Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 1.798
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-781304


OBJECTIVE@#To explore the genetic basis of a pedigree affected with hereditary spherocytosis.@*METHODS@#Peripheral blood samples were collected from 17 members of the pedigree. Genomic DNA of the proband was subjected to next generation sequencing. Candidate variant was validated by co-segregation analysis. pCAS2(c.5798+1G) and pCAS2(c.5798+1A) plasmids were constructed by homologous recombination and transfected into 293T cells. Reverse transcription PCR, TA cloning and Sanger sequencing were used to analyze the effect of candidate variant on splicing. Meanwhile, peripheral blood RNAs were extracted to analyze the effect of candidate variant on splicing in vivo.@*RESULTS@#The proband was found to carry a c.5798+1G>A variant of the SPTB gene. The variant has co-segregated with the phenotype in the pedigree. In vitro and in vivo splicing experiments confirmed that the mutation has significantly affected the splicing, resulting in shift of reading frame and produced a premature termination codon.@*CONCLUSION@#The novel c.5798+1G>A variant of the SPTB gene probably underlies the pathogenesis of hereditary spherocytosis in this pedigree.

Códon sem Sentido , Genética , Variação Genética , Células HEK293 , Humanos , Mutação , Genética , Linhagem , Plasmídeos , Processamento de RNA , Espectrina , Genética , Esferocitose Hereditária , Genética , Transfecção
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-781302


OBJECTIVE@#To explore the genetic etiology of a pedigree affected with Norrie disease.@*METHODS@#Four individuals from the core family of the proband were subjected to whole exome sequencing in order to identify the pathological variant. Sanger sequencing was used to verify the finding among 7 additional members from the pedigree.@*RESULTS@#The proband and other 3 male patients have all carried a hemizygote c.361C>T (p.Arg121Trp) missense variant of the NDP gene, for which his mother, grandmother and two younger female cousins were heterozygous carriers. The same variant was not detected among unaffected males. Above results conformed to a X-linked recessive pattern of inheritance.@*CONCLUSION@#The missense variant c.361C>T of the NDP gene probably underlies the Norrie disease in this pedigree.

Cegueira , Genética , Proteínas do Olho , Genética , Feminino , Doenças Genéticas Ligadas ao Cromossomo X , Genética , Humanos , Masculino , Proteínas do Tecido Nervoso , Genética , Doenças do Sistema Nervoso , Genética , Linhagem , Degeneração Retiniana , Genética , Espasmos Infantis , Genética
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-781293


OBJECTIVE@#To explore the molecular basis for a pedigree affected with May-Hegglin anomaly (MHA).@*METHODS@#Peripheral blood samples were collected and subjected to DNA extraction. Exons 1, 10, 16, 24, 25, 26, 30, 31, 33, 38 and 40 and flanking sequences of the MYH9 gene were subjected to PCR amplification and Sanger sequencing. Changes in protein expression were determined by an indirect immunofluorescence assay. Platelet aggregation function of the proband was assessed by thromboelastogram.@*RESULTS@#The proband and his second son both carried a heterozygous 5521G>A (GAG to AAG) missense variant in exon 38 of the MYH9 gene, leading to p.Glu1841Lys substitution at position 1841 of amino acid sequence. Immunofluorescence showed inclusions containing NMMHC-II A. Thromboelastogram suggested enhanced platelet aggregation function of the proband.@*CONCLUSION@#The c.5521G>A variant of MYH9 gene has co-segregated with the phenotype of MHA in this pedigree. To assess the aggregation function of platelet by thromboelastogram can predict the risk of bleeding in MHA patients.

