An epidemiological survey of TYLCD in southern Sardinia (Italy).

Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV) are among the most virulent pathogens of greenhouse tomatoes in Sardinia (Italy). To investigate the relationship between seasonal population trends of the vector Bemisia tabaci and the dynamics of TYLCD spread to susceptible crops, between May and October 2007 we carried out a survey in a tomato growing area located in the south of the island. On three farms specialized in the production of fresh market tomatoes we monitored, outside commercial greenhouses, the following parameters related to TYLCD epidemiology: mean weekly catches of the whiteflies B. tabaci and Trialeurodes voporariorum on yellow sticky traps, ratio between the two whitefly species and proportion of B. tabaci adults carrying TYLCSV/TYLCV in adult samples collected on hosts not susceptible to the disease, proportion of tomato plants infected by TYLCSV/TYLCV after a two-week exposure to open field conditions. Generally speaking, the flight activity of whiteflies increased during spring, reached a peak in May or June and gradually declined in summer. At the beginning of the survey, T. vaporariorum was found to be the prevalent species, but after a shift in composition of whitefly populations during July, B. tabaci became predominant. While the percentage of vector adults carrying the viral agents of the disease was relatively high up to July, with maximum values ranging between 14 and 25%, during the following months it decreased to less than 5%. The incidence of TYLCD in the plants exposed outside the greenhouses showed a similar trend in the sites surveyed, with two peaks roughly coinciding with the beginning and end of summer. Therefore, two distinct phases of TYLCD spread were observed: from spring to midsummer when the disease was transmitted by low 8. tabaci populations with relatively high proportions of virus carriers; from midsummer to autumn, when the disease was spread by larger vector populations with low percentages of individuals carrying the viruses. Further studies are necessary to gain a better understanding of the interactions among B. tabaci biotypes, TYLCSV/TYLCV and their hosts.

TYLCSV DNA, but not infectivity, can be transovarially inherited by the progeny of the whitefly vector Bemisia tabaci (Gennadius).

The transovarial transmission of two species of begomovirus, Tomato yellow leaf curl virus (TYLCV) and Tomato yellow leaf curl Sardinia virus (TYLCSV), through generations of Bemisia tabaci of the B and Q biotypes has been investigated. Different life stages of the progeny of viruliferous female whiteflies have been analysed by PCR detection of viral DNA and infectivity tests. Our results indicate that TYLCSV DNA can be detected in eggs and nymphs, and to a lesser extent adults, of the first-generation progeny. Infectivity tests using a large number of adult progeny of the first, second, and third generation indicate that even when viral DNA is inherited, infectivity is not. For TYLCV, neither viral DNA nor infectivity were associated with the progeny of viruliferous female whiteflies. Because the inherited viral DNA is unable to give rise to infections, the transovarial transmission of TYLCSV DNA appears to have no epidemiological relevance.

Severe outbreaks of tomato yellow leaf curl Sardinia virus in Calabria, Southern Italy.

During the winter 2003--2004 a serious disease was observed in protected tomato crops in Castrovillari, Reggio Calabria province, Southern Italy. Symptoms consisted in marginal leaf yellowing, leaf curling, plant stunting, flower abortion. The disease was detected in a group of greenhouses (about 10ha) where several tomato cultivars were grown hydroponically. The highest incidence of infection (60-100%) was observed in tomatoes grafted on Beaufort DRS tomato rootstock. Since the symptoms were similar to those described for Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), detection assays for these viruses were used. In DAS-ELISA positive results were obtained with a abroad-spectrums reagent combination (distributed by Bioreba AG) detecting TYLCV, TYLCSV, and other begomoviruses. When DNA probes were used in tissue print assays, positive reactions were obtained for TYLCSV, but not for TYLCV. The two probes consisted of digoxigenin-labelled DNAs representing the coat protein gene of either TYLCSV or TYLCV. Attempts to isolate the viral agent by mechanical inoculation failed, except in few cases where Potato virus Y and Tobacco mosaic virus were identified following transmission from symptomatic plants to herbaceous indicatorpplants. By contrast, grafting onto tomato seedlings always successfully transmitted the disease. In the Castrovillari area TYLCSV was not reported before. The rootstocks that nurseries used for grafting were obtained from Sicily, where the disease is endemic and both TYLCSV and TYLCV are widespread. Probably the grafted plantlets represented the primary source of infection from which subsequent diffusion by way of the vector Bemisia tabaci followed. In fact the vector had previously been detected in both the glasshouse-grown and open field tomato crops in Calabria region. TYLCV was previously reported in a different area of Calabria in 1991, but apparently it was an occasional outbreak, and B. tabaci was not detected. Since in the Castrovillari area surveyed in the present study tomato is grown throughtout the year in protected crops, the whitefly vector of the virus is present, and some natural hosts of the virus are found, it is feared that TYLCSV may become endemic, as already happened in Sicily, Sardinia, and Spain several years ago. In Spain and Sicily TYLCV, together with TYLCSV, was reported as the causal agent of very severe tomato crop losses. Therefore the danger exists that also TYLCV will reach this area, furthermore complicating the management of tomato crops.

The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Nucleotide sequence, genome organisation and phylogenetic analysis of Indian citrus ringspot virus. Brief report.

The sequence of the single-stranded RNA genome of Indian citrus ringspot virus (ICRSV) consists of 7560 nucleotides. It contains six open reading frames (ORFs) which encode putative proteins of 187.3, 25, 12, 6.4, 34 and 23 kDa respectively. ORF1 encodes a polypeptide that contains all the elements of a replicase; ORFs 2, 3 and 4 compose a triple-gene block; ORF5 encodes the capsid protein; the function of ORF6 is unknown. Phylogenetic analysis of the complete genome and each ORF separately, and database searches indicate that ICRSV, though showing some similarities to potexviruses, is significantly different, as in the presence of ORF6, the genome and CP sizes, and particle morphology. These differences favour its inclusion in a new virus genus.

First Report of Tomato yellow leaf curl virus Infecting Pepper Plants in Cuba.

The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.

First Report of Tomato infectious chlorosis virus in Spain.

During the summer and autumn of 2001, symptoms of interveinal yellowing, bronzing, brittleness, and rolling of lower leaves were observed in greenhouse- and field-grown tomato (Lycopersicon esculentum) plants in Castellon Province in eastern Spain. Symptoms resembled those caused by the whitefly-transmitted criniviruses (1,2). Total RNA was extