BPH, the application of progressive pre-disconnection of urethral mucosal flap in TUPEP can completely remove the hyperplastic glands and promote early recovery of postoperative urinary continence with less perioperative bleeding and decreased surgical complications.

Duchenne muscular dystrophy in a Filipino boy reaching adulthood, and nine years into oral corticosteroids: A case report

Rationale@#Duchenne muscular dystrophy (DMD) is a disease that primarily manifests in the early stages of life and progressively affects muscle strength resulting in quadriparesis and ultimately resulting in premature death secondary to cardiac or respiratory failure. DMD is the most common x-linked genetic disorder in children that is because of an alteration of a protein called “dystrophin” which is responsible for strengthening muscle fibers and protecting them from injury as muscles contract and relax. @*Objective@#To highlight the case of a 19-year-old male who was diagnosed with DMD at 8 years of age and treated with oral corticosteroid and rehabilitation. @*Case@#We present the case of a 19-year-old male who developed difficulty climbing stairs and was diagnosed with DMD at 8 years old with the use of clinical exome sequencing. Corticosteroid therapy was initiated and rehabilitation perpetuated which dramatically improved his life expectancy. @*Discussion and Summary@#Clinical exome sequencing was employed on our patient to confirm the diagnosis of DMD from other neuromuscular and neurodegenerative diseases. Most cases of DMD succumb to cardiopulmonary arrest before reaching adulthood; however, this case exemplifies DMD from other cases since our patient was able to prolong his life with continuation of oral corticosteroid and rehabilitation and in the absence of extensive life support.

Progress in the treatment of progressive myoclonic epilepsies / 中华神经科杂志

Progressive myoclonic epilepsies (PMEs) are a group of rare genetic diseases. Common clinical manifestations include action myoclonus often with generalized tonic-clonic seizures, cognitive impairment and other focal neurological deficits. PMEs generally respond poorly to antiseizure drugs and have a poor overall prognosis. Disorders that can cause PMEs include Unverricht-Lundborg disease, Lafora disease, neuronal ceroid lipofuscinosis, myoclonic epilepsy with fragmented red fiber syndrome, sialic acidosis, dentate erythronucleus pallidus Lewy body atrophy, etc. The current treatments for PMEs include drug therapy, neuromodulatory therapy, dietary therapy, anti-inflammatory and immunomodulatory therapy, enzyme replacement therapy and gene therapy. This article reviews the currently known treatments for PMEs, and provides ideas for better research and exploration of treatments for PMEs.

ADAM10 gene mutations caused familial progressive hyperpigmentation / 中华皮肤科杂志

Objective:To identify the causative gene in patients with familial progressive hyperpigmentation (FPH) .Methods:Two families with FPH were collected in March 2005 and March 2015 respectively, and their phenotypes were observed and recorded. The causative gene was investigated by single nucleotide polymorphism (SNP) -based genome-wide linkage analysis and exome sequencing, and verified by Sanger sequencing. The candidate gene expression was determined in FPH lesions and normal skin tissues by using immunohistochemical techniques.Results:The genome-wide linkage analysis showed that the causative gene in FPH family 1 was mapped to the loci of rs1026369-rs11857925 on chromosome 15q21.1 - q22.2; a disintegrin and metalloproteinase 10 (ADAM10) gene was identified as the possible causative gene by exome sequencing; Sanger sequencing showed that a splice-site mutation c.1511+1G>A in the ADAM10 gene was co-segregated with the disease phenotype in the FPH family 1. Immunohistochemical staining demonstrated that ADAM10 was expressed in both the FPH lesions and normal skin tissues of the proband in the FPH family 1. A missense mutation c.1172C>T (p.Ser319Phe) was identified by further ADAM10 mutation analysis in another 3-generation family with FPH (family 2). Both the above mutations were not detected in 300 local healthy controls.Conclusion:ADAM10 was identified as a novel causative gene responsible for FPH.

