Clinicopathological features of gastric alpha-fetoprotein-producing adenocarcinoma with SWI/SNF complex deletion / 中华病理学杂志

Objective: To investigate the clinicopathological features and treatment of gastric alpha-fetoprotein (AFP)-producing adenocarcinoma with SWI/SNF complex deletion. Methods: Four cases of gastric AFP-producing adenocarcinoma with SWI/SNF complex deletion diagnosed in Zhongshan Hospital of Fudan University from January 2021 to December 2022 were collected, and their histomorphological characteristics, immunohistochemical (IHC), in situ hybridization of Epstein-Barr virus-encoded RNA (EBER), next-generation sequencing results, clinicopathological features and treatment were summarized, and literature review was conducted. Results: Among the 4 patients, there were three males and one female. They presented with abdominal pain, belching and melena. Serum AFP was significantly elevated in three patients, and endoscopy showed ulcerative lesions. Microscopically, the tumor cells showed mainly diffuse flaky or nest-like growth and typical characteristics of hepatoid adenocarcinoma. In two cases there were adenoid growth, and the tumor cells in these areas possessed clear cytoplasm, suggesting enteroblastic differentiation. The tumor cell nuclei were pleomorphic with large nucleoli and brisk mitoses. The IHC results showed that the tumor cells expressed AFP, GPC3 and SALL4, and there was retained expression of broad-spectrum keratin (CKpan) and E-cadherin. IHC detection of SWI/SNF complex subunits, namely INI1 (SMARCB1), BRG1 (SMARCA4), BRM (SMARCA2), ARID1A protein was performed. In all four cases the hepatoid adenocarcinoma region and enteroblastic differentiation region showed SMARCA2 deletion, and one case with enteroblastic differentiation also showed ARID1A deletion. SMARCB1 and SMARCA4 deletions were not seen. All the four cases were diffusely positive for p53 protein, and the Ki-67 proliferation index was 80%-90%. There were no mismatch repair deletion detected; one cases showed HER2 was strongly positive (3+), and EBER was negative. None of the four cases had mutations in the SWI/SNF complex-related subunits detected by next-generation sequencing. Among the four patients, two underwent palliative surgery due to distant metastasis at the time of surgery, two underwent radical resection. Postoperative adjuvant chemotherapy was given to three patients. Conclusions: AFP-producing adenocarcinoma is a rare subtype of gastric cancer, which can be combined with SWI/SNF complex deletion, and the pathomorphological manifestations are different from the classical SWI/SNF complex deletion of undifferentiated carcinoma with rhabdoid phenotype.

Clinical feature and genetic analysis of a patient with Idiopathic hypogonadotropic hypogonadism due to a novel variant of CHD7 gene / 中华医学遗传学杂志

OBJECTIVE@#To explore the clinical feature and genetic etiology of a patient with normosmic idiopathic hypogonadotropic hypogonadism (nIHH) due to variant of CHD7 gene.@*METHODS@#A patient who had presented at Anhui Provincial Children's Hospital in October 2022 was selected as the study subject. Clinical data of the patient was collected. The patient and his parents were subjected to trio-whole exome sequencing. Candidate variant was verified by Sanger sequencing and bioinformatic analysis.@*RESULTS@#The patient had featured delayed development of secondary sexual characteristics but normal olfactory function. Genetic testing revealed that he has harbored a c.3052C>T (p.Pro1018Ser) missense variant of the CHD7 gene, for which both of his parents were of the wild type. The variant has not been recorded in the PubMed and HGMD databases. Analysis of amino acid sequences suggested that the variant site is highly conserved, and the variant may affect the stability of protein structure. Based on the guidelines from the American College of Medical Genetics and Genomics, the c.3032C>T variant was classified as a likely pathogenic (PS2+PM2_Supporting+PP2+PP3+PP4).@*CONCLUSION@#The delayed development of secondary sexual characteristics of the patient may be attributed to the c.3052C>T (p.Pro1018Ser) variant of the CHD7 gene. Above finding has expanded the variation spectrum of the CHD7 gene.

