RESUMO
OBJECTIVE@#To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.@*METHODS@#The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.@*RESULTS@#Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.@*CONCLUSION@#The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.
Assuntos
Humanos , Síndrome CHARGE/genética , DNA Helicases/genética , Proteínas de Ligação a DNA/genética , Testes Genéticos , Heterozigoto , Mutação , Fenótipo , Sequenciamento do ExomaRESUMO
El síndrome CHARGE es un trastorno genético raro que generalmente se diagnostica durante el período prenatal o neonatal, con la identificación de numerosas anomalías dismórficas y congénitas, como coloboma, defectos cardiacos, atresia de coanas, retraso del crecimiento, hipogonadismo y defectos auditivos, con una incidencia de 1 por cada 12.000 a 15.000 nacidos vivos. Presenta un patrón de herencia autosómico dominante, y entre el 60% y el 70% de los casos se deben a mutaciones que alteran la secuencia del gen CHD7 en el cromosoma 8, las cuales en su mayoría (>90%) son mutaciones de novo. Se describe el caso de una paciente de 6 años con sospecha de síndrome de malformaciones múltiples, que presentó al examen físico talla baja, pabellones de baja implantación, frente amplia, antecedentes de atresia esofágica, hipoacusia neurosensorial, coloboma y riñón en herradura, los cuales son criterios mayores y menores para el diagnóstico clínico de la entidad. Posteriormente, se realizó secuenciación del exoma completo, detectándose alteración del gen CHD7, que confirmó el diagnóstico de síndrome CHARGE. Se debe tener presente que, aunque la prueba molecular confirma el diagnóstico, un gran porcentaje de los pacientes con diagnóstico clínico de síndrome CHARGE no presentan alteraciones en la secuencia de este gen; por lo tanto, el diagnóstico clínico, basado en las alteraciones fenotípicas, continúa demostrando su relevancia
CHARGE syndrome is a rare genetic disorder, which is usually diagnosed during the prenatal or neonatal period with the identification of numerous dysmorphic and congenital abnormalities, characterized by coloboma, heart defects, choanal atresia, retarded growth and development, hypogonadism, and hearing defects, with an incidence of 1 in every 12,000 to 15,000 live births. It has an autosomal dominant inheritance pattern, and between 60% and 70% of cases are caused by mutations in the CHD7 gene at chromosome 8, with the majority (>90%) of mutations occurring de novo. The case of a 6-year-old patient with a multiple malformation syndrome is described, who presented during the physical examination with short stature, ear abnormalities, prominent forehead, a history of esophageal atresia, sensorineural hearing loss, coloboma and horseshoe kidney, which are major and minor criteria for the clinical diagnosis of this condition. Subsequently, complete exome sequencing was performed, detecting a mutation in the CHD7 gene, that confirmed the diagnosis of CHARGE syndrome. It should be noted that although the molecular test confirms the diagnosis, a large percentage of patients with a clinical diagnosis of CHARGE syndrome do not have mutations in this gene sequence; therefore, clinical diagnosis, based on phenotypic features, continues demonstrating its relevance
Assuntos
Síndrome CHARGE , Genética , MutaçãoRESUMO
OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.
Assuntos
Criança , Humanos , Síndrome CHARGE/genética , DNA Helicases/genética , Proteínas de Ligação a DNA/genética , Variação Genética , Mutação , FenótipoRESUMO
SUMMARY CHARGE syndrome is a complex disorder involving multiple congenital anomalies and is caused by heterozygous mutations in the CHD7 gene. Growth retardation is a characteristic finding and about 10% of cases present growth hormone (GH) deficiency. GH treatment of short stature in CHARGE syndrome has shown some benefit, but normal height is rarely attained. We report a girl with CHARGE syndrome due to a de novo frameshift mutation in the CHD7 gene (c.2509_2512delCATT), in whom recurrent hypoglycaemia led to the diagnosis of GH deficiency in the second month of life. Early initiation of treatment with recombinant GH resulted in normal growth over ten years of follow-up. This case is the youngest reported CHARGE patient to be diagnosed and treated for GH deficiency and demonstrates that GH deficiency in CHARGE syndrome may manifest early in life through hypoglycaemia, before growth retardation is noted, and can be successfully treated with recombinant GH.
Assuntos
Humanos , Feminino , Recém-Nascido , Síndrome CHARGE , Hormônio do Crescimento , Hormônio do Crescimento Humano , MutaçãoRESUMO
INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.
INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.
Assuntos
Humanos , Feminino , Recém-Nascido , DNA Helicases/genética , Proteínas de Ligação a DNA/genética , Síndrome CHARGE/fisiopatologia , Fenótipo , Síndrome CHARGE/diagnóstico , Síndrome CHARGE/genética , MutaçãoRESUMO
Mutations in the CHD7 gene, encoding for the chromodomain helicase DNA-binding protein 7, are found in approximately 60% of individuals with CHARGE syndrome (coloboma, heart defects, choanal atresia, retarded growth and development, genital hypoplasia, ear abnormalities and/or hearing loss). Herein, we present a clinical case of a 14-year-old male presenting for evaluation of poor growth and pubertal delay highlighting the diagnostic challenges of CHARGE syndrome. The patient was born full term and underwent surgery at 5 days of life for bilateral choanal atresia. Developmental milestones were normally achieved. At age 14 his height and weight were
Assuntos
Adolescente , Humanos , Masculino , Síndrome CHARGE , Atresia das Cóanas , Diagnóstico , Orelha , Hormônio Foliculoestimulante , Seguimentos , Testes Genéticos , Gonadotropinas , Crescimento e Desenvolvimento , Audição , Coração , Hormônio Luteinizante , Transtornos do Olfato , Puberdade Tardia , Testículo , TestosteronaRESUMO
CHARGE syndrome is a rare genetic disorder with CHD7 gene mutation. CHARGE is an acronym for coloboma (C), heart disease (H), atresia of choanae (A), retardation of growth (R), genitourinary malformation (G), and ear abnormalities (E). Patients with CHARGE syndrome need to undergo many surgeries due to their various congenital anomalies. Since airway abnormalities frequently accompany CHARGE syndrome, general anesthesia remains a challenge. Here we report a case of difficult intubation in a 35-month-old boy with CHARGE syndrome during general anesthesia and the experience of successful intubation using D-blade of C-MAC® video laryngoscope.
Assuntos
Criança , Pré-Escolar , Humanos , Masculino , Manuseio das Vias Aéreas , Anestesia Geral , Síndrome CHARGE , Coloboma , Orelha , Cardiopatias , Intubação , Laringoscópios , Nasofaringe , PediatriaRESUMO
<p><b>OBJECTIVE</b>To analyze two Chinese pediatric patients with multiple malformations and growth and development delay.</p><p><b>METHODS</b>Both patients were subjected to targeted gene sequencing, and the results were analyzed with Ingenuity Variant Analysis software. Suspected pathogenic variations were verified by Sanger sequencing.</p><p><b>RESULTS</b>High-throughput sequencing showed that both patients have carried heterozygous variants of the CHD7 gene. Patient 1 carried a nonsense mutation in exon 36 (c.7957C>T, p.Arg2653*), while patient 2 carried a nonsense mutation of exon 2 (c.718C>T, p.Gln240*). Sanger sequencing confirmed the above mutations in both patients, while their parents were of wild-type for the corresponding sites, indicating that the two mutations have happened de novo.</p><p><b>CONCLUSION</b>Two patients were diagnosed with CHARGE syndrome by high-throughput sequencing.</p>
Assuntos
Humanos , Lactente , Masculino , Síndrome CHARGE , Genética , DNA Helicases , Genética , Proteínas de Ligação a DNA , Genética , Testes Genéticos , Sequenciamento de Nucleotídeos em Larga Escala , MutaçãoRESUMO
Bilateral choanal atresia is a rare disorder characterized by bilateral obstruction of the posterior end of the nasal cavity. It can be present in isolation or associated with multiple disorders such as coloboma, heart defect, choanal atresia, retarded growth, genital hypoplasia, ear abnormalities (CHARGE) syndrome. Because congenital bilateral choanal atresia presents as respiratory distress at birth, immediate diagnosis and adequate treatment is required. Traditionally, using stents was a part of the postoperative treatment to provide a low rate of restenosis but recently it is controversial. Currently nasal endoscopic approach is mainly used with or without stenting. We report a case of CHARGE syndrome with bilateral choanal atresia treated by transnasal endoscopic approach without stenting.
