Characterization of a Putative New Member of the Genus Potyvirus from Kudzu (Pueraria montana var. lobata) in Mississippi.

Kudzu (Pueraria montana var. lobata), a plant native to Southeastern Asia, has become a major noxious weed covering millions of hectares in the Southern United States. A kudzu patch displaying virus-like symptoms located in Ackerman, northeastern Mississippi (MS), was used as a source for virus isolation and characterization involving mechanical and vector transmission, ultrastructural observation, surveys, Sanger and high-throughput genome sequencing, and sequence analyses. The results revealed the presence of a new potyvirus in infected kudzu, closely related to wisteria vein mosaic virus (WVMV) and provisionally named kudzu chlorotic ring blotch virus (KudCRBV). Genome features and pairwise comparison with six WVMV genomes currently available in GenBank and three additional isolates from MS sequenced in this work suggest that KudCRBV is likely a member of a new species in the genus Potyvirus. Furthermore, under experimental conditions, KudCRBV was successfully transmitted by cotton and potato aphids and mechanically to soybean and beans. A state-wide survey revealed several kudzu patches infected by the virus in northern MS.

Discovery and Analyses of Caulimovirid-like Sequences in Upland Cotton (Gossypium hirsutum).

Analyses of Illumina-based high-throughput sequencing data generated during characterization of the cotton leafroll dwarf virus population in Mississippi (2020-2022) consistently yielded contigs varying in size (most frequently from 4 to 7 kb) with identical nucleotide content and sharing similarities with reverse transcriptases (RTases) encoded by extant plant pararetroviruses (family Caulimoviridiae). Initial data prompted an in-depth study involving molecular and bioinformatic approaches to characterize the nature and origins of these caulimovirid-like sequences. As a result, here, we report on endogenous viral elements (EVEs) related to extant members of the family Caulimoviridae, integrated into a genome of upland cotton (Gossypium hirsutum), for which we propose the provisional name "endogenous cotton pararetroviral elements" (eCPRVE). Our investigations pinpointed a ~15 kbp-long locus on the A04 chromosome consisting of head-to-head orientated tandem copies located on positive- and negative-sense DNA strands (eCPRVE+ and eCPRVE-). Sequences of the eCPRVE+ comprised nearly complete and slightly decayed genome information, including ORFs coding for the viral movement protein (MP), coat protein (CP), RTase, and transactivator/viroplasm protein (TA). Phylogenetic analyses of major viral proteins suggest that the eCPRVE+ may have been initially derived from a genome of a cognate virus belonging to a putative new genus within the family. Unexpectedly, an identical 15 kb-long locus composed of two eCPRVE copies was also detected in a newly recognized species G. ekmanianum, shedding some light on the relatively recent evolution within the cotton family.

Defining Fungicide Resistance Mechanisms in the Corynespora cassiicola Population from Mississippi Soybean.

Target spot, caused by Corynespora cassiicola, is a common lower canopy soybean disease in the southern United States. Recently, target spot has resurged in importance especially following the identification of resistance to the quinone outside inhibitor (QoI) fungicides. As a result, a survey of C. cassiicola from soybean throughout Mississippi began in 2018. A total of 819 C. cassiicola monoconidial isolates were obtained from 228 fields in 75 counties. The molecular mechanism of QoI resistance was determined, which resulted from an amino acid substitution from glycine (G) to alanine (A) at position 143 using a PCR-RFLP method and comparing nucleotide sequences of the cytochrome b gene. Five previously defined geographic regions were used to present the distribution of the G143A substitution and included the Capital, Coast, Delta, Hills, and Pines. The Capital had the greatest proportion of G143A-containing isolates (95.0%), followed by the Coast (92.9%), Delta (89.8%), Pines (78.8%), and Hills (69.4%). In all, 85.8% of the C. cassiicola isolates carried the G143A substitution. In addition, the effective fungicide concentration (EC50) of randomly selected C. cassiicola isolates to azoxystrobin was used to characterize isolates as resistant (n = 14) (based on the presence of the G143A substitution and EC50 values >52 µg/ml) or sensitive (n = 11) (based on the absence of the G143A substitution and EC50 values <46 µg/ml). The EC50 values varied among isolates (P < 0.0001), with QoI-sensitive isolates exhibiting lower EC50 values than QoI-resistant isolates. The current study revealed that a reduction in sensitivity to QoI fungicides has likely resulted based on the percentage of C. cassiicola isolates containing the G143A substitution identified in Mississippi.