Perda Auditiva Neurossensorial , Genética , Humanos , Masculino , Mutação , Cadeias Pesadas de Miosina , Genética , Linhagem , Trombocitopenia , Genética
Arch. argent. pediatr ; 117(6): 684-687, dic. 2019. tab
Artigo em Espanhol | LILACS (Américas), BINACIS | ID: biblio-1051382


La xerocitosis hereditaria es un desorden poco frecuente causado por defectos en la permeabilidad eritrocitaria, que se caracteriza por anemia hemolítica de gravedad variable y sobrecarga de hierro. El diagnóstico suele ser tardío y confundirse con otras anemias hemolíticas, lo que puede llevar a indicaciones de procedimientos, como la esplenectomía, contraindicados en estos pacientes. Se reportan las características clínicas, hematológicas y moleculares de dos pacientes pediátricos no relacionados con diagnóstico de xerocitosis hereditaria. Ambos presentaban eritrocitos deshidratados con alta concentración de hemoglobina corpuscular media, frotis no patognomónico, marcadores de hemólisis y una curva de fragilidad osmótica resistente. El diagnóstico se confirmó por la secuenciación del gen PIEZO.Se resalta la importancia de reconocer la causa de la anemia hemolítica para dar un enfoque terapéutico preciso y dar adecuado consejo genético

Hereditary xerocytosis is a rare disorder caused by defects of red blood cell permeability that are characterized by hemolytic anemia of variable degree and iron overload. Diagnosis is usually late and confused with other hemolytic anemias, which can lead to procedural indications, such as splenectomy, contraindicated in these patients. We report the clinical, haematological, and molecular characteristics of two patients from two unrelated families affected by hereditary xerocytosis. Both patients had dehydrated erythrocytes with a high concentration of mean corpuscular hemoglobin, non-pathognomonic smears, markers of hemolysis and a resistant osmotic fragility curve. The diagnosis was confirmed by the sequencing of the PIEZO gene. We emphasize the importance of recognizing the cause of hemolytic anemia to give an accurate therapeutic approach and give adequate genetic counseling.

Humanos , Masculino , Feminino , Criança , Adolescente , Hidropisia Fetal/diagnóstico , Anemia Hemolítica Congênita/diagnóstico , Mutação , Linhagem , Hemoglobinas/análise , Sobrecarga de Ferro , Índices de Eritrócitos , Anemia Hemolítica Congênita/complicações , Anemia Hemolítica Congênita/genética , Anemia Hemolítica Congênita/sangue , Icterícia Neonatal
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-819038


OBJECTIVE@#To analyze clinical and genetic features of a family affected with Van der Woude syndrome.@*METHODS@#The umbilical cord blood of the proband and the peripheral blood of the parents were used for the whole exon sequencing to find the candidate gene.Peripheral blood of 9 members of the family were collected for Sanger sequencing verification, bioinformatics analysis and genotype-phenotype correlation analysis.@*RESULTS@#The proband was diagnosed with cleft lip and palate by ultrasound. His father and grandmother had hollow lower lip and all other family members did not have the similar phenotype. A missense c.263A>G (p.N88S) mutation was found in exon 4 of gene in the proband, his father and his grandmother.The mutation was not found in other family members.@*CONCLUSIONS@#A missense c.263A>G (p.N88S) mutation in gene probably underlies the pathogenesis of Van der Woude syndrome in the family and the mutation has been firstly discovered in China.

Anormalidades Múltiplas , Genética , China , Fenda Labial , Diagnóstico por Imagem , Genética , Fissura Palatina , Diagnóstico por Imagem , Genética , Cistos , Genética , Feminino , Humanos , Fatores Reguladores de Interferon , Genética , Lábio , Anormalidades Congênitas , Masculino , Mutação , Linhagem , Ultrassonografia
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-772120


OBJECTIVE@#To investigate the molecular genetic mechanism of Charcot- Marie-Tooth (CMT) disease in a pedigree.@*METHODS@#Genomic DNA was extracted from the peripheral blood of the family members of a pedigree with autosomal dominant CMT disease, and 65 candidate genes of the proband were screened using target exon capture and the next generation sequencing, and the suspicious genes were verified using Sanger sequencing. PolyPhen-2, PROVEAN and SIFT software were used to predict the function of the mutant genes, and PyMOL-1 software was used to simulate the mutant protein structure.@*RESULTS@#A heterozygous missense mutation [c.371A>G (p.Y124C)] was detected in exon 3 of gene of the proband. This heterozygous mutation was also detected in both the proband's mother and her brother, but not in her father. Multiple sequence alignment analysis showed that tyrosine at codon 124 of GDAP1 protein was highly conserved. All the 3 prediction software predicted that the mutation was harmful. Molecular structure simulation showed a weakened interaction force between the amino acid residues at codon 124 and the surrounding amino acid residues to affect the overall stability of the protein.@*CONCLUSIONS@#The mutation of gene may be related to the pathogenesis of autosomal dominant AD-CMT in this pedigree. The newly discovered c.371A>G mutation (p.Y124C) expands the mutation spectrum of gene, but further study is needed to clarify the underlying pathogenesis.

