Effect of polycystin2 on differentiation and maturation of osteoblasts promoted by low-frequency pulsed electromagnetic fields / 生物工程学报

It is known that low-frequency pulsed electromagnetic fields (PEMFs) can promote the differentiation and maturation of rat calvarial osteoblasts (ROBs) cultured in vitro. However, the mechanism that how ROBs perceive the physical signals of PEMFs and initiate osteogenic differentiation remains unknown. In this study, we investigated the relationship between the promotion of osteogenic differentiation of ROBs by 0.6 mT 50 Hz PEMFs and the presence of polycystin2 (PC2) located on the primary cilia on the surface of ROBs. First, immunofluorescence staining was used to study whether PC2 is located in the primary cilia of ROBs, and then the changes of PC2 protein expression in ROBs upon treatment with PEMFs for different time were detected by Western blotting. Subsequently, we detected the expression of PC2 protein by Western blotting and the effect of PEMFs on the activity of alkaline phosphatase (ALP), as well as the expression of Runx-2, Bmp-2, Col-1 and Osx proteins and genes related to bone formation after pretreating ROBs with amiloride HCl (AMI), a PC2 blocker. Moreover, we detected the expression of genes related to bone formation after inhibiting the expression of PC2 in ROBs using RNA interference. The results showed that PC2 was localized on the primary cilia of ROBs, and PEMFs treatment increased the expression of PC2 protein. When PC2 was blocked by AMI, PEMFs could no longer increase PC2 protein expression and ALP activity, and the promotion effect of PEMFs on osteogenic related protein and gene expression was also offset. After inhibiting the expression of PC2 using RNA interference, PEMFs can no longer increase the expression of genes related to bone formation. The results showed that PC2, located on the surface of primary cilia of osteoblasts, plays an indispensable role in perceiving and transmitting the physical signals from PEMFs, and the promotion of osteogenic differentiation of ROBs by PEMFs depends on the existence of PC2. This study may help to elucidate the mechanism underlying the promotion of bone formation and osteoporosis treatment in low-frequency PEMFs.

Policistina-1 protege a los cardiomiocitos de la necrosis inducida por estrés mecánico / Policystin-1 protects cardiomyocytes from mechanical stress induced necrosis

Resumen: Antecedentes: La muerte de los cardiomiocitos es determinante en el desarrollo de patologías cardiacas posteriores al infarto del miocardio y la insuficiencia cardiaca. Las variaciones en la expresión de la familia de proteínas BCL-2 regulan vías, tanto de muerte, como de sobrevida celular. Así, BCL-2 es una proteína anti- apoptótica y NIX una proteína que induce la necrosis y/o la apoptosis celular. La Policistina-1 (PC1) es un mecanosensor vital para la función contráctil cardiaca; sin embargo, se desconoce su papel en la sobrevida de los cardiomiocitos durante el estrés mecánico. Objetivo: Determinar si PC-1 previene la muerte de los cardiomiocitos inducida por estrés mecánico y las proteínas BCL-2 y NIX. Métodos: Se utilizó cultivo de cardiomiocitos de ratas neonatas controles o deficientes en la expresión de PC1, estimulados con solución hiposmótica (HS), como modelo de estrés mecánico. Se midió la muerte por necrosis y apoptosis y los niveles de BCL-2 y NIX. Resultados: La deficiencia de la PC1 en los cardiomiocitos induce un aumento de la necrosis y los niveles proteicos de NIX en las células estimuladas con HS. El estrés mecánico induce la apoptosis basal relacionada a una disminución de BCL- 2, independiente de la expresión de la PC1. Conclusiones: La PC1 protege a los cardiomiocitos de la necrosis por estrés mecánico, lo que podría deberse en parte a su papel en la regulación de los niveles de las proteínas NIX.

