RESUMO
As an important category of rare diseases, rare genetic kidney diseases have many types. In recent years, their diagnosis, treatment, research and management strategies have made great progress. Continuously more new genes and mechanisms have been discovered, giving rise to new technologies and drugs for precision medicine and clinical applications. This article systematically analyzes rare diseases involving the urinary system listed in the catalog of rare diseases in China, gives examples to illustrate the research and management methods for the diagnosis and treatment of rare genetic kidney diseases, promotes clinical applications of new drugs by expanding physiological mechanisms, introduces the application of special blood purification in the field of critical rare diseases, and provides an outlook forward to the future prospects of precise diagnosis and treatment of rare kidney diseases in China.
RESUMO
ABSTRACT Objective: To evaluate autoinflammatory diseases (AID) according to age at diagnosis and sex, and response to therapy in a large population. Methods: This is a cross-sectional observational study of a Latin American registry using a designed web system for data storage, collected between 2015 and 2018. Any altered findings during follow-up were recorded. The forms were translated into Portuguese and Spanish, including demographic, clinical, laboratory, genetic and treatment characteristics. Results: We included 152 patients, 51.3% male and 75% Caucasian. The median age at disease onset was 2.1 years (0-15.6 years) and median age at diagnosis 6.9 years (0-21.9 years); 111 (73%) were children (0-9 years old), and 41 (27%) were adolescents and young adults (AYA) (10-21 years old). Periodic fever, aphthous stomatitis, pharyngitis, and adenitis syndrome (PFAPA) occurred in 46/152 (30%), chronic non-bacterial osteomyelitis (CNO) in 32/152 (21%), and familial Mediterranean fever (FMF) in 24/152 (15.7%). PFAPA was significantly higher in young children than in AYA (38.7% vs. 7.3%, p<0.001), while CNO were lower (13.5% vs. 41.5%, p<0.001). The frequency of females was significantly higher in CNO (28.4% vs. 14.1%, p=0.031) and lower in FMF (8.1% vs. 23.1%, p=0.011). The most used drugs were glucocorticoids, non-steroidal anti-inflammatory drugs (NSAID), and colchicine. Glucocorticoids and colchicine treatment were used in all AID with good to moderate response. However, cryopyrin-associated periodic syndromes (CAPS) seemed unresponsive to glucocorticoids. NSAIDs and methotrexate were the main medications used to treat CNO. Conclusions: Differences among AID patients were observed in the LA population regarding sex and age at disease diagnosis.
RESUMO Objetivo: Avaliar as doenças autoinflamatórias (DAI) de acordo com sexo e idade no momento do diagnóstico e a resposta terapêutica em uma grande população. Métodos: Este é um estudo observacional transversal de um registro latino-americano que usou um sistema de dados coletados entre 2015 e 2018. Quaisquer achados alterados ao longo do acompanhamento foram registrados. Os formulários foram traduzidos para os idiomas português e espanhol, incluindo características demográficas, clínicas, laboratoriais, genéticas e de tratamento. Resultados: Incluímos 152 pacientes, sendo 51,3% do sexo masculino e 75% da raça branca. A média de idade de início da doença foi de 2,1 anos (0-15,6 anos) e a média de idade de diagnóstico 6,9 anos (0-21,9 anos); 111 (73%) eram crianças (0-9 anos) e 41 (27%) adolescentes/adultos jovens (10-21 anos). A síndrome de febre periódica, estomatite aftosa, faringite e adenite (PFAPA) ocorreu em 46/152 (30%), osteomielite não bacteriana crônica (CNO) em 32/152 (21%) e febre familiar do Mediterrâneo (FMF) em 24/152 (15,7%). A PFAPA foi significativamente maior em crianças pequenas (38,7 vs. 7,3%, p<0,001), e a CNO, em adolescentes/adultos jovens (13,5 vs. 41,5%, p<0,001). A frequência do sexo feminino foi significativamente maior na CNO (28,4 vs. 14,1%, p=0,031) e menor na FMF (8,1 vs. 23,1%, p=0,011). Os medicamentos mais utilizados foram glicocorticoides, anti-inflamatórios não esteroidais (AINE) e colchicina. O tratamento com glicocorticoides e colchicina foi usado em todas as DAI com resposta boa a moderada. No entanto, as síndromes periódicas associadas à criopirina (CAPS) pareciam não responder aos glicocorticoides. AINE e metotrexato foram os principais medicamentos utilizados no tratamento da CNO. Conclusões: Diferenças de pacientes com DAI foram observadas na população latino-americana em pacientes agrupados por sexo e idade ao diagnóstico da doença.
RESUMO
ABSTRACT Objective: Familial chylomicronemia syndrome (FCS) is a rare autosomal recessive metabolic disorder caused by mutations related to chylomicron metabolism. The objective of this study is to show the development and results of a screening program for FCS in Argentina. Materials and methods: A cross-sectional study was performed. All patients > 18 years with a triglyceride level ≥ 1,000 mg/dL in the period from January 1, 2017 to December 31, 2021 were included. The program was developed in three stages: (1) Review of electronic records and identification of suspected laboratory cases (triglyceride level ≥ 1,000 mg/dL); (2) Identification of suspected clinical cases (all suspected laboratory cases that had no relevant secondary factors) and application of the FCS score to define probable cases (score ≥ 10); (3) Perform genetic tests in probable cases. Results: Globally, 348 suspected laboratory cases (mean age of 49.9 years, 77.3% men) were included. The median triglycerides level was 1,309 mg/dL (interquartile range 1,175-1,607 mg/dL). In total, 231 patients were categorized as suspected clinical cases. After applying the FCS score, 3% of them were classified as "very likely FCS" (probable cases). Four variants of uncertain significance have been identified. No previously reported pathogenic variants were detected. Conclusion: This study shows a screening program for the detection of FCS. Although no patient was diagnosed with FCS, we believe that more programs of these characteristics should be developed in our region, given the importance of early detection of this metabolic disorder.
RESUMO
Treatment of children with end-stage kidney disease (ESKD), requiring maintenance dialysis, poses unique challenges. In low- and middle-income countries, lifelong treatment leads to significant stress on the overall family unit. Families face serious financial, social and psychological consequences despite free treatment. This pilot study, utilising primarily quantitative methods, supplemented by two case studies, is set in Sindh Institute of Urology and Transplantation, a tertiary care hospital in Karachi, Pakistan, providing free medical treatment. Fifty-two caretakers of children receiving haemodialysis for more than five years participated in the quantitative arm. Findings reveal that additional financial challenges may send the entire household into financial catastrophe. Social problems include migration from native cities, impact on the education of the sick child along with changes in lives of siblings. One-third of primary caretakers screened positive for anxiety/depression. Healthcare professionals 'practising' in developing countries face considerable ethical dilemmas in their practice when offering “free” paediatric dialysis services knowing the financial and psychological burden imposed on families.
RESUMO
Abstract Hereditary transthyretin amyloidosis with peripheral neuropathy (ATTRv-PN) is an autosomal dominant inherited sensorimotor and autonomic polyneuropathy with over 130 pathogenic variants identified in the TTR gene. Hereditary transthyretin amyloidosis with peripheral neuropathy is a disabling, progressive and life-threatening genetic condition that leads to death in ~ 10 years if untreated. The prospects for ATTRv-PN have changed in the last decades, as it has become a treatable neuropathy. In addition to liver transplantation, initiated in 1990, there are now at least 3 drugs approved in many countries, including Brazil, and many more are being developed. The first Brazilian consensus on ATTRv-PN was held in the city of Fortaleza, Brazil, in June 2017. Given the new advances in the area over the last 5 years, the Peripheral Neuropathy Scientific Department of the Brazilian Academy of Neurology organized a second edition of the consensus. Each panelist was responsible for reviewing the literature and updating a section of the previous paper. Thereafter, the 18 panelists got together virtually after careful review of the draft, discussed each section of the text, and reached a consensus for the final version of the manuscript.
Resumo Polineuropatia amiloidótica familiar associada a transtirretina (ATTRv-PN) é uma polineuropatia sensitivo-motora e autonômica hereditária autossômica dominante com mais de 130 variantes patogênicas já identificadas no gene TTR. A ATTRv-PN é uma condição genética debilitante, progressiva e que ameaça a vida, levando à morte em ~ 10 anos se não for tratada. Nas últimas décadas, a ATTRv-PN se tornou uma neuropatia tratável. Além do transplante de fígado, iniciado em 1990, temos agora 3 medicamentos modificadores de doença aprovados em muitos países, incluindo o Brasil, e muitas outras medicações estão em desenvolvimento. O primeiro consenso brasileiro em ATTRv-PN foi realizado em Fortaleza em junho de 2017. Devido aos novos avanços nesta área nos últimos 5 anos, o Departamento Científico de Neuropatias Periféricas da Academia Brasileira de Neurologia organizou uma segunda edição do consenso. Cada panelista ficou responsável por rever a literatura e atualizar uma parte do manuscrito. Finalmente, os 18 panelistas se reuniram virtualmente após revisão da primeira versão, discutiram cada parte do artigo e chegaram a um consenso sobre a versão final do manuscrito.
RESUMO
ABSTRACT In individuals with very low high-density lipoprotein (HDL-C) cholesterol, such as Tangier disease, LCAT deficiency, and familial hypoalphalipoproteinemia, there is an increased risk of premature atherosclerosis. However, analyzes based on comparisons of populations with small variations in HDL-C mediated by polygenic alterations do not confirm these findings, suggesting that there is an indirect association or heterogeneity in the pathophysiological mechanisms related to the reduction of HDL-C. Trials that evaluated some of the HDL functions demonstrate a more robust degree of association between the HDL system and atherosclerotic risk, but as they were not designed to modify lipoprotein functionality, there is insufficient data to establish a causal relationship. We currently have randomized clinical trials of therapies that increase HDL-C concentration by various mechanisms, and this HDL-C elevation has not independently demonstrated a reduction in the risk of cardiovascular events. Therefore, this evidence shows that (a) measuring HDL-C as a way of estimating HDL-related atheroprotective system function is insufficient and (b) we still do not know how to increase cardiovascular protection with therapies aimed at modifying HDL metabolism. This leads us to a greater effort to understand the mechanisms of molecular action and cellular interaction of HDL, completely abandoning the traditional view focused on the plasma concentration of HDL-C. In this review, we will detail this new understanding and the new horizon for using the HDL system to mitigate residual atherosclerotic risk.
RESUMO
This report presents a case of a male infant, aged 32 days, who was admitted to the hospital due to 2 days of bloody stools and 1 day of fever. Upon admission, venous blood samples were collected, which appeared pink. Blood biochemistry tests revealed elevated levels of triglycerides and total cholesterol. The familial whole genome sequencing revealed a compound heterozygous variation in the LPL gene, with one variation inherited from the father and the other from the mother. The patient was diagnosed with lipoprotein lipase deficiency-related hyperlipoproteinemia. Acute symptoms including bloody stools, fever, and bloody ascites led to the consideration of acute pancreatitis, and the treatment involved fasting, plasma exchange, and whole blood exchange. Following the definitive diagnosis based on the genetic results, the patient was given a low-fat diet and received treatment with fat-soluble vitamins and trace elements, as well as adjustments to the feeding plan. After a 4-week hospitalization, the patient's condition improved and he was discharged. Follow-up showed a decrease in triglycerides and total cholesterol levels. At the age of 1 year, the patient's growth and psychomotor development were normal. This article emphasizes the multidisciplinary diagnosis and treatment of familial hyperlipoproteinemia presenting with symptoms suggestive of acute pancreatitis, including bloody ascites, in the neonatal period.
Assuntos
Humanos , Lactente , Masculino , Doença Aguda , Ascite , Colesterol , Hiperlipoproteinemia Tipo I/genética , Hiperlipoproteinemias , Lipase Lipoproteica/genética , Pancreatite , TriglicerídeosRESUMO
Familial exudative vitreoretinopathy (FEVR) is a serious hereditary retinal vascular disease. The clinical manifestations vary, and the severity of the patients' condition is different. In severe cases, it may lead to bilateral blindness. The pathogenic mechanism of FEVR is also complex. At present, more than ten classical and candidate pathogenic genes have been found: NDP, FZD4, LRP5, TSPAN12, CTNNB1, KIF11, ZNF408, RCBTB1, LRP6, CTNNA1, CTNND1, JAG1, ATOH7, DLG1, DOCK6, ARHGP31 and EVR3 region. These pathogenic genes are involved in Wnt/β-catenin signaling pathway, norrin/β-catenin pathway and Notch pathway. They regulate and affect the development of retinal blood vessels, hyaloid vascular system regression, endothelial cell connections, and blood retinal barrier homeostasis, ultimately leading to the occurrence and development of FEVR disease.
RESUMO
Objective:To compared the changes of macular microvascular architecture in early stage familial exudative vitreoretinopathy (FEVR) patients with inner retinal layer (IRL) persistence and without IRL persistence.Methods:A retrospective clinical study. From 2017 to 2022, 94 patients with stage 1 FEVR with or without IRL residue and 45 age- and sex-matched healthy volunteers with 45 eyes (normal control group) who were confirmed by ophthalmology examination in Hangzhou Hospital of Optometry Affiliated to Wenzhou Medical University and Zhejiang Provincial People's Hospital were included in the study. According to whether there was IRL residue, the patients were divided into IRL group and non-IRL group, with 22 patients (22 eyes) and 72 patients (72 eyes), respectively. Best corrected visual acuity (BCVA) and optical coherence tomography angiography (OCTA) were performed in all eyes. Superficial vessel density (SCP) and deep vessel density (DCP) of whole image, fovea and parafovea, the area and perimeter of fovea avascular area (FAZ), A-circularity index (AI, perimeter/standard circle perimeter with equal area) and vessel density around the 300 μm width of the FAZ (FD), central macular thickness (CMT) on macular 3 mm × 3 mm scan on OCTA were measured.Results:SCP and DCP of whole image ( F=10.774, 4.583) and parafovea ( F=10.433, 3.912), CMT ( F=171.940) in IRL group and non-IRL group on macular 3 mm × 3 mm scan on OCTA were significantly lower than that in normal persons ( P<0.05). There were significant differences among three groups of the area of FAZ ( F=4.315), AI ( F=3.413), FD-300 ( F=13.592) ( P<0.05). BCVA were worst in IRL group ( P<0.05). Conclusions:Blood flow density decreased in macular area of FEVR patients. CMT is significantly thicker than normal population. The FAZ area of the foveal IRL residual eyes is small and irregular, with worse BCVA and lower macular blood density.
RESUMO
Objective:To investigate the etiology, clinical features and treatment of familial exudative vitreoretinopathy (FEVR) secondary glaucoma.Methods:A retrospective clinical study. From January 1, 2016 to January 1, 2022, 15 patients (17 eyes) were diagnosed with FEVR secondary glaucoma in Beijing Tongren Hospital, Capital Medical University were included in the study. All patients underwent systematic ophthalmological evaluation. According to the patient's age, visual acuity, intraocular pressure, anterior segment, vitreous body and retina condition, the choice of translimbal lensectomy combined with vitrectomy, goniectomy, cyclophotocoagulation, intravitreal injection of anti-vascular endothelial growth factor (VEGF) treatment were chosen. The follow-up time was 3 to 37 months. The clinical characteristics of the affected eye, and the changes of intraocular pressure, anterior chamber depth and complications after surgery were observed.Results:Among the 15 patients, there were 11 males with 13 eyes, and 4 females with 4 eyes. Age was 6.14±7.37 years old. FEVR stages 2B, 3B, 4A, 4B, 5A, and 5B were 1, 1, 5, 6, 3, and 1 eye, respectively. The intraocular pressure of the affected eye was 42.74±9.06 mm Hg (1 mm Hg=0.133 kPa). All eyes had shallow anterior chamber and angle closure, anterior or posterior iris adhesions, lens opacity, retinal detachment, iris neovascularization in 4 eyes, and vitreous hemorrhage in 2 eyes. Sixteen eyes were treated with translimbal lensectomy combined with vitrectomy and goniotomy, of which 8 eyes were treated with anti-VEGF treatment; 1 eye was treated with cyclophotocoagulation combined with anti-VEGF treatment. After operation, the intraocular pressure of 16 eyes returned to normal range, and the depth of anterior chamber of 16 eyes returned to normal, and no obvious complications occurred.Conclusions:The main etiology of secondary glaucoma in FEVR is the structural and functional abnormalities of the anterior chamber and angle, which are found in the 2B and above stages of FEVR. The lensectomy and vitrectomy via limbal approach can effectively control the intraocular pressure and restore the anterior chamber, with no serious complications.
RESUMO
Objective:To observe and investigate the related factors that might affect clinical features of familial exudative vitreoretinopaty (FEVR) patients.Methods:A retrospective chart study. From January 2012 and December 2021, 42 patients with 84 eyes with a diagnosis of FEVR from Department of Ophthalmology, Peking University People's Hospital were included in the study. The patients came from 42 separate families. There were 31 males and 11 females, with an average age of first diagnosis was 16.6±33.7 months. There were 21 patients referred from other hospitals for the fundus disease found in eye screening after birth, 21 patients were first seen in our hospital. There were 4 and 38 premature and full-term infants, respectively. Two patients with a positive family history of FEVR. All patients are FEVR stages 1-5. The wide-angle digital pediatric retinal imaging system after general anesthesia for fluorescein fundus angiography (FFA) examination were performed for patients aged <5 years. If patients ≥ 5 years old, routine FFA examination was performed. Sixty-eight first-degree relatives from 28 families undergo routine fundus examinations and FFA examination. Genetic examination was performed for 26 families, including 26 probands and 57 first-degree relatives. Genetic examination were performed on gene the coreceptor of low density lipoprotein receptor-associated protein 5 ( LRP5), Wnt receptor coiled protein 4 ( FZD4), Norrie disease ( NDP), tetraporin 12 ( TSPAN12), catenin β1 ( CTNNB1) genes known to be involved in FEVR. The clinical features and the genotype of FEVR were observed in relation to the clinical phenotype. Results:Among the 42 patients, 13 patients were first observed by strabismus and nystagmus, with the median age of 12 months. Eight patients were complained non-chasing or vision-related symptoms. Among the 84 eyes, FEVR stage 1 or 2, 3 or 4, and 5 were 50 (59.5%, 50/84), 31 (36.9%, 31/84), and 3 (3.6%, 3/84) eyes, respectively. Among the 23 patients who were > 3 months at first diagnosis, 16 patients had at least one eye severer than stage 3 (69.6%, 16/23). Of the 68 first-degree relatives, 22 (32.4%, 22/68) had FEVR-like changes. Among the 26 families that underwent genetic detection, 13 families (50%, 13/26) of 16 variants of FEVR-related genes were detected, of which 10 mutations of LRP5 gene were the most common. There were 10 families with single gene mutations, including 6, 2 and 2 families of LRP5, FZD4 and CTNNB1 genes, respectively. One family of LRP5 gene mutations were compound heterozygous mutations, 1 family with LRP5 gene mutaition combined with NDP gene mutation, and 1 family with LRP5 and TSPAN12 gene mutation. Among the proband with FEVR pathogenic genes, 6 cases with similiar stage of both eyes, and 7 cases with inconsistent disease stages, and there was no obvious correlation between gene mutations and clinical phenotypes. Conclusion:In addition to the age of first diagnosis, no exact factors affecting the clinical manifestations of FEVR are found, and the association between clinical phenotypic and genetic heterogeneity still needs to be further explored.