Aminoácidos , Doença de Charcot-Marie-Tooth , Genética , Feminino , Genes Dominantes , Genética , Heterozigoto , Sequenciamento de Nucleotídeos em Larga Escala , Métodos , Humanos , Masculino , Mutação de Sentido Incorreto , Proteínas do Tecido Nervoso , Genética , Linhagem , Software
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-772030


OBJECTIVE@#To identify pathogenic mutation in a pedigree affected with brachydactyly and obesity.@*METHODS@#Peripheral blood sample was collected for extraction of genomic DNA. Exons capture combined with next generation sequencing (NGS) was carried out to identify potential mutation. Sanger sequencing was used to verify the results.@*RESULTS@#NGS has identified a novel heterozygous missense mutation (c.125A>C, p.Gln42Pro) in the exon 1 of PTHLH gene. The result was verified by Sanger sequencing. The mutations was derived from his mother. His uncle and sister have also carried the same heterozygous mutation.@*CONCLUSION@#A novel mutation of the PTHLH gene has been identified in a pedigree affected with brachydactyly type E2 and obesity.

Braquidactilia , Análise Mutacional de DNA , Humanos , Mutação , Obesidade , Linhagem
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-772013


OBJECTIVE@#To determine the nature and origin of aberrant chromosomes in a child with multiple anomalies and psychomotor retardation.@*METHODS@#Routine G-banding was carried out to analyze the karyotypes of the patient and his parents, and next generation sequencing for copy number variations (CNV-seq) was used for the fine mapping of the aberrant chromosomal regions.@*RESULTS@#The proband and his uncle exhibited psychomotor retardation, craniofacial malformation, infantile external genitalia, and concealed penis. Cytogenetic analysis indicated that the child has a 46,XYqh+,+(9),t(9;13)(q13;q12),pat,-13 karyotype. His uncle was XYqh+,+(9),t(9;13)(q13;q12)mat,-13, his father was 46,XYqh+,t(9;13)(q13;q12)mat, his grandmother was 46,XX,t(9;13)(q13;q12), and his grandfather was 46,XYqh+. The result of CNV-seq assay for the child was 46,XY,+9p(pter-p13.2,-40 Mb×3). No deletion was detected.@*CONCLUSION@#The partial trisomy 9 and partial monosomy 13 probably underlie the phenotypic abnormalities in the child. Combined chromosomal karyotyping and DNA sequencing can facilitate delineation of the nature and origin of the aberrant chromosomes.

Anormalidades Múltiplas , Criança , Deleção Cromossômica , Cromossomos Humanos Par 13 , Cromossomos Humanos Par 9 , Variações do Número de Cópias de DNA , Humanos , Cariotipagem , Masculino , Monossomia , Linhagem , Translocação Genética , Trissomia
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-772012


OBJECTIVE@#To explore the genetic basis for a pedigree affected with X-linked mental retardation.@*METHODS@#The proband was subjected to chromosomal karyotyping, FMR1 mutation testing and copy number variation analysis with a single nucleotide polymorphism microarray (SNP array). His family members were subjected to multiplex ligation-dependent probe amplification (MLPA) assaying. Expression of genes within the repeated region were analyzed.@*RESULTS@#The proband had a normal chromosomal karyotype and normal number of CGG repeats within the FMR1 gene. SNP array identified a 370 kb duplication in Xq28 (ChrX: 153 027 633-153 398 515), which encompassed 14 genes including MECP2. The patient was diagnosed as Lubs X-linked mental retardation syndrome (MRXSL). MLPA confirmed the presence of copy number variation, its co-segregation with the disease, in addition with the carrier status of females. Genes from the duplicated region showed higher levels of expression (1.79 to 5.38 folds) within peripheral blood nucleated cells of the proband.@*CONCLUSION@#The patients were diagnosed with MRXSL. The expression of affected genes was up-regulated due to the duplication. Genetic counseling and prenatal diagnosis may be provided based on the results.