Assuntos
Síndrome CHARGE , Atresia das Cóanas , Coloboma , Diagnóstico , Orelha , Coração , Cavidade Nasal , Parto , StentsRESUMO
CHARGE syndrome (coloboma, heart defects, atresia choanae, retarded growth and development, genital hypoplasia, and ear abnormalities) is characterized by multiple malformations and is diagnosed using distinct consensus criteria. Mutations in the gene encoding chromodomain helicase DNA-binding protein 7 (CHD7) are the major cause of CHARGE syndrome. Clinical features of CHARGE syndrome considerably overlap those of 22q11.2 deletion syndrome. Of these features, immunodeficiency and hypocalcemia are frequently reported in patients with 22q11.2 deletion syndrome but are rarely reported in patients with CHARGE syndrome. In this report, we have described the case of a patient with typical phenotypes of 22q11.2 deletion syndrome but without the proven chromosome microdeletion. Mutation analysis of CHD7 identified a pathogenic mutation (c.2238+1G>A) in this patient. To our knowledge, this is the first case of CHARGE syndrome with immunodeficiency and hypocalcemia in Korea. Our observations suggest that mutation analysis of CHD7 should be performed for patients showing the typical phenotypes of 22q11.2 deletion syndrome but lacking the proven chromosome microdeletion.
Assuntos
Humanos , Síndrome CHARGE , Consenso , Síndrome de DiGeorge , Orelha , Crescimento e Desenvolvimento , Coração , Hipocalcemia , Coreia (Geográfico) , Nasofaringe , FenótipoRESUMO
CHARGE syndrome MIM #214800 is an autosomal dominant syndrome involving multiple congenital malformations. Clinical symptoms include coloboma, heart defects, choanal atresia, retardation of growth or development, genital hypoplasia, and ear anomalies or deafness. Mutations in the chromodomain helicase DNA binding protein 7 (CHD7) gene have been found in 65-70% of CHARGE syndrome patients. Here, we describe a 16-month-old boy with typical CHARGE syndrome, who was referred for CHD7 gene analysis. Sequence analysis and multiplex ligation-dependent probe amplification were performed. A heterozygous 38,304-bp deletion encompassing exon 3 with a 4-bp insertion was identified. There were no Alu sequences adjacent to the breakpoints, and no sequence microhomology was observed at the junction. Therefore, this large deletion may have been mediated by non-homologous end joining. The mechanism of the deletion in the current case differs from the previously suggested mechanisms underlying large deletions or complex genomic rearrangements in the CHD7 gene, and this is the first report of CHD7 deletion by this mechanism worldwide.
Assuntos
Humanos , Lactente , Masculino , Elementos Alu/genética , Sequência de Bases , Síndrome CHARGE/diagnóstico , DNA/química , Reparo do DNA por Junção de Extremidades , DNA Helicases/genética , Proteínas de Ligação a DNA/genética , Éxons , Dosagem de Genes , Heterozigoto , Reação em Cadeia da Polimerase Multiplex , Mutação , Análise de Sequência de DNA , Deleção de SequênciaRESUMO
Introduction: Although it has been more than 250 years since the first description of choanal atresia (CA), there are still doubts about this abnormality. The differences between unilateral and bilateral forms are seldom discussed. Objectives: Aggregate data from patients diagnosed with CA, grouping patients with unilateral and bilateral forms. Methods: Retrospective study. Results Eighteen patients were included: 12 (66.6%) presented bilateral atresia, of which 77.8% were mixed bony-membranous type and 22.2% were pure bony type. From the 12 patients with bilateral atresia, 10 presented related malformations, 3 of whom had CHARGE syndrome (coloboma, heart defects, choanal atresia, retardation of growth and development, genitourinary problems, ear abnormalities). From the remaining 6 patients with unilateral atresia, only 2 showed malformations, 1 renal and 1 cardiac. All patients with unilateral atresia needed only 1 surgical procedure, and patients with the bilateral form needed a median of 2.85 interventions (p = 0.003). The median age of surgical procedure in the unilateral group was 6 years, ranging from 6 months to 18 years, and in the bilateral group was 25 days, ranging from 6 days to 6 years (p = 0.003). The median interval between diagnosis and surgery was 9 months in the unilateral group, ranging from 1 month to 18 years, and in the bilateral group was 1 day, ranging from 1 day to 2 months (p = 0.001). Discussion and Conclusions: Success rates with the endoscopic approach vary from 62 to 100%. Nonetheless, most of these reports present results without considering the number of compromised sides. In our opinion, unilateral and bilateral cases involve distinct patients (taking into account the related malformations), have diverging clinical presentations, and show discrepant restenosis rates and therefore could be considered in different groups of analysis...
