ABSTRACT
Frogeye leaf spot, caused by Cercospora sojina Hara, is a foliar disease affecting soybean (Glycine max (L.) Merr.), often managed by applications of quinone outside inhibitor (QoI) fungicides. In 2013 and 2014, 634 C. sojina monoconidial isolates were collected from soybean fields throughout Mississippi. Initially, in vitro bioassays were performed to evaluate the sensitivity of 14 of 634 isolates plus a baseline. Resistant and sensitive isolates were characterized by determining the effective fungicide concentrations at which 50% of conidial germination was inhibited (EC50). The molecular mechanism of resistance was determined for all 634 isolates, using a PCR-RFLP method and comparing nucleotide sequences of the cytochrome b gene. The state of Mississippi was divided into five distinct geographical regions (the Hills, Delta, Pines, Capital, and Coast) based on estimates of total soybean hectares. The greatest proportion (16.7%) of QoI-sensitive isolates was collected in the Hills while the Coast had no QoI-sensitive isolates. QoI-sensitive isolates from the Pines, Capital, and Delta ranged from 1.6 to 7.0%. Results of this study determined that more than 93% of C. sojina isolates collected in Mississippi carried the G143A amino acid substitution, indicating a shift to a QoI-resistant population throughout Mississippi soybean fields.
ABSTRACT
A study, designed to gain some knowledge of viruses infecting native grapes in the southeastern United States, presently limited to a single paper (4), was initiated in spring of 2012. In the first phase of this investigation, 28 samples of muscadine (Vitis rotundifolia) and summer (V. aestivalis) grapes were collected from different locations in Mississippi (MS) and the Great Smoky Mountains National Park (GSMNP) and were analyzed for the presence of dsRNAs. A muscadine sample of cv. Burgaw (MS-07) from an experimental field in southern MS and a sample of summer grape from GSMNP (GSM-1) contained similar patterns of multiple dsRNA bands reminiscent of closterovirus infections. These dsRNAs were reverse transcribed and subjected to PCR with taxon-specific degenerate primers targeting HSP70h gene of closterovirids as described (5). DNA bands of ~600 bp, amplified from both samples, were cloned and sequenced. Pairwise comparisons showed that two viruses share 75% common nucleotides (nt) and 82% amino acids (aa) in the genome portion sequenced. Comparisons with available sequences in NCBI/GenBank revealed that these viruses are distinct isolates of Grapevine leafroll-associated virus 2 (GLRaV-2). GLRaV-2 is known to occur as divergent molecular variants characterized by different pathological effects on specific indicators ranging from leafroll to graft incompatibility (2). The GSM-1 isolate was most closely related to Red Globe isolate of GLRaV-2 (GLRaV-2RG; AF314061), reported to induce graft incompatibility (1), with 87% identical nt (95% aa). However, isolate MS-07 was most closely related (96% nt and 97% aa identity) to leafroll-inducing isolate 93/955 (GLRaV-2 93/955; NC_007448.1) (3). Virus-specific DIG labeled probe produced strong hybridization signals with nucleic acids extracted from MS07 and GSM-1 and blotted onto a positively charged membrane, thus confirming GLRaV-2 infections. No signal could be observed in negative controls. Finally, a set of GLRaV-2 specific primers (LR-2F: 5'TCGGCGTACATCCCAACTTAC3' and LR-2R: 5'CTGAGTGAAACGCACTGATC3'), designed to amplify a 422-bp-long PCR product, was applied in one-step RT-PCR tests performed on total nucleic acid extracts from additional 65 samples (60 muscadines and five summer grapes). GLRaV-2 was found in an additional four samples of muscadines (cvs. Burgaw and Hunt and two samples of an unknown cultivar) collected in MS and in one sample of summer grape collected 200 m away from the original source in GSMNP. As further ascertained, all GLRaV-2 isolates from muscadines belonged to "93/955 subgroup," whereas the additional isolate from summer grape shared 98% identical nt with the isolate GSM-1. No specific symptoms could be associated with the presence of GLRaV-2 in summer grapes or muscadines. This is the first report of GLRaV-2 in muscadines and summer grapes in the United States. Furthermore, the occurrence of GLRaV-2 in summer grapes in a natural ecosystem and in muscadines in Mississippi where there is no sizable V. vinifera industry provides important clues on ecology and possible origin of this virus. References: (1) R. Alkowni et al. Virus Genes 43:102, 2011. (2) N. Bertazzon et al. Eur. J. Plant Pathol. 127:185, 2010. (3) B. Meng et al. Virus Genes 31:31, 2005. (4) S. Sabanadzovic et al. Virology 394:1, 2009. (5) T. Tian et al. Phytopathology 86:1167, 1996.
ABSTRACT
Virus-like symptoms were observed in several kudzu patches in Mississippi during a survey of viruses infecting soybean carried out in late summer/fall of 2013 as a part of a project funded by the Mississippi Soybean Promotion Board. Symptomatology consisted of chlorotic mottle and ringspots, vein-associated feathering, necrosis, and leaf deformation, which were often observed in combination on the same plant. In order to identify the virus(es) involved in the disease, young leaves from a symptomatic kudzu sample collected in Kemper County were crushed in 10 volumes of 0.1 M phosphate buffer (pH 7.2) and mechanically inoculated onto celite-dusted leaves of two soybean varieties (Asgrow AG4605 and AG4730), each represented by 10 plants. Sap from an asymptomatic kudzu sample from Oktibbeha County was used as a control. Both varieties reacted by systemic mottle, stunting, and apical leaf necrosis approximately 2 weeks after inoculation, while no symptoms could be observed in controls. Partially purified preparations from both symptomatic soybean cultivars exhibited the presence of putative intact and empty spherical virus particles ~30 nm in diameter. ELISA tests with antisera to several soybean viruses were performed on the original kudzu sample and inoculated AG4605 and AG4730 soybean plants. These tests revealed the presence of Tobacco ringspot virus (TRSV) in all symptomatic samples. In order to better understand the incidence of this virus in kudzu in Mississippi, a total of 127 samples from 28 counties were collected during October 2013 and tested using ELISA. A total of 11 samples collected in 8 different counties were positive for TRSV. To further confirm these results, one step RT-PCR test was performed on total nucleic extracts from all ELISA-positive and four negative kudzu samples using TRSV-specific primers (3). A specific PCR product of 766 bp was present in all ELISA-positive samples and positive controls, whereas no visible bands were present in negative samples. PCR products generated from samples, collected in Kemper, Tippah, and Jefferson Davis counties, were cloned and custom sequenced. Pair-wise comparisons indicated conserved nucleotide (95 to 98%) and amino acid (98 to 99%) contents among sequenced products. Kudzu isolates from Mississippi shared 91 to 96% and 98 to 99% conserved nucleotides and amino acids, with TRSV sequences currently available in the NCBI/GenBank database. This is the first report of TRSV infection of kudzu in Mississippi. The possible implications to the soybean industry are yet to be determined since kudzu occupies approximately 202,000 ha in Mississippi and TRSV has historically been reported associated with bud blight in soybean (1). Nonetheless, results of our study, along with the recent report from Louisiana (2), strongly suggest that kudzu, due to its widespread distribution in the region, may represent a major reservoir of TRSV in the southeastern United States. References: (1) G. L. Hartman et al. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN, 1999. (2) Khankhum et al. Plant Dis. 97:561, 2013. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010.