Abstracts: Background: Cardiomyocytes death is a determining factor in the development of cardiac dysfunction after myocardial infarction and heart failure. The change in BCL-2 family protein expression regulates both cell death and survival pathways, whereas BCL-2 is an anti-apoptotic protein and NIX induces necrosis and/or apoptosis. Polycystin-1 (PC1) is a crucial mechanosensor for cardiac contractile function. However, its role in cardiomyocyte survival during mechanical stress is unknown. Aim: To study the relationship of PC1 with mechanical stretch-death in cardiomyocytes and the BCL-2, and NIX proteins. Methods. Controls or deficient expression of PC1 neonatal rat ventricular myocytes were stimulated with hypoosmotic solution (HS) and used as a model of mechanical stress. Necrosis or apoptosis cell death, BCL-2 and NIX protein levels were measured. Results: Deficient expression of PC1 increases cardiomyocyte necrosis and NIX protein levels in cells stimulated with HS. Mechanical stress induces basal apoptosis related to a decrease in BCL-2, independent of PC1 expression. Conclusion: PC1 protects cardiomyocytes from mechanical stress necrosis, at least in part, by regulating NIX protein levels.

Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).@*METHODS@#Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.@*RESULTS@#Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.@*CONCLUSION@#Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.

Analysis of PKD1 gene mutation in a family affected with autosomal dominant polycystic kidney disease / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To determine the molecular etiology for a family affected with autosomal dominant polycystic kidney disease and provide prenatal diagnosis for the family.</p><p><b>METHODS</b>Clinical data of the family was collected. Target region sequencing with monogenetic disorders capture array combined with Sanger sequencing and bioinformatics analysis were performed in turn. SIFT and NCB1 were used to evaluate the conservation of the gene and pathogenicity of the identified mutation.</p><p><b>RESULTS</b>Target region sequencing has identified a novel c.11333C to A (p.T3778N) mutation of the PKD1 gene in the proband and the fetus, which was confirmed by Sanger sequencing in three affected individuals from the family. The same mutation was not detected in healthy members of the pedigree. Bioinformatics analysis suggested that the mutation has caused a likely pathogenic amino acid substitution of Threonine by Aspartic acid, and Clustal analysis indicated that the altered amino acid is highly conserved in mammals.</p><p><b>CONCLUSION</b>A novel mutation of the PKD1 gene has been identified in an affected Chinese family. The mutation is probably responsible for a range of clinical manifestations, for which reliable prenatal diagnosis and genetic counseling may be provided.</p>

Identification of a novel splicing mutation of PKD1 gene in a pedigree affected with autosomal dominant polycystic kidney disease / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To identify potential mutations of PKD1 gene in a family affected with autosomal dominant polycystic kidney disease (ADPKD).</p><p><b>METHODS</b>The coding regions of the PKD1 gene were subjected to PCR and Sanger sequencing. Reverse transcription-PCR (RT-PCR) was used to determine the relative mRNA expression in the patient.</p><p><b>RESULTS</b>A splicing site mutation, c.8791+1_8791+5delGTGCG (IVS23+1_+5delGTGCG), was detected in the PKD1 gene in all 5 patients from the pedigree but not in 6 phenotypically normal relatives and 40 healthy controls. Sequencing of RNA has confirmed that there were 8 bases inserted in the 3' end of exon 23 of the PKD1 gene.</p><p><b>CONCLUSION</b>The novel c.8791+1_8791+5delGTGCG mutation has created a new splice site and led to a frameshift, which probably underlies the ADPKD in the family. Above finding has enriched the mutation spectrum of the PKD1 gene.</p>

Immunohistochemical study of polycystin-1 in dentigerous cysts.

Background: The alterations involved in step-wise transformation of a dental follicle to dentigerous cyst (DC) is not clearly known. Primary cilium and its protein have been hypothesized to be associated with DC. Mutation of a ciliary protein, polycystin‑1 (PC1) is associated with autosomal dominant polycystic kidney disease. This study was performed to assess the immunohistochemical expression of PC1 between DC and postfunctional follicular tissue (PFFT). Materials and Methods: Thirty‑one consecutive PFFT and 15 DC formed the study group. The PFFT and DC tissues were stained with antibody against PC1. Statistical Package for Social Service was used to analyze data. Descriptive statistics and Student’s Chi‑square test were appropriately used. P ≤0.05 was taken as significant. Results: Fifteen DC (100%) and 7 (22.58%) PFFT were positive for PC1. The difference was statistically significant (P = 0.000). PC1 expression was observed in the cytoplasm with varying intensity. Discussion and Conclusion: All PC1 positive epithelial cells’ cytoplasm stained diffusely. Abnormal cytoplasmic expression of PC1 in all positive epithelial lining indicates that the PC1 probably is associated with cystic transformation.

Cyst growth, polycystins, and primary cilia in autosomal dominant polycystic kidney disease

The primary cilium of renal epithelia acts as a transducer of extracellular stimuli. Polycystin (PC)1 is the protein encoded by the PKD1 gene that is responsible for the most common and severe form of autosomal dominant polycystic kidney disease (ADPKD). PC1 forms a complex with PC2 via their respective carboxy-terminal tails. Both proteins are expressed in the primary cilia. Mutations in either gene affect the normal architecture of renal tubules, giving rise to ADPKD. PC1 has been proposed as a receptor that modulates calcium signals via the PC2 channel protein. The effect of PC1 dosage has been described as the rate-limiting modulator of cystic disease. Reduced levels of PC1 or disruption of the balance in PC1/PC2 level can lead to the clinical features of ADPKD, without complete inactivation. Recent data show that ADPKD resulting from inactivation of polycystins can be markedly slowed if structurally intact cilia are also disrupted at the same time. Despite the fact that no single model or mechanism from these has been able to describe exclusively the pathogenesis of cystic kidney disease, these findings suggest the existence of a novel cilia-dependent, cyst-promoting pathway that is normally repressed by polycystin function. The results enable us to rethink our current understanding of genetics and cilia signaling pathways of ADPKD.

Polycystin-1 C terminus cleavage and its relation with polycystin-2, two proteins involved in polycystic kidney disease / Clivaje del C-terminal de policistina-1 y su relación con policistina-2, dos proteínas involucradas en la poliquistosis renal

Autosomal dominant polycystic kidney disease (ADPKD), a most common genetic cause of chronic renal failure, is characterized by the progressive development and enlargement of cysts in kidneys and other organs. The cystogenic process is highly complex and involves a high proliferative rate, increased apoptosis, altered protein sorting, changed secretory characteristics, and disorganization of the extracellular matrix. ADPKD is caused by mutations in the genes encoding polycystin-1 (PC-1) or polycystin-2 (PC-2). PC-1 undergoes multiple cleavages that intervene in several signaling pathways involved in cellular proliferation and differentiation mechanisms. One of these cleavages releases the cytoplasmic C-terminal tail of PC-1. In addition, the C-terminal cytoplasmic tails of PC-1 and PC-2 interact in vitro and in vivo. The purpose of this review is to summarize recent literature that suggests that PC-1 and PC-2 may function through a common signaling pathway necessary for normal tubulogenesis. We hope that a better understanding of PC-1 and PC-2 protein function will lead to progress in diagnosis and treatment for ADPKD.

La poliquistosis renal autosómica dominante (ADPKD por sus siglas en inglés) es una causa genética muy común de falla renal crónica que se caracteriza por el progresivo desarrollo y agrandamiento de quistes en los riñones y en otros órganos. El proceso de cistogénesis comprende incrementos en la proliferación y muerte celular por apoptosis, así como alteraciones en la distribución intracelular de proteínas, el movimiento transcelular de solutos y organización de la matriz extracelular. ADPKD es causada por mutaciones en los genes que codifican para policistina-1 (PC-1) o policistina-2 (PC-2). PC-1 puede sufrir múltiples clivajes y los fragmentos generados intervienen en diferentes cascadas de señalización involucradas en mecanismos de proliferación y diferenciación celular. Uno de estos clivajes libera el extremo C-terminal citoplasmático de la PC-1. Se ha demostrado que los extremos C-terminal citoplasmático de PC-1 y PC-2 pueden interactuar tanto in vitro como in vivo. El propósito de esta revisión es resumir la literatura más reciente que sugiere que PC-1 y PC-2 pueden funcionar a través de una cascada de señalización común necesaria para la tubulogénesis normal. Creemos que una mejor comprensión de los mecanismos moleculares de acción de PC-1 y PC-2 contribuirán al progreso en el diagnóstico y tratamiento de ADPKD.

Molecular and cellular pathogenesis of autosomal dominant polycystic kidney disease

Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common human life-threatening monogenic disorders. The disease is characterized by bilateral, progressive renal cystogenesis and cyst and kidney enlargement, often leading to end-stage renal disease, and may include extrarenal manifestations. ADPKD is caused by mutation in one of two genes, PKD1 and PKD2, which encode polycystin-1 (PC1) and polycystin-2 (PC2), respectively. PC2 is a non-selective cation channel permeable to Ca2+, while PC1 is thought to function as a membrane receptor. The cyst cell phenotype includes increased proliferation and apoptosis, dedifferentiation, defective planar polarity, and a secretory pattern associated with extracellular matrix remodeling. The two-hit model for cyst formation has been recently extended by the demonstration that early gene inactivation leads to rapid and diffuse development of renal cysts, while inactivation in adult life is followed by focal and late cyst formation. Renal ischemia/reperfusion, however, can function as a third hit, triggering rapid cyst development in kidneys with Pkd1 inactivation induced in adult life. The PC1-PC2 complex behaves as a sensor in the primary cilium, mediating signal transduction via Ca2+ signaling. The intracellular Ca2+ homeostasis is impaired in ADPKD, being apparently responsible for the cAMP accumulation and abnormal cell proliferative response to cAMP. Activated mammalian target for rapamycin (mTOR) and cell cycle dysregulation are also significant features of PKD. Based on the identification of pathways altered in PKD, a large number of preclinical studies have been performed and are underway, providing a basis for clinical trials in ADPKD and helping the design of future trials.

Identification of mutations in PKD1 and PKD2 genes in two Chinese families with autosomal dominant polycystic kidney disease / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To identify the responsible mutation of autosomal dominant polycystic kidney disease (ADPKD) in two Chinese families.</p><p><b>METHODS</b>Total genomic DNA of all available family members and 100 unrelated healthy controls was extracted from peripheral blood leukocytes using a standard phenol-chloroform procedure. All exons with intronic flanking sequences of the PKD1 and PKD2 genes in the probands were amplified by PCR. Mutations were detected directly by DNA sequencing. To evaluate the pathogenicity of the variations, family and control based analyses were performed.</p><p><b>RESULTS</b>Five sequence variants were identified in the two families including PKD1 :c.2469G to A, PKD1:c.5014_5015delAG, PKD1:c.10529 C to T, PKD2:c.568G to A and PKD2:c.2020 1_2020delAG. Among them, PKD1:c.2469G to A and PKD2:c.2020 1_2020 delAG were novel mutations. Furthermore, the frameshift and splicing site mutations detected in the affected individuals were not detected in their unaffected relatives and 100 unrelated normal controls.</p><p><b>CONCLUSION</b>PKD1:c.5014_5015delAG and PKD2:c.2020 1_2020delAG are the responsible mutations of family A and B, respectively, and PKD2:c.2020 1_2020delAG is a de novo mutation.</p>

Recent advances in studies on autosomal dominant adult polycystic kidney disease / 中华医学遗传学杂志

Adult polycystic kidney disease (APKD) is a severe autosomal dominant inheritable renal disease with high incidence. Because of the late-onset of the disease, patients might have transferred the disease gene to the next generation when diagnosis is made. Since its pathogenic molecular mechanism is still not completely clear and the shortage of effective medicines, the prevention and treatment of the disease is still not satisfactory. In the present article, the recent advances in the research on the pathogenesis, gene diagnosis and management of APKD are reviewed.

TRPP subfamily and kidney diseases / 浙江大学学报·医学版

TRPP subfamily is an important member of transient receptor potential family. It has six transmembrane (TM) domains, a large extracellular loop between the first and second TM and 2-4 ankyrin repeats in the N terminal. TRPP subfamily includes TRPP2, TRPP3, TRPP5 etc. There are several differences in their structure, activation mode and function. TRPP subfamily is involved in many physiological mechanisms and its abnormal structure can lead to the formation of polycystic kidney. This subfamily is also closely related to gustation. In this review, we summarize recent research findings of TRPP subfamily and its association with polycystic kidney diseases.

Mutation detection of PKD1 gene in patients with autosomal dominant polycystic kidney diseases / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To detect gene mutation in the patients with autosomal dominant polycystic kidney disease (PKD).</p><p><b>METHODS</b>Polymerase chain reaction (PCR)-denaturing high-performance liquid chromatography (DHPLC) analyses were performed in 3o single copy region of PKD 1 gene (PKD1). DNA sequencing were carried out on PCR products with abnormal peak shape afterwards.</p><p><b>RESULTS</b>A new nonsense mutation (C11901A in exon 42 of PKD1 was identified to cause serine in position 3897 turning to a stop codon. A missense mutation, C10737T, was detected in exon 35 which caused threonine in position 3509 turn to methionine. Two kinds of samesense mutation, G11824A and C11860T in exon 42, were found in normal control.</p><p><b>CONCLUSION</b>PKD1 mutation were detected successfully by PCR-DHPLC. A new nonsense mutation, a missense mutation and two polymorphisms are identified in this study.</p>

Research on autosomal dominant polycystic kidney disease in China / 中华医学杂志(英文版)

<p><b>OBJECTIVE</b>To review the history and recent development of research on autosomal dominant polycystic kidney disease (ADPKD) in China.</p><p><b>DATA SOURCES</b>Both Chinese and English literatures were searched in MEDLINE/CD ROM (1979 - 2006) and the Chinese Biomedical Literature Disk (1979 - 2006).</p><p><b>STUDY SELECTION</b>Published articles about ADPKD from mainland of China were selected. Data were mainly extracted from 58 articles which are listed in the reference section of this review.</p><p><b>RESULTS</b>Some preliminary reports on cyst decompression surgeries and mutation analysis represent the contribution to the ADPKD research from China in the history. A serial of basic research and clinical studies on ADPKD in recent years also have been summarized. A technique platform for ADPKD research was firstly established. The genomics/proteomics/bioinformatics approach was introduced, which provide a lot of valuable information for understanding the pathogenesis. By denature high performance liquid chromatography (DHPLC) technique the entire PKD1 and PKD2 gene sequence screening system for Chinese Han population has been successfully established. Based on the characteristic data of Chinese patients, an integrated therapy protocol was put forward and won an advantage over the traditional therapy. Some novel experimental studies on therapy also were encouraging.</p><p><b>CONCLUSIONS</b>Remarkable progress of ADPKD research in China have been made recently. Still many works, including the government support, international collaboration and active participation of more Chinese nephrologists, should be enhanced to advance this process in the near future.</p>

Polycystin-1 Expression in Fetal, Adult and Autosomal Dominant Polycystic Kidney

The mutation of the PKD1 gene causes autosomal dominant polycystic kidney disease (ADPKD), and the PKD1 gene encodes polycystin-1 (PC-1). PC-1 is thought to be a cell-cell/matrix adhesion receptor molecule at the cell surface that is widely expressed in the kidney. However, there are controversies about the role of PC-1 protein and its expression when using different antibodies to detect it. We used two PC-1 antibodies; C-20 (Santa Cruz, sc-10372) as the C-terminal antibody, and P-15 (Santa Cruz, sc-10307) as the N-terminal antibody. We evaluated the PC-1 expression by performing immunoblotting on the human embryonic kidney (HEK) 293 cells and the renal proximal tubular epithelial cell (RPTEC) lysates. We characterized the expression of PC-1 in the fetal, adult and polycystic kidneys tissues by performing immunohistochemistry. We confirmed the PC-1 expression in the HEK 293 cells and the RPTEC lysates, but the expression was very low. The PC-1 proteins were diffusely expressed in the tubular epithelial cells cytoplasm in the fetal and adult kidneys, and the PC-1 expression was more prominent in the proximal tubules of the fetal kidney. In the ADPKD kidney, the PC-1 proteins were heterogenously and weakly expressed in the tubular or cyst lining epithelial cells. Our data suggests that the development of the kidney may regulate the expression of PC-1, and an altered PC-1 expression may contribute to cyst formation in ADPKD.

An analysis for the phenotype and genotype of autosomal dominant polycystic kidney disease from two Chinese families / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To scan for mutations of polycystic kidney disease 1 gene (PKD1) in Chinese population in order to find some features about Chinese patients and a better approach to detect mutations.</p><p><b>METHODS</b>Twenty-five PKD-affected individuals from twenty-one unrelated genealogies and sixteen controls participated in the study. Thirty-five blood samples and six tissues were obtained after receiving informed consent and were in accordance with institutional ethical guidelines. Genomic DNA was isolated from peripheral blood using standard procedures. PCR amplification of genomic DNA was performed to generate the aimed fragments. Amplified fragments were analyzed by denaturing gradient gel electrophoresis (DGGE). A GC clamp was attached to the 5' primer. After that, the abnormal fragments were sequenced on freshly amplified specific PCR products with the dideoxynucleotide chain termination method. Sequencing was performed for all samples to evaluate DGGE.</p><p><b>RESULTS</b>Aimed fragments of exons 44 and 45 were amplified. DGGE detected eleven abnormal PCR fragments. Two novel mutations were identified by sequencing, included one nonsense mutation (C12217T) and one frameshift (12431delCT). In addition, one polymorphism (A50747C) was identified. The mutation detection rate is 8% in our study.</p><p><b>CONCLUSION</b>Two novel pathogenic mutations were detected, including one nonsense mutation (C12217T) and one frameshift (12431delCT).</p>