Assuntos
Humanos , Masculino , Feminino , Síndrome CHARGE , Atresia das Cóanas , Anormalidades Congênitas , Estudos RetrospectivosRESUMO
PURPOSE: CHARGE syndrome consists of multiple malformation including coloboma, heart defect, choanal atresia, growth or developmental retardation, genital anomalies, and ear anomalies. The aim of this study was to evaluate the respiratory problems in children with CHARGE syndrome. METHODS: Out of 9 patients with CHARGE syndrome, medical records from 8 patients showing respiratory distress or respiratory failure were retrospectively reviewed. We investigated the causes of respiratory problems by physical examination, endoscopy, echocardiogram, computed tomography, rigid bronchoscopy, swallowing test, and 24-hour impedence monitoring. RESULTS: Five patients required endotracheal intubation soon after birth due to bilateral choanal atresia (n=2) and congenital heart diseases (n=3). Three patients were intubated within a month because of surgery for complex heart diseases (n=2) or recurrent apnea (n=1). Tracheostomy was performed in 3 patients who showed primary or secondary subglottic stenosis. Among 8 patients who had aspiration or respiratory distress after feeding, cricopharyngeal incoordination and gastroesophageal reflux disease were found in 7 and 2 children, respectively. One patient died of aspiration during oral feeding. CONCLUSION: Patients with CHARGE syndrome manifest respiratory distress or failure due to various causes including congenital anomaly in the airway, cardiac anomaly, neurologic or gastrointestinal problems. Therefore, pediatricians should be alert to the respiratory symptoms and signs in CHARGE syndrome and take active intervention from the birth to improve their long-term prognosis.
Assuntos
Criança , Humanos , Apneia , Ataxia , Broncoscopia , Síndrome CHARGE , Atresia das Cóanas , Coloboma , Constrição Patológica , Deglutição , Orelha , Endoscopia , Métodos de Alimentação , Refluxo Gastroesofágico , Coração , Cardiopatias , Intubação Intratraqueal , Prontuários Médicos , Parto , Exame Físico , Prognóstico , Insuficiência Respiratória , Estudos Retrospectivos , TraqueostomiaRESUMO
CHARGE syndrome has been estimated to occur in 1:10,000 births worldwide and shows various clinical manifestations. It is a genetic disorder characterized by a specific and a recognizable pattern of anomalies. The major clinical features are ocular coloboma, heart malformations, atresia of the choanae, growth retardation, genital hypoplasia, and ear abnormalities. The chromodomain helicase DNA-binding protein 7 (CHD7) gene, located on chromosome 8q12.1, causes CHARGE syndrome. The CHD7 protein is an adenosine triphosphate (ATP)-dependent chromatin remodeling protein. A total of 67% of patients clinically diagnosed with CHARGE syndrome have CHD7 mutations. Five hundred twenty-eight pathogenic and unique CHD7 alterations have been identified so far. We describe a patient with a CHARGE syndrome diagnosis who carried a novel de novo mutation, a c.3896T>C (p. leu1299Pro) missense mutation, in the CHD7 gene. This finding will provide more information for genetic counseling and expand our understanding of the pathogenesis and development of CHARGE syndrome.
Assuntos
Humanos , Trifosfato de Adenosina , Síndrome CHARGE , Montagem e Desmontagem da Cromatina , Coloboma , Diagnóstico , Orelha , Aconselhamento Genético , Coração , Mutação de Sentido Incorreto , Nasofaringe , PartoRESUMO
Colpocephaly is an abnormal enlargement of the occipital horns of both lateral ventricles; it is also described as persistence of the fetal configuration of the lateral ventricles. Since it was first described, Colpocephaly has been found in association with several abnormalities of the brain. The spectrum of clinical presentation is wide, including mainly various degrees of mental retardation, seizures, and motor and visual abnormalities. Approximately 50 cases have been described in children. Herein we report three new cases of Colpocephaly. One of the cases was associated with CHARGE syndrome. To the best of our knowledge, this is the first publication to report such an association
Assuntos
Humanos , Masculino , Feminino , Síndrome CHARGE , Aberrações dos Cromossomos Sexuais , Ventrículos Cerebrais/patologia , Predisposição Genética para Doença , Lobo OccipitalRESUMO
The CHARGE association (coloboma of the eyes; heart disease; atresia of the choanae; retarded growth and development; genital hypoplasia/genitourinary anomalies; ear anomalies and/or hearing loss) was first described in 1979 by Hall, and among its main features is hearing loss. This study presents a case aiming to establish relationships between performance on Infant Toddler Meaningful Auditory Integration Scale (IT-MAIS) and Meaningful Use of Speech Scales (MUSS) tests and the analysis of hearing and language categories of a patient diagnosed with CHARGE syndrome, before and after cochlear implant (CI) surgery. Case Report: A 7-year-old girl was diagnosed with CHARGE. She had severe sensorineural hearing loss and was a prelingual unilateral CI user. We analyzed data from the patient's medical records regarding therapies and video recordings. Results: The patient showed positive results in all evaluations after CI. IT-MAIS rose from 5 to 90% following the use of CI. MUSS also rose, from 75 to 72.5%, after use of CI. Classification of Auditory Skills changed from category 1 before use of CI to category 6 after use of CI. Classification of Language Skills changed from category 1 before use of CI to category 3 after use of CI. The CI is an aid but there are many factors in the therapeutic process, and great heterogeneity in individuals diagnosed with CHARGE should be investigated. Conclusion: The development of listening and language skills after CI use was demonstrated by IT-MAIS and MUSS tests, and categorization of speech and hearing in this child with a diagnosis of CHARGE syndrome shows that CI can be an effective technological resource to provide information on hearing as one source for language construction...
Assuntos
Humanos , Feminino , Criança , Síndrome CHARGE , Implantes Cocleares , Testes Auditivos , Testes de LinguagemRESUMO
Los defectos del desarrollo se pueden deber a malformaciones congénitas, deformaciones o disrupciones. El 10% de las malformaciones se atribuyen a causas ambientales el 25% a factores genéticos y el 65% a factores desconocidos probablemente de orden multifactorial. Existe un período de mayor susceptibilidad frente a los teratógenos que corresponde a la etapa donde se están formando la mayoría de los órganos y sistemas. La ingestión de plantas teratogénicas puede dar lugar a anomalías congénitas en los fetos de animales. Los pesticidas como DDT, la contaminación de las aguas por mercurio y los disruptores endocrinos afectan la embriogénesis de las distintas especies del reino animal. También se consideran como factores causantes de malformaciones a los agentes ambientales infecciosos y a algunos medicamentos. Los agentes físicos como los aumentos de temperatura, las condiciones de hipoxia y las radiaciones afectan a distintos organismos, desde los peces al ser humano. La genética de las malformaciones ha sido difícil de establecer, principalmente porque la mayor parte de ellas se caracteriza por presentar manifestaciones fenotípicas diversas, que en muchos casos aparentemente no están relacionadas y que son variables para los individuos afectados. Por otra parte, los estudios realizados indican que frecuentemente, en la determinación genética de las malformaciones participan varios genes y las interacciones de éstos con el ambiente, aunque determinaciones monogénicas se han podido establecer para unos pocos casos. Ilustramos aquí estos dos tipos contrastantes de determinación genética, a través de la descripción de los factores genéticos que estarían involucrados en los defectos del tubo neural y en el síndrome de CHARGE, respectivamente.
Developmental defects may be due to congenital malformations, deformations or disruptions; 10% of malformations are caused by environmental factors, 25% by genetics factors and 65% are due to unknown multifactorial problems. There is a developmental period of greater susceptibility to teratogens, which corresponds to the stages when most organs and systems are being formed. Ingestions of teratogenics plants may result in congenital anomalies in animal foetuses. Pesticide such as DDT, water contamination with the Hg and the endocrine disrupters affect embryogenesis of different animal species. As factors that provoke malformations there are environmental agents, infections and some drugs. Physical agents such as increased temperature, hypoxic conditions and radiation, affect different organisms from fishes to human. Genetic of malformations have been difficult to establish, mainly because most of them are characterized by diverse phenotypic aspects, apparently not related and variable for the different affected organisms. On the other hand, studies realized indicate that frequently in the genetic determination of malformations several genes and their interactions with the environment are involved, although it has been possible to establish monogenic determination for a few cases. Here we contrast these two types of genetic determination, describing the genetic factors involved in the neural tube defects and the CHARGE syndrome, respectively.
Assuntos
Anormalidades Congênitas/genética , Meio Ambiente , Síndrome CHARGE/genética , Defeitos do Tubo Neural/genéticaRESUMO
Objetivo: Describir la epidemiologia local y la experiencia en el manejo de casos de atresia de coanas con la técnica de cirugía endoscópica transnasal e instrumental de poder. Diseño: Estudio retrospectivo. Metodología: Se toman 16 casos con diagnóstico de atresia de coanas, en los que fueron consideradas variables clínicas, método diagnóstico, lateralidad, tipo de atresia, manejo inicial y técnica quirúrgica. Se realizó análisis estadístico en Stata, versión 11.1. Resultados: En esta serie de casos, diez eran mujeres y seis hombres, con una relación mujer-hombre de 1,7:1; 56% de ellos fueron bilaterales, 56% de presentaron anomalías congénitas y la edad al diagnóstico fue postneonatal en el 81%. No se encontró asociación estadística entre sexo, tipo de atresia y lateralidad. El principal método diagnóstico fue la tomografía axial computarizada, en el 87,6% de los estudios. El 94% de los pacientes presentaron buen resultado quirúrgico funcional con la técnica endoscópica
Objective: Describe the local epidemiology and the experience in the management of choanal atresia with endoscopic transnasal approach and power instruments. Methodology: Retrospective study of 16 cases with diagnosis of choanal atresia was considered variable clinics, diagnosis method, laterality, type of atresia, initial management and surgical technique. We performed statistical analysis in Stata, version 11.1. Results: In this series of cases, 10 was women and 6 was men, relation 1,7:1; 56% had associated congenital anomalies, the age of diagnosis was post neonatal 81%. There was no statistical association between sex, type of atresia and latelality. The main method diagnosis was the TAC in 87.6%. 94% of the patients showed a good surgical outcome with functional endoscopic technique. Conclusions: The experience observed in this series of cases with the use of technique endoscopic transnasal and power instrumentation (Shaver - Drill), represent a form of technique minimal invasive approach for this type of nasal congenital pathology with low degree of morbility, complications and excellent functional results
Assuntos
Humanos , Atresia das Cóanas , Nasofaringe , Síndrome CHARGERESUMO
CHARGE syndrome is a congenital malformation disorder that includes Coloboma, Heart defect, Atresia of the choanae, Retarded growth and development, Genital hypoplasia, and Ear abnormalities. Recently hypogonadotropic hypogonadism and abnormal olfactory bulb development are occasionally described in CHARGE syndrome with chromodomain helicase DNA-binding protein 7 (CHD7) gene mutation. We report the case of Korean female patient with CHARGE syndrome and CHD7 mutation who had hypogonadotropic hypogonadism and abnormal olfactory bulb as manifested by delayed puberty and growth retardation at 13 years of age. She had both optic nerve coloboma, external ear abnormalities and bilateral agenesis of the semicircular canals. She had severe mental retardation and autistic-like behavior. We identified a heterozygous nonsense mutation at exon 20 of the CHD7 gene (c.4601G>A; Trp1534X).