Clinicopathological features and prognosis of SMARCA4-deficient non-small cell lung carcinoma: an analysis of 127 cases / 中华病理学杂志

Objective: To investigate and elucidate the clinicopathological and prognostic characteristics of SMARCA4-deficient non-small cell lung cancer. Methods: The clinicopathological and prognostic data were collected in 127 patients with SMARCA4-deficient non-small cell lung cancer diagnosed in Shanghai Pulmonary Hospital, Shanghai, China from January 2020 to March 2022. The variation and expression of biomarkers related to treatment were retrospectively reviewed. Results: One hundred and twenty-seven patients were eligible for enrollment. Among them 120 patients (94.5%) were male and 7 cases (5.5%) were female, while the average age was 63 years (range 42-80 years). There were 41 cases (32.3%) of stage Ⅰ cancer, 23 cases (18.1%) of stage Ⅱ, 31 cases (24.4%) of stage Ⅲ and 32 cases (25.2%) of stage Ⅳ. SMARCA4 expression detected by immunohistochemistry was completely absent in 117 cases (92.1%) and partially absent in 10 cases (7.9%). PD-L1 immunohistochemical analyses were performed on 107 cases. PD-L1 was negative, weakly positive and strongly positive in 49.5% (53/107), 26.2% (28/107) and 24.3% (26/107) of the cases, respectively. Twenty-one cases showed gene alterations (21/104, 20.2%). The KRAS gene alternation (n=10) was most common. Mutant-type SMARCA4-deficient non-small cell lung cancer was more commonly detected in females, and was associated with positive lymph nodes and advanced clinical stage (P<0.01). Univariate survival analysis showed that advanced clinical stage was a poor prognosis factor, and vascular invasion was a poor predictor of progression-free survival in patients with surgical resection. Conclusions: SMARCA4-deficient non-small cell lung cancer is a rare tumor with poor prognosis, and often occurs in elderly male patients. However, SMARCA4-deficient non-small cell lung cancers with gene mutations are often seen in female patients. Vascular invasion is a prognostic factor for disease progression or recurrence in patients with resectable tumor. Early detection and access to treatment are important for improving patient survivals.

Evaluation of Efficacy and Prognosis Analysis of Stage III-IV SMARCA4-deficient Non-small Cell Lung Cancer Treated by PD-1 Immune Checkpoint Inhibitors plus Chemotherapy and Chemotherapy / 中国肺癌杂志

BACKGROUND@#The SMARCA4 mutation has been shown to account for at least 10% of non-small cell lung cancer (NSCLC). In the present, conventional radiotherapy and targeted therapy are difficult to improve outcomes due to the highly aggressive and refractory nature of SMARCA4-deficient NSCLC (SMARCA4-DNSCLC) and the absence of sensitive site mutations for targeted drug therapy, and chemotherapy combined with or without immunotherapy is the main treatment. Effective SMARCA4-DNSCLC therapeutic options, however, are still debatable. Our study aimed to investigate the efficacy and prognosis of programmed cell death 1 (PD-1) immune checkpoint inhibitors (ICIs) in combination with chemotherapy and chemotherapy in patients with stage III-IV SMARCA4-DNSCLC.@*METHODS@#46 patients with stage III-IV SMARCA4-DNSCLC were divided into two groups based on their treatment regimen: the chemotherapy group and the PD-1 ICIs plus chemotherapy group, and their clinical data were retrospectively analyzed. Efficacy assessment and survival analysis were performed in both groups, and the influencing factors for prognosis were explored for patients with SMARCA4-DNSCLC.@*RESULTS@#Male smokers are more likely to develop SMARCA4-DNSCLC. There was no significant difference in the objective response rate (76.5% vs 69.0%, P=0.836) between chemotherapy and the PD-1 ICIs plus chemotherapy or the disease control rate (100.0% vs 89.7%, P=0.286). The one-year overall survival rate in the group with PD-1 ICIs plus chemotherapy was 62.7%, and that of the chemotherapy group was 46.0%. The difference in median progression-free survival (PFS) between the PD-1 ICIs plus chemotherapy group and the chemotherapy group was statistically significant (9.3 mon vs 6.1 mon, P=0.048). The results of Cox regression analysis showed that treatment regimen and smoking history were independent influencing factors of PFS in patients with stage III-IV SMARCA4-DNSCLC, and family history was an individual influencing factor of overall survival in patients with stage III-IV SMARCA4-DNSCLC.@*CONCLUSIONS@#Treatment regimen may be a prognostic factor for patients with SMARCA4-DNSCLC, and patients with PD-1 ICIs plus chemotherapy may have a better prognosis.