Evaluating In Vitro Fitness Parameters of G143A-Containing and Wild-Type Corynespora cassiicola Isolates from Mississippi Soybean.

Quinone outside inhibitor (QoI) fungicides have been widely used to manage diseases of soybean including target spot caused by Corynespora cassiicola. However, resistance to QoI fungicides has recently been reported within the C. cassiicola population from Alabama, Arkansas, Mississippi, and Tennessee as a result of isolates in the population containing the G143A amino acid substitution. Therefore, the relative fitness and stability of isolates containing the G143A substitution compared with wild-type C. cassiicola isolates from Mississippi soybean were investigated by analyzing several fitness parameters in vitro. In addition, in vivo virulence assays were conducted in the greenhouse on a target spot-susceptible cultivar. The evaluations of fitness considered the difference between isolates from the wild-type and G143A-containing genotypes by evaluating colony growth parameters following the first and the 10th subcultures on microbiological media. When considered as an average of all G143A-containing isolates, the G143A-containing isolates following the 10th subculture produced 6.2% greater colony diameter growth but produced 2.3% less conidia. Conversely, over the same period, wild-type isolates produced 6.7% less colony growth but produced 10.9% more conidia. Based on our results, the C. cassiicola isolates that contained the G143A substitution appear stable since successive subculturing did not significantly affect the measured fitness parameters. The lack of fitness cost accompanying the genotypic shift to the G143A amino acid substitution which confers fungicide resistance in C. cassiicola indicates that these isolates may have fitness advantages and may remain stable in the population as well as displace wild-type isolates with repeated fungicide applications of QoI-containing products.

First report of pothos latent virus infecting upland cotton (Gossypium hirsutum) in the United States.

Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al. 2016; Kumar et al. 2001). PoLV has not been previously reported on the American continent. During 2019, we carried out a state-wide, RT-PCR-based survey for cotton leafroll dwarf virus (CLRDV), as previously described (Aboughanem-Sabanadzovic et al. 2019). Plants exhibiting symptoms reported associated with CLRDV (Avelar et al. 2019) were collected from cotton fields throughout Mississippi. Samples consisted of individually bagged, six inch-long, apical portions collected from five to twelve cotton plants per field. At the end of the season, the total RNAs extracted from a subset of CLRDV-infected samples using a Spectrum RNA extraction kit (Sigma, St Louis, MO), were randomly selected for additional characterization by Illumina 150 nt paired-end high-throughput sequencing at the UIUC Core Sequencing Facility (University of Illinois, Urbana, IL). De novo assembly of 46 to 60 million raw reads/sample was performed by metaSPAdes (Nurk et al. 2017). In addition to several CLRDV-specific contigs, analyses of 184,173 contigs assembled from a sample collected in Clay County (lab code CL-112) revealed a large contig # 63556 of 4298 nt in size with identities ranging from 90.5% to 94.3% with three PoLV genome sequences available in GenBank, suggesting that an isolate of this virus (PoLV-cot; GenBank OP584699) was coinfecting the sample along with CLRDV. Sequence analyses showed that contig #63556 represents approx. 97-98% of the entire PoLV-cot genome. To verify HTS data, specific primers (PoLV-F 5'ACATATATCAGAGAGAGCTCAGGTC3' and PoLV-R 5'GCTCCCATGACAGACCTCACT3') were designed on conserved sequences of all four PoLV genomes and used in a single-tube RT-PCR. The initial tests on RNAs from CL-112 and six other samples from the same field confirmed PoLV-cot infections in the original and an additional cotton plant. Sanger sequencing of the two 294 bp-long RT-PCR products revealed >99% nt mutual identity and 97.5-99% with PoLV isolates. However, none of the additional 226 cotton samples collected in 2019 across the state of Mississippi and 12 samples collected in the same field in 2020 tested positive for PoLV-cot. At this moment, it is not clear whether the PoLV infections originated from infected seeds or, more likely, from soil-borne inoculum. Indeed, several aureusviruses are known to be transmitted by soil either involving vectors belonging to the fungal genera Olpidium and/or Polymyxa (i.e., cucumber leaf spot virus, maize white line mosaic virus), or in a vectorless manner (Rochon et al. 2012). Previous studies on this virus demonstrated low-rate experimental transmission through the soil with no apparent involvement of specific vectors (Chen et al. 2016; Kumar et al. 2001; Sabanadzovic et al. 1995). In summary, results of our study indicate an original report of PoLV on the North American continent, along with description of a new host. Possible impact of PoLV-cot on the cotton industry, or any other susceptible crop in the US, is yet to be understood. Funding: This work has been partially supported by financial support from Cotton Inc, Cotton Foundation, USDA-ARS 58-6066-9-033 and 2020 MAFES-SRI grants. NAS and SS acknowledge partial support from the National Institute of Food and Agriculture, US Department of Agriculture, Hatch Projects Numbers 7001412 and1021494, respectively. The author(s) declare no conflict of interest. 1. Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis 103: 1798. 2. Avelar, S., et al. 2019. Plant Dis 103: 592. 3. Chen, Y-K., et al. 2016. J Phytopath 164: 650. 4. Kumar, P.L., et al. 2001. Plant Dis 85: 208. 5. Martelli, G.P., et al. 1998. Arch Virol 143: 1847. 6. Nurk, S., et al. 2017. Genome Res 27: 824. 7. Rochon, D., et al. 2012. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam, NL, Elsevier Academic Press, pp 1111-1138. 8. Rubino, L., et al. 1995. J Gen Virol 76: 2835. 9. Sabanadzovic, S., et al.1995. Eur J Plant Pathol 101:171.

Identification and characterization of privet leaf blotch-associated virus, a novel idaeovirus.

A novel virus has been identified by next-generation sequencing (NGS) in privet (Ligustrum japonicum L.) affected by a graft-transmissible disease characterized by leaf blotch symptoms resembling infectious variegation, a virus-like privet disease with an unclear aetiology. This virus, which has been tentatively named 'privet leaf blotch-associated virus' (PrLBaV), was absent in non-symptomatic privet plants, as revealed by NGS and reverse transcription-polymerase chain reaction (RT-PCR). Molecular characterization of PrLBaV showed that it has a segmented genome composed of two positive single-stranded RNAs, one of which (RNA1) is monocistronic and codes for the viral replicase, whereas the other (RNA2) contains two open reading frames (ORFs), ORF2a and ORF2b, coding for the putative movement (p38) and coat (p30) proteins, respectively. ORF2b is very probably expressed through a subgenomic RNA starting with six nucleotides (AUAUCU) that closely resemble those found in the 5'-terminal end of genomic RNA1 and RNA2 (AUAUUU and AUAUAU, respectively). The molecular signatures identified in the PrLBaV RNAs and proteins resemble those of Raspberry bushy dwarf virus (RBDV), currently the only member of the genus Idaeovirus. These data, together with phylogenetic analyses, are consistent with the proposal of considering PrLBaV as a representative of the second species in the genus Idaeovirus. Transient expression of a recombinant PrLBaV p38 fused to green fluorescent protein in leaves of Nicotiana benthamiana, coupled with confocal laser scanning microscopy assays, showed that it localizes at cell plasmodesmata, strongly supporting its involvement in viral movement/trafficking and providing the first functional characterization of an idaeovirus encoded protein.

Genomic Characterization and Population Structure of a Badnavirus Infecting Blackberry.

Blackberry viruses are pervasive, decreasing growth, yield, and plant longevity. In a quest to identify viruses associated with blackberry yellow vein, a disease caused by virus complexes, a new double-stranded DNA virus, referred to as blackberry virus F (BVF), a putative member of the genus Badnavirus, family Caulimoviridae, was identified. The virus was found in both cultivated and wild blackberry samples collected from several states in the southern United States. Population structure, host range, and association with disease symptoms were assessed. As BVF integrates into the plant genome, it affects the production of virus-free propagation material, the cornerstone for certification programs.