Assessment of conventional magnetic resonance morphological measurements in diagnosis and differential diagnosis of progressive supranuclear paralysis / 中华老年医学杂志

Objective:To study the features as well as the diagnosis and differential diagnosis values by conventional MRI morphometrics in different clinical subtypes of progressive supranuclear palsy(PSP).Methods:Forty five patients with PSP were included, comprising three PSP subtypes: 15 cases of Richardson's syndrome(PSP-RS), 15 cases of Parkinson's syndrome(PSP-P)and 15 cases of progressive frozen gait(PSP-PFG). In addition, three control groups were established: 15 cases of multiple system atrophy-Parkinson's syndrome(MSA-P), 30 cases of primary Parkinson's disease(PD)and 40 healthy controls(HC). Midbrain area-to-Pons area ratio(M/P), Magnetic Resonance Parkinsonism Index(MRPI, MRPI2.0), width ratio of middle cerebellar peduncle to superior cerebellar peduncle(MCP/SCP), Midbrain-to-Pons ratio(MTPR), Angle of cerebral peduncle(A cp), third ventricle width/frontal horns width ratio(V 3rd/FH), and Humming bird sign rating scale(HBS-RS)scores were calculated.Diagnostic sensitivity and specificity were performed by ROC curve to assess the accuracy of these imaging indicators in the diagnosis and differential diagnosis of PSP and its subtypes. Results:The MRPI, MRPI2.0, MCP/SCP and HBS-RS scores were significantly higher in PSP group than in other control groups( H=69.351, 66.776, 33.926 and 84.694, all P<0.05), while M/P and MTPR were significantly lower in PSP group than in other control groups(H=60.101 and 77.276, all P<0.05). PSP group also had higher V 3rd/FH compared with PD or HC group( F=17.168, P<0.05), but not with MSA-P group( Z=-1.602, P>0.05). The above differences also existed between each PSP subgroup and control groups.Among PSP subgroups, PSP-PFG subgroup had a larger A cp than did PSP-RS( Z=-2.510, P<0.05), and had higher HBS-RS score than did PSP-P group( Z=-2.380, P<0.05). No significant differences in other MRI morphometric indexes were identified among PSP subtypes.The M/P, MRPI, MTPR, MRPI2.0, HBS-RS score showed good accuracy in diagnosing PSP and its each subgroup, with HBS-RS score being the most accurate indicator, when the cutoff value was 2, the AUC values were all higher than 0.99, and the sensitivity and specificity were all above 90%.PSP and its subtypes were best distinguished from MSA-P by MRPI, when the cutoff value was 9.94, the AUC values were all higher than 0.90, with the sensitivity of 100% and specificity of 86.67%.PSP and its subtypes were best distinguished from PD by MTPR, AUC values were all above 0.95, with slightly different cutoff values.Almost all the morphological measurement parameters failed to show significant sensitivity and specificity in discriminating subtypes of PSP.The sensitivity and specificity of almost all MRI morphometry indicators in differentiating different subtypes of PSP are not high. Conclusions:MRI morphometrics have a high value both in the diagnosis of PSP and its subtypes, and also in specific application fields.MRI morphometrics have a limited value in discriminating PSP subtypes.

Effect of health management of progressive resistance training on the self-efficacy and bone mineral density improvement in patients with osteoporosis / 中华健康管理学杂志

Objective:To explore the effect of health management of progressive resistance training on self-efficacy and bone mineral density (BMD) improvement in osteoporosis patients.Methods:It was a cross-sectional study. Clinical data of 156 patients with primary osteoporosis treated in Jiangnan Hospital Affiliated to Zhejiang University of Traditional Chinese Medicine from September 2019 to March 2022 were analyzed retrospectively. A simple random sampling method was implied, and 78 patients were set as control group, they were treated with conventional osteoporosis drugs and routine health education and peer education. And the other 78 patients were set as observation group, and progressive resistance training was added to the health management program in these patients on the basis of the intervention of the control group. Combined with the 6-month follow-up records of the two groups, the changes of self-efficacy level and the improvement of BMDin the two groups before and after the intervention were analyzed and compared. The above indexes were statistically analyzed with χ2 test or t test. Results:The compliance of diet, psychology, exercise and medication in the observation group was 97.4%, 97.4%, 98.7% and 97.4%, respectively, which were all higher than those in the control group (89.7%, 87.2%, 88.5% and 87.2%). The self-efficacy score before and after intervention in the observation group was 110.09±11.73 and 217.05±8.12, the anxiety score was 46.44±3.17 and 31.92±3.28, the depression score was 51.60±3.42 and 33.32±2.98, the osteoporosis knowledge score was 14.99±2.14 and 24.40±1.28, respectively; and those were 110.81±12.53 and 185.36±12.29, 46.92±2.18 and 36.53±3.54, 51.56±3.93 and 39.02±2.65, 14.76±2.93 and 20.11±1.84 respectively in the control group; and there was no statistically significant difference in above-mentioned indexes between the two groups before the intervention (all P>0.05); but after 6 months of intervention, the above-mentioned scores of the observation group were all significantly superior than those in the control group (all P<0.05). The BMD of lumbar spine L 1-4, femoral trochanter and hip in the observation group before intervention was 0.869±0.127, 0.608±0.110 and 0.740±0.138, respectively, and after the intervention, it was 0.915±0.107, 0.654±0.108 and 0.785±0.134, respectively; the BMD of lumbar spine L 1-4, femoral trochanter and hip in the control group was 0.833±0.126, 0.607±0.114 and 0.738±0.135, respectively before intervention, and it was 0.869±0.114, 0.643±0.114 and 0.748±0.124, respectively after intervention. After intervention, the lumbar L 1-4 bone density in the observation group was higher than that in the control group, the difference was statistically significant ( P<0.05). There was no significant difference in all the BMD before intervention and the BMD of the femoral trochanter and the hip after intervention between the two groups (all P>0.05). Conclusion:The health management of progressive resistance training combined with drug therapy can effectively improve the BMD in patients with osteoporosis.

Application of progressive case teaching method based on core competency in standardized nursing training / 中华医学教育探索杂志

Objective:To explore the application effect of progressive case teaching method based on core competency in standardized nursing training.Methods:A total of 63 nursing students rotated in department of neurosurgery from June 2020 to June 2022 were selected as the research objects and randomized into experimental group ( n=31) and control group ( n=32). The experimental group adopted the progressive case teaching method based on core competency, and the control group adopted the conventional teaching mode. The data was analyzed using SPSS 26.0 to conduct t-test or non-parametric test based on the data normality for comparing the theory results, objective structure clinical examination (OSCE) scores, core competency, self-directed learning ability scores, teaching satisfaction and nursing satisfaction of patients in two wards between the two groups. Results:The theoretical results ( t=4.74, P<0.001) and OSCE scores ( t=3.81, P<0.001) of the experimental group were better than those of the control group. The scores of core competency and autonomous learning ability ( t=4.32, P<0.001) of the experimental group were better than those of the control group. The teaching satisfaction score ( t=2.21, P=0.044) and patient satisfaction score ( t=2.92, P=0.011) of the observation group were better than those of the control group. Conclusion:The progressive case teaching method based on core competency can improve the post competency of nurses, and also improve the teaching satisfaction rate and patient satisfaction rate, which is worthy of being carried out in the subsequent teaching activities.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Research progress on the related treatment of progressive myoclonic epilepsy / 中国临床药理学与治疗学

Progressive myoclonic epilepsy (PME) is a rare epileptic syndrome closely associated with genetic factors. The disease is primarily inherited in an autosomal recessive manner, although there are rare cases that demonstrate autosomal dominant or mitochondrial inheritance. Common clinical features include myoclonus, multiple seizure types, and progressive decline in neurological and cognitive function. PME typically manifests in late childhood or adolescence but can occur at any age. It accounts for approximately 1% of epileptic syndromes among children and adolescents worldwide. In recent years, in addition to antiseizure medications, numerous non-pharmacological treatments have emerged, including dietary therapy, neuromodulatory therapy, immunomodulatory therapy, enzyme replacement therapy, gene therapy, etc. This article aims to review the research progress in the treatment of PME.