Mutation detection of ADPKD PKD1 gene in Hans by denaturing high-performance liquid chromatography / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To develop a screening system for more rapid and sensitive mutation detection of autosomal dominant polycystic kidney disease (ADPKD) gene 1 (PKD1) by using denaturing high-performance liquid chromatography (DHPLC) protocol.</p><p><b>METHODS</b>Using genomic DNA as templates extracted from blood samples of 19 Han pedigrees with 67 family members, the complete codon areas were amplified by long-range PCR and nested PCR in succession, and then the PCR products were analyzed by DHPLC. The mutations from screened abnormal PCR products were confirmed by DNA sequencing, and then compared with the mutations identified by single strand conformation polymorphism (SSCP) before.</p><p><b>RESULTS</b>There were 14 mutations found in this study, including 10 missense, 1 insertion, 1 deletion and 2 nonsense mutations. Besides 12 mutations identified before, mutations nt32819G>A and nt37137T>C were the novel mutations found. The mutation detection ratio was 73.7%.</p><p><b>CONCLUSION</b>This developed system via DHPLC can be used as a more effective approach for mutation detection of autosomal dominant polycystic kidney disease PKD1 in Hans.</p>

A Chinese autosomal dominant polycystic kidney disease family probably related to PKD2 gene / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To study the genetic heterogeneity of autosomal dominant polycystic kidney disease (ADPKD) in Chinese.</p><p><b>METHODS</b>Using polymerase chain reaction (PCR) and non-denatured polyacrylamide gel electrophoresis, the authors analyzed eight microsatellite markers closely linked to PKD1 or PKD2 genes respectively in a Chinese ADPKD family.</p><p><b>RESULTS</b>Seven informative markers were found in this family, including KG8, SM6, CW4 and CW2 which are tightly linked to PKD1, and D4S1563, D4S414 and D4S423 which are linked to PKD2. After the process of genotyping, the haplotypes were estimated with Cyrillic 2.0, and the linkage-based analysis suggested that the disease is not linked to PKD1 other than PKD2.</p><p><b>CONCLUSION</b>In China this non-PKD1 family is the second one, but it is the first reported PKD2 family showing the genetic heterogeneity of ADPKD in Chinese. In the family the affected mother transmits the disease and the affected members' phenotypes are eterogeneous. In addition, the existing "anticipation" and the presence of the disease in a child of this family suggest that non-PKD1 linked families may have early-onset of the disease in child.</p>

Expression of PKD1 and PKD2 transcripts and proteins and its significance in different types of kidney tissues and kidney lines / 中华病理学杂志

<p><b>OBJECTIVE</b>To investigate the expression and function of PKD1 and PKD2 in different kidney tissues and cell lines.</p><p><b>METHODS</b>Immunoprecipitation, Western blotting, In situ hybridization and immunohistochemical staining methods were used to observe the expression of PKD1 mRNA and PKD2 mRNA and their protein abundance in different kidney tissues and cell lines.</p><p><b>RESULTS</b>Coordinate expressions of PKD1 and PKD2 were found in all kidney tissues and cell lines. Distribution of PKD1 mRNA and PKD2 mRNA and their protein polycystin-1 and polycystin-2 in normal human adult kidney tissue were mainly expressed in the medullary collecting ducts and distal tubules. Positive staining was also found in the majority of cyst-lining epithelial cells of PKD1 cystic kidney tissue, PKD1 cyst-lining epithelia cell line and LLC-PK1. The expression level of them in cystic epithelia of ADPKD kidney tissue was much higher than that in adult renal tubules (P < 0.01).</p><p><b>CONCLUSIONS</b>Similar expression pattern of PKD1 and PKD2 and their different tissue distribution in different kidney tissues show that the molecular mutuality of PC-1 and PC-2 might be the base of their functional correlation. Polycystins might play an important role in the maintenance of tubular architecture.</p>