Clinical feature difference between juvenile amyotrophic lateral sclerosis with SPTLC1 and FUS mutations / 中华医学杂志(英文版)

BACKGROUND@#Juvenile amyotrophic lateral sclerosis (JALS) is an uncommon form of amyotrophic lateral sclerosis whose age at onset (AAO) is defined as prior to 25 years. FUS mutations are the most common cause of JALS. SPTLC1 was recently identified as a disease-causative gene for JALS, which has rarely been reported in Asian populations. Little is known regarding the difference in clinical features between JALS patients carrying FUS and SPTLC1 mutations. This study aimed to screen mutations in JALS patients and to compare the clinical features between JALS patients with FUS and SPTLC1 mutations.@*METHODS@#Sixteen JALS patients were enrolled, including three newly recruited patients between July 2015 and August 2018 from the Second Affiliated Hospital, Zhejiang University School of Medicine. Mutations were screened by whole-exome sequencing. In addition, clinical features such as AAO, onset site and disease duration were extracted and compared between JALS patients carrying FUS and SPTLC1 mutations through a literature review.@*RESULTS@#A novel and de novo SPTLC1 mutation (c.58G>A, p.A20T) was identified in a sporadic patient. Among 16 JALS patients, 7/16 carried FUS mutations and 5/16 carried respective SPTLC1 , SETX , NEFH , DCTN1 , and TARDBP mutations. Compared with FUS mutation patients, those with SPTLC1 mutations had an earlier AAO (7.9 ± 4.6 years vs. 18.1 ± 3.9 years, P  < 0.01), much longer disease duration (512.0 [416.7-607.3] months vs. 33.4 [21.6-45.1] months, P  < 0.01), and no onset of bulbar.@*CONCLUSION@#Our findings expand the genetic and phenotypic spectrum of JALS and help to better understand the genotype-phenotype correlation of JALS.

Clinical and genetic analysis of two patients with CHARGE syndrome due to de novo variants of CHD7 gene / 中华医学遗传学杂志

OBJECTIVE@#To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.@*METHODS@#The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.@*RESULTS@#Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.@*CONCLUSION@#The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.

Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

Espectro fenotípico de Síndrome de CHARGE neonatal / Phenotypic spectrum of neonatal CHARGE syndrome

INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.

INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.

Non-Homologous End Joining Repair Mechanism-Mediated Deletion of CHD7 Gene in a Patient with Typical CHARGE Syndrome

CHARGE syndrome MIM #214800 is an autosomal dominant syndrome involving multiple congenital malformations. Clinical symptoms include coloboma, heart defects, choanal atresia, retardation of growth or development, genital hypoplasia, and ear anomalies or deafness. Mutations in the chromodomain helicase DNA binding protein 7 (CHD7) gene have been found in 65-70% of CHARGE syndrome patients. Here, we describe a 16-month-old boy with typical CHARGE syndrome, who was referred for CHD7 gene analysis. Sequence analysis and multiplex ligation-dependent probe amplification were performed. A heterozygous 38,304-bp deletion encompassing exon 3 with a 4-bp insertion was identified. There were no Alu sequences adjacent to the breakpoints, and no sequence microhomology was observed at the junction. Therefore, this large deletion may have been mediated by non-homologous end joining. The mechanism of the deletion in the current case differs from the previously suggested mechanisms underlying large deletions or complex genomic rearrangements in the CHD7 gene, and this is the first report of CHD7 deletion by this mechanism worldwide.

ATR-X syndrome in two siblings with a novel mutation (c.6718C>T mutation in exon 31).

ATR-X syndrome is an X-linked mental retardation syndrome characterized by mental retardation, alpha thalassaemia and distinct facial features which include microcephaly, frontal hair upsweep, epicanthic folds, small triangular nose, midface hypoplasia and carp-shaped mouth. Here we report two brothers with clinical features of ATR-X syndrome, in whom a novel missense (C>T) mutation was identified in exon 31 of the ATRX gene.

Novel CHD7 and FBN1 mutations in an infant with multiple congenital anamolies.

The first case of an infant with a dual genetic diagnosis of CHARGE and Marfan syndrome is reported here. The patient had multiple congenital anamolies, many of them consistent with CHARGE syndrome and genetic testing identified a heterozygous mutation c.3806_11del6insA in the CHD7 gene. In addition, his father had physical features consistent with Marfan syndrome. Fibrillin-1 (FBN1) mutation screening identified a heterozygous c.3990insC mutation in both father and the patient.

'DEAD-box' helicase from Plasmodium falciparum is active at wide pH and is schizont stage-specific.