RESUMO
Objective:To summarize the clinical and genetic characteristics in patients with transthyretin familial amyloid polyneuropathy (TTR-FAP).Methods:Fourteen unrelated TTR-FAP patients diagnosed at Xuanwu Hospital, Capital Medical University from September 2014 to February 2022 were retrospectively reviewed. The clinical manifestation, electrophysiology, cardiac function, biopsy and gene mutation were analyzed.Results:In the 14 patients (13 males, 1 female) diagnosed as TTR-FAP, the mean age at onset was 53.9 years (range: 33.0-71.0 years), with a mean course from symptom-onset to diagnosis of 4.1 years. The late-onset type occurred in 9 cases. Seven patients had a family history of TTR-FAP. Distal paresthesia of lower limbs was the commonest initial symptom (8 cases), with sensorimotor neuropathy and autonomic dysfunction seen initially in 4 and 2 cases, respectively. Cardiac involvement occurred in 6/8 of the patients. Nerve conduction studies indicated extremely axonal impairment with demyelinating features. Sural nerve biopsies showed moderate to severe axonal loss of myelinated fibers and the positive rate of Congo red staining was 8/14. Of 8 different TTR mutations detected, V50M was the most common (appearing in 5 cases). No obvious neuropathy progression was seen in the 5 patients who received tafamidis and 2 patients died of dyscrasia. Conclusions:TTR-FAP is more common in males, with sensorimotor axonal polyneuropathy, autonomic dysfunction and cardiac subclinical damage as the predominant symptoms. V50M is the commonest mutation. Tafamidis can delay the progression of disability.
RESUMO
Familial hypercholesterolemia(FH)is an autosomal dominant disease.Homozygous FH patients tend to have a high incidence of severe arteriosclerotic cardiovascular disease during adolescence and die at ages of 20-30.Liver transplantation(LT)may correct the dysfunction of LDL receptor on hepatocytes, restore normal lipoprotein metabolism, arrest disease progression and improving patient outcomes.However, due to a great rarity of LT for FH, domestic transplantation centers lack the relevant clinical experiences.This review summarized some important issues of FH patients undergoing LT, such as indications, timing, donor sources, efficacies, complications and reusing diseased liver.The goal was to provide practical references for managing FH.
RESUMO
Objective:To identify the causative gene in patients with familial progressive hyperpigmentation (FPH) .Methods:Two families with FPH were collected in March 2005 and March 2015 respectively, and their phenotypes were observed and recorded. The causative gene was investigated by single nucleotide polymorphism (SNP) -based genome-wide linkage analysis and exome sequencing, and verified by Sanger sequencing. The candidate gene expression was determined in FPH lesions and normal skin tissues by using immunohistochemical techniques.Results:The genome-wide linkage analysis showed that the causative gene in FPH family 1 was mapped to the loci of rs1026369-rs11857925 on chromosome 15q21.1 - q22.2; a disintegrin and metalloproteinase 10 (ADAM10) gene was identified as the possible causative gene by exome sequencing; Sanger sequencing showed that a splice-site mutation c.1511+1G>A in the ADAM10 gene was co-segregated with the disease phenotype in the FPH family 1. Immunohistochemical staining demonstrated that ADAM10 was expressed in both the FPH lesions and normal skin tissues of the proband in the FPH family 1. A missense mutation c.1172C>T (p.Ser319Phe) was identified by further ADAM10 mutation analysis in another 3-generation family with FPH (family 2). Both the above mutations were not detected in 300 local healthy controls.Conclusion:ADAM10 was identified as a novel causative gene responsible for FPH.
RESUMO
A 60-year-old female proband presented with recurrent erythema, blisters and erosions all over the body for 30 years, which had been aggravated 10 days prior to the presentation. Skin examination showed erythematous swelling of the bilateral eyelids with scattered dark red crusts, scattered erythema and erosions on the nasolabial folds and chin, large areas of erythema and erosions on the neck, bilateral axillae, left cubital fossa, perineum and perianal area, accompanied by bright red granulation tissues and positive Nikolsky′s sign. The proband had two sons, both of whom occasionally presented with erythema and erosions on the axillae and groin, and had not been diagnosed or treated. Blood samples were collected from the proband and her two sons, and genomic DNA was extracted and subjected to whole-exome sequencing. A heterozygous deletion mutation c.955_957del (p.A319del) was identified in the ATP2C1 gene in the proband and her two sons, which had not been previously reported. The patient was finally diagnosed with generalized familial benign chronic pemphigus.
RESUMO
Hereditary prostate cancer has the highest hereditary rate in men cancers. Genes associated with hereditary prostate cancer susceptibility include mismatch repair genes (MLH1, MSH2, MSH6 and PMS2) and homologous recombination genes (BRCA1/2, ATM, PALB2, CHEK2), and single nucleotide polymorphisms and copy number variants also play a role in genetic mutations. Early onset, rapid disease progression and locally advanced stage are the main features of hereditary prostate cancer. Patients with potentially hereditary prostate cancer would benefit from undergoing genetic testing or counseling. This article reviews the current status of the prevalence, incidence characteristics, and etiology of familial hereditary prostate cancer and other research advances.
RESUMO
Familial pheochromocytoma belongs to autosomal dominant inheritance, and has complex and variable clinical manifestations. A child with bilateral PHEO was admitted to our hospital. His grandmother, father and brother were all diagnosed with PHEO, and his aunt was diagnosed with paraganglioma. The child underwent laparoscopic left partial adrenalectomy and open surgery for the contralateral tumor, and was in good postoperative condition. The blood pressure returned to normal and there was no local recurrence and metastasis during the follow-up of 8 months after the second operation.
RESUMO
Objective:To evaluate the efficacy of scleral buckling in the treatment of retinal detachment (RD) secondary to familial exudative vitreoretinopathy (FEVR).Methods:An observational case series study was conducted.A total of 37 patients (42 eyes) of RD secondary to FEVR who were treated with scleral buckling in Beijing Tongren Hospital from July 2010 to March 2021 were enrolled.There were 30 males (35 eyes) and 7 females (7 eyes), with an average age of (15.21±5.42) years old.Scleral buckling under general anesthesia was performed in all patients.There were 22 eyes with rhegmatogenous RD (RRD), of which 21 eyes were treated with local external compression combined with cerclage, and 1 eye was treated with radial spinal compression.There were 13 eyes with tractive RD (TRD), of which 12 eyes were treated with local external compression combined with cerclage and subretinal fluid drainage, and 1 eye was treated with scleral buckling combined with vitrectomy.There were 7 eyes with RRD combined with TRD, of which 4 eyes were treated with local external compression combined with cerclage and subretinal fluid drainage, and 3 eyes were treated with scleral buckling combined with vitrectomy.The average follow-up time was (30.61±10.50) months.The main outcomes were best corrected visual acuity (BCVA) of the operated eye converted to the logarithm of the minimum angle of resolution, retinal reattachment rate, and incidence of complications.The study adhered to the Declaration of Helsinki and was approved by the Ethics Committee of Beijing Tongren Hospital, Capital Medical University (No.TRECKY2018-056-GZ[2022]-07). Written informed consent was obtained from each subject or their guardians before entering the cohort.Results:The average BCVA was 0.83±0.50 at last follow-up after surgery which was better than 1.10±0.39 before surgery, and the difference was statistically significant ( t=6.639, P<0.001). There were 39 eyes with retinal reattachment and 3 eyes without retinal reattachment.The reattachment rate was 95.45%(21/22) in RRD, 84.62%(11/13) in TRD, and 100%(7/7) in RRD combined with TRD.No serious complication occurred in any patients during postoperative follow-up. Conclusions:On the premise of optimized surgical strategy based on the indications of RD secondary to FEVR, scleral buckling has a high retinal reattachment rate in the treatment of RD secondary to FEVR.
RESUMO
The clinical data, diagnose and treatment of a child with familial glucocorticoid deficiency (FGD) caused by the NNT gene mutation who was treated in the Department of Endocrinology, Children′s Hospital Affiliated to Nanjing Medical University in November 2014 were retrospectively analyzed.The female child with 1 year and 5 months old presented with 6 months of skin pigmentation.Laboratory examinations showed decreased cortisol and increased adrenocorticotropic hormone.During the follow-up period, she developed convulsions and precocious puberty.Whole exome sequencing revealed that the patient carried a homozygous mutation c. 1054G > A (p.G352R) in exon 8 of the NNT gene, which was a newly reported gene mutation.Domestic cases of FGD caused by the NNT gene mutation has never been reported yet.Through literature review of a total of 40 reported children with FGD caused by the NNT gene mutation, typical manifestations included skin pigmentation, hypoglycemia and seizures, alongside mineralocorticoid deficiency, precious puberty, abnormal male gonadal development, thyroid diseases and heart diseases.
RESUMO
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.