Variações do Número de Cópias de DNA , Feminino , Proteína do X Frágil de Retardo Mental , Humanos , Retardo Mental Ligado ao Cromossomo X , Proteína 2 de Ligação a Metil-CpG , Linhagem , Gravidez
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-772010


OBJECTIVE@#To detect pathogenic mutation of DOCK6 gene in a patient with convulsive seizure and refractory epilepsy.@*METHODS@#CytoScan HD-Array and next generation sequencing were used to detect the potential mutation in the patient.@*RESULTS@#The proband has carried compound heterozygous mutations of c.188C>T (p.Arg63Gln) and c.5374C>T (p.Glu1792Lys) of the DOCK6 gene, which were respectively inherited from his mother and father. Neither mutation was reported previously. Bioinformatic analysis indicated that the two amino acids are highly conserved. Based on the ACMG guidelines, the c.188C>T mutation was predicted to be likely pathogenic, while the c.5374C>T mutation was of uncertain significance.@*CONCLUSION@#The compound heterozygous mutations of c.188C>T (p.Arg63Gln) and c.5374C>T (p.Glu1792Lys) of the DOCK6 gene probably underlie the disease in this patient.

Criança , Diabetes Mellitus Tipo 2 , Displasia Ectodérmica , Genética , Fatores de Troca do Nucleotídeo Guanina , Genética , Humanos , Deformidades Congênitas dos Membros , Genética , Mutação , Linhagem , Dermatoses do Couro Cabeludo , Genética
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-772009


OBJECTIVE@#To identify the mutation type of non-muscle myosin heavy chain 9 (MYH9) gene and investigate the clinical features of a pedigree affected with MYH9 gene-related disease.@*METHODS@#Peripheral blood samples of the proband and his family members were collected. Routine blood tests were performed, which included platelet counting and Wright's staining to observe the granulocyte inclusions and giant platelets. PCR was used to amplify exons 2, 17, 27, 31, 39 and 41 of the MYH9 gene, and the mutation site was determined by Sanger sequencing.@*RESULTS@#All patients from the pedigree presented a typical triad of thrombocytopenia, giant platelets, and inclusion bodies in leukocytes. In addition, two patients had nephritis and cataract. All affected members carried a heterozygous missense mutation of c.5521G>A (p.glu1841Lys) in exon 39 of the MYH9 gene. The same mutation was not found among healthy members of the pedigree and the controls.@*CONCLUSION@#The c.5521G>A (p.Glu1841Lys) mutation in the MYH9 gene probably underlies the MYH9-related disease in this pedigree.

Feminino , Testes Genéticos , Humanos , Masculino , Proteínas Motores Moleculares , Genética , Mutação , Cadeias Pesadas de Miosina , Genética , Linhagem , Trombocitopenia
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-772008


OBJECTIVE@#To explore the genetic cause for a child with congenital ichthyosis.@*METHODS@#The child was subjected to next generation sequencing using a specific gene panel. Suspected mutation was validated by Sanger sequencing.@*RESULTS@#The proband was found to harbor compound heterozygous mutations c.327delG (p.Met109Ilefs*2) and c.791G>A (p.Arg264Gln) of the TGM1 gene, which were respectively inherited from his mother and father. The same mutations were not found among 101 healthy controls. c.327delG was not reported previously. By bioinformatic analysis, both mutations are likely to impair the function of TGase-1 protein.@*CONCLUSION@#The compound heterozygous mutations of c.327delG and c.791G> A of the TGM1 gene probably underlie the ichthyosis in the proband. The result has facilitated prenatal diagnosis for this pedigree.

Feminino , Humanos , Eritrodermia Ictiosiforme Congênita , Genética , Recém-Nascido , Mutação , Linhagem , Fenótipo , Gravidez , Transglutaminases , Genética
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-772006


OBJECTIVE@#To identify potential mutations of F11 gene in a pedigree affected with hereditary coagulation factor XI (FXI) deficiency and explore its molecular pathogenesis.@*METHODS@#Prothrombin time (PT), activated partial thromboplastin time (APTT), fibrinogen (FIB), coagulation factor VIII activity (FVIIIC), coagulation factor IX activity (FIXC), coagulation factor XI activity (FXIC), coagulation factor XII activity (FXIIC) and lupus anticoagulation (LA) of the proband and eight family members were determined. FXI antigen (FXIAg) was determined by enzyme-linked immunosorbent assay (ELISA). For the proband, potential mutations in the exons, flanking introns and 5'-, 3'-untranslated regions of the F11 gene were screened by direct DNA sequencing. The results were confirmed by reverse sequencing. Suspected mutations were detected in other family members. ClustalX-2.1-win and four online bioinformatic tools (PolyPhen-2, PROVEAN, SIFT, and Mutation Taster) were used to study the conservation and possible impact of the mutations. The structure of the mutational sites was processed with Swiss-PdbViewer.@*RESULTS@#The propositus had prolonged APTT (69.6 s), whose FXIC and FXIAg were reduced to 6.0% and 10.7%, respectively. Her mother, elder sister, one younger sister, little brother, daughter and son showed slightly prolonged APTT and moderate FXIC and FXIAg levels. Gene sequencing revealed that the propositus carried a heterozygous nonsense mutation c.738G>A (p.Trp228stop) in exon 7 and a heterozygous mutation c.1556G>C (p.Trp501Ser) in exon 13. Her mother, elder sister and daughter were heterozygous for the p.Trp228stop mutation, while one younger sister and little brother and son were heterozygous for p.Trp501Ser. Her husband and the youngest sister were of the wild type. Phylogenetic analysis suggested that Trp501 was highly conserved among all homologous species. The p.Trp501Ser was predicted to be "probably damaging","deleterious", "affect protein function" and "disease causing" corresponding to PolyPhen-2, PROVEAN, SIFT and Mutation Taster. Model analysis demonstrated that the non-polar Trp501 has two benzene rings, forming a hydrogen bond with Gln512 in the wild type. Once substituted by Ser501, the side chain may form another hydrogen bond with the benzene of His396. This may affect the normal space conformation and stability of FXI protein.@*CONCLUSION@#The compound heterozygous mutations of the F11 gene probably accounted for the low FXI concentration in this pedigree.

Fator XI , Genética , Deficiência do Fator XI , Genética , Feminino , Heterozigoto , Humanos , Masculino , Mutação , Linhagem , Filogenia
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-771999


OBJECTIVE@#To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).@*METHODS@#Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.@*RESULTS@#Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.@*CONCLUSION@#Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.

Análise Mutacional de DNA , Feminino , Humanos , Mutação , Linhagem , Rim Policístico Autossômico Dominante , Gravidez , Diagnóstico Pré-Natal , Canais de Cátion TRPP
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-771993


OBJECTIVE@#To explore the genetic etiology of two pedigrees affected with congenital arthrogryposis.@*METHODS@#Whole exome sequencing (WES) was used to screen potential variations in the proband. Suspected variations were analyzed with bioinformatics software and validated by Sanger sequencing.@*RESULTS@#A heterozygous c.1123G>A (p.Glu375Lys) variation was detected in the proband and an affected fetus from pedigree 1, while a de novo heterozygous c.118 G>A (p.Val40Met) variation was detected in an affected fetus from pedigree 2.@*CONCLUSION@#The two heterozygous variations of the MYH3 gene probably underlie the disease in the pedigrees. Above results have facilitated genetic counseling and prenatal diagnosis.

Artrogripose , Proteínas do Citoesqueleto , Genética , Feminino , Heterozigoto , Humanos , Mutação , Linhagem , Gravidez , Diagnóstico Pré-Natal , Sequenciamento Completo do Exoma
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-771992


OBJECTIVE@#To detect EXT1 and EXT2 gene mutations in two pedigrees affected with hereditary multiple exostosis (HME).@*METHODS@#The coding regions and exon/intron boundaries of the EXT1 and EXT2 genes were analyzed by targeted next-generation sequencing (NGS). Suspected mutations were confirmed by Sanger sequencing of the probands, their family members and 200 unrelated healthy controls. Gross deletion was confirmed by quantitative PCR (qPCR) analysis and multiple ligation-dependent probe amplification (MLPA) analysis.@*RESULTS@#Two mutations were detected in the pedigrees, which included EXT2 gene c.337_338insG mutation in pedigree 1 and deletion of entire EXT1 in pedigree 2. Analysis of sequencing data revealed that a novel heterozygous mutation (c.337_338insG) in EXT2 gene in proband 1 and his father. The same mutation was not found among healthy family members and 200 unrelated healthy controls. As shown by NGS and MLPA analysis, proband 2 carried a heterozygous deletion of entire EXT1 gene. The same deletion was also found in her mother by qPCR.@*CONCLUSION@#Mutations of the EXT1 and EXT2 genes probably underlie the HME in both pedigrees. NGS combined with Sanger sequencing, qPCR and MLPA is effective for attaining the diagnosis.

Análise Mutacional de DNA , Exostose Múltipla Hereditária , Genética , Feminino , Humanos , Mutação , N-Acetilglucosaminiltransferases , Genética , Linhagem
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-771991


OBJECTIVE@#To report on the clinical pictures of 7 patients from a pedigree affected with X-linked adrenal hypoplasia congenita (XL-AHC) and hypogonadotropic hypogonadism (HH) and the underlying mutations.@*METHODS@#Seven patients were identified from a four-generation pedigree affected with XL-AHC and HH. Their clinical features, endocrinological changes, treatment and drug response were recorded. The patients were subjected to next-generation sequencing, and the result was verified by Sanger sequencing. PolyPhen-2 was used for predicting the influence of the mutation on protein production.@*RESULTS@#Three deceased patients had manifested adrenal insufficiency (AI) within one year after birth. Two died at 6 and one died at 12. The four survivors presented with salient clinical and endocrinological features of AHC and HH, adrenal and testicular atrophy, and renin-angiotensin compensation. Two adult patients had testicular micro-stone detected by ultrasound.One of them also had remarkable seminiferous tubule degeneration by biopsy. The patients were followed up for 0.5 to 10 years. All required hyper-physiological dose of hydrocortisone to stabilize their clinical condition. In three patients, gonadotropic or androgen replacement induced cardinal masculine development but with unsatisfactory testis growth and sperm production.Genetic analysis revealed a novel missense c.827A>C (p.Q276P) mutation in a hotspot region within a highly conserved domain. PolyPhen-2 predicted the mutation to be highly hazardous.@*CONCLUSION@#The novel p.Q276P mutation of the DAX1 gene probably underlies the XL-AHC and HH in this pedigree with variable clinical presentations in the patients.

Insuficiência Adrenal , Receptor Nuclear Órfão DAX-1 , Genética , Humanos , Hipoadrenocorticismo Familiar , Genética , Masculino , Mutação , Mutação de Sentido Incorreto , Linhagem , Proteínas Repressoras
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wprim-771990


OBJECTIVE@#To detect mutation of NDP gene in a pedigree affected with Norrie disease.@*METHODS@#Sanger sequencing was used to analyze the NDP gene at Xp11.3. Prenatal diagnosis was performed on amniotic fluid sample after the causative gene was detected.@*RESULTS@#Sanger sequencing has revealed a c.2T>C (p.M1T) missense mutation of the NDP gene in the proband and the fetus. The same variation was not found in ClinVar and HGMD database.@*CONCLUSION@#The c.2T>C mutation of the NDP gene probably underlies the Norrie disease in this pedigree.

Cegueira , Proteínas do Olho , Feminino , Doenças Genéticas Ligadas ao Cromossomo X , Humanos , Proteínas do Tecido Nervoso , Doenças do Sistema Nervoso , Linhagem , Gravidez , Diagnóstico Pré-Natal , Degeneração Retiniana , Espasmos Infantis