BACKGROUND & OBJECTIVES: DNA helicases catalyse unwinding of duplex DNA in an ATP-dependent manner and are involved in all the basic genetic processes. In order to study these important enzymes in the human malaria parasite we have recently cloned the first full-length 'DEAD-box' helicase gene from Plasmodium falciparum (3D7). In the present study, we report some of the important activities of the encoded protein. METHODS: We have expressed the P. falciparum helicase in Escherichia coli and characterised the encoded biochemically active helicase protein. The characterisation of the protein was carried out using radioactively labeled substrate and the standard strand displacement assay. The localisation of the enzyme was studied using immunofluorescence assay. RESULTS & CONCLUSION: P. falciparum helicase gene is 1551 bp in length and encodes for a protein consisting of 516 amino acid residues with a predicted molecular mass of 59.8 kDa. The protein is designated as Plasmodium falciparum DEAD-box helicase 60 kDa in size (PfDH60). Purified PfDH60 showed ATP and Mg2+ dependent DNA unwinding, ssDNA-dependent ATPase and ATP-binding activities. Interestingly, this is a unique helicase because it works at a wide pH range (from 5.0-10.0). The peak expression of PfDH60 is mainly in schizont stages of the development of P. falciparum, where DNA replication is active. The cell-cycle dependent expression suggests that PfDH60 may be involved in the process of DNA replication and distinct cellular processes in the parasite and this study should make an important contribution in our better understanding of DNA metabolic pathways in the parasite.

Frequency of Werner helicase 1367 polymorphism and age-related morbidity in an elderly Brazilian population

Werner syndrome (WS) is a premature aging disease caused by a mutation in the WRN gene. The gene was identified in 1996 and its product acts as a DNA helicase and exonuclease. Some specific WRN polymorphic variants were associated with increased risk for cardiovascular diseases. The identification of genetic polymorphisms as risk factors for complex diseases affecting older people can improve their prevention, diagnosis and prognosis. We investigated WRN codon 1367 polymorphism in 383 residents in a district of the city of São Paulo, who were enrolled in an Elderly Brazilian Longitudinal Study. Their mean age was 79.70 ± 5.32 years, ranging from 67 to 97. This population was composed of 262 females (68.4 percent) and 121 males (31.6 percent) of European (89.2 percent), Japanese (3.3 percent), Middle Eastern (1.81 percent), and mixed and/or other origins (5.7 percent). There are no studies concerning this polymorphism in Brazilian population. These subjects were evaluated clinically every two years. The major health problems and morbidities affecting this cohort were cardiovascular diseases (21.7 percent), hypertension (83.7 percent), diabetes (63.3 percent), obesity (41.23 percent), dementia (8.0 percent), depression (20.0 percent), and neoplasia (10.8 percent). Their prevalence is similar to some urban elderly Brazilian samples. DNA was isolated from blood cells, amplified by PCR and digested with PmaCI. Allele frequencies were 0.788 for the cysteine and 0.211 for the arginine. Genotype distributions were within that expected for the Hardy-Weinberg equilibrium. Female gender was associated with hypertension and obesity. Logistic regression analysis did not detect significant association between the polymorphism and morbidity. These findings confirm those from Europeans and differ from Japanese population.

Obesity and genetic polymorphism of ERCC2 and ERCC4 as modifiers of risk of breast cancer

To evaluate the relationship of genetic polymorphisms of ERCC2 and ERCC4 genes, both involved in nucleotide excision repair (NER), and the risk of breast cancer, a hospital-based case-control study was conducted in Korea. Histologically confirmed breast cancer cases (n=574) and controls (n=502) with no present or previous history of cancer were recruited from three teaching hospitals in Seoul during 1995-2001. Information on selected characteristics was collected by interviewed questionnaire. ERCC2 Asp312Asn (G>A) was genotyped by single-base extension assay and ERCC4 Ser835Ser (T>C) by dynamic allele-specific hybridization system. Although no significant association was observed between the genetic polymorphisms and the risk of breast cancer, women with both ERCC2 A allele- and ERCC4 C allele-containing genotypes showed a 2.6-fold risk (95% CI: 1.02-6.48) of breast cancer compared to women concurrently carrying the ERCC2 GG and ERCC4 TT genotypes. The breast cancer risk increased as the number of "at risk" genotypes increased with a borderline significance (P for trend = 0.07). Interactive effect was also observed between ERCC4 genotype and body mass idnex (BMI) for the breast cancer risk; the ERCC4 C allele containing genotypes posed a 1.7-fold (95% CI: 0.96-2.93) breast cancer risk in obese women (BMI>25 kg/m2) with a borderline significance. Our finding suggests that the combined effect of ERCC2 Asp312Asn and ERCC4 Ser835Ser genotypes might be associated with breast cancer risk in Korean women.