Cucumis melo endornavirus: Genome organization, host range and co-divergence with the host.

A high molecular weight dsRNA was isolated from a Cucumis melo L. plant (referred to as 'CL01') of an unknown cultivar and completely sequenced. Sequence analyses showed that dsRNA is associated with an endornavirus for which a name Cucumis melo endornavirus (CmEV) is proposed. The genome of CmEV-CL01 consists of 15,078 nt, contains a single, 4939 codons-long ORF and terminates with a stretch of 10 cytosine residues. Comparisons of the putative CmEV-encoded polyprotein with available references in protein databases revealed a unique genome organization characterized by the presence of the following domains: viral helicase Superfamily 1 (Hel-1), three glucosyltransferases (doublet of putative capsular polysaccharide synthesis proteins and a putative C_28_Glycosyltransferase), and an RNA-dependent RNA polymerase (RdRp). The presence of three glycome-related domains of different origin makes the genome organization of CmEV unique among endornaviruses. Phylogenetic analyses of viral RdRp domains showed that CmEV belongs to a specific lineage within the family Endornaviridae made exclusively of plant-infecting endornaviruses. An RT-PCR based survey demonstrated high incidence of CmEV among melon germplasm accession (>87% of tested samples). Analyses of partial genome sequences of CmEV isolates from 26 different melon genotypes suggest fine-tuned virus adaptation and co-divergence with the host. Finally, results of the present study revealed that CmEV is present in plants belonging to three different genera in the family Cucurbitaceae. Such diverse host range is unreported for known endornaviruses and suggests a long history of CmEV association with cucurbits predating their speciation.

A Novel Ilarvirus Is Associated with Privet Necrotic Ringspot Disease in the Southern United States.

Necrotic ringspot disease (NRSD) is a graft-transmissible disorder of privet (synonym ligustrum), originally reported from Florida and Louisiana more than 50 years ago. In this communication we report an isometric virus isolated from Japanese privet (Ligustrum japonicum) collected in the southern United States displaying symptoms resembling those of NRSD. In mechanical transmission tests, the virus induced systemic infections in several herbaceous hosts. Double-stranded RNA analysis showed a pattern resembling replicative forms of members of the family Bromoviridae. The genome organization along with phylogenetic analyses and serological tests revealed that the virus belongs to subgroup 1 of the genus Ilarvirus. Pairwise comparisons with recognized ilarviruses indicated that the virus is a distinct, and as yet, undescribed member in the taxon, for which we propose the name Privet ringspot virus (PrRSV). Furthermore, the near-perfect association of PrRSV infections with symptoms, and apparent absence of any other virus(es) in studied samples, strongly suggest an important role of this virus in the etiology of NRSD of privet in the southeastern United States.

Molecular characterization and population structure of blackberry vein banding associated virus, new Ampelovirus associated with yellow vein disease.

Blackberry yellow vein disease is the most important viral disease of blackberry in the United States. Experiments were conducted to characterize a new virus identified in symptomatic plants. Molecular analysis revealed a genome organization resembling Grapevine leafroll-associated virus 3, the type species of the genus Ampelovirus in the family Closteroviridae. The genome of the virus, provisionally named blackberry vein banding associated virus (BVBaV), consists of 18,643 nucleotides and contains 10 open reading frames (ORFs). These ORFs encode closterovirid signature replication-associated and quintuple gene block proteins, as well as four additional proteins of unknown function. Phylogenetic analyses of taxonomically relevant products consistently placed BVBaV in the same cluster with GLRaV-3 and other members of the subgroup I of the genus Ampelovirus. The virus population structure in the U.S. was studied using the replication associated polyprotein 1a, heat shock 70 homolog and minor coat proteins of 25 isolates. This study revealed significant intra-species variation without any clustering among isolates based on their geographic origin. Further analyses indicated that these proteins are under stringent purifying selections. High genetic variability and incongruent clustering of isolates suggested the possible involvement of recombination in the evolution of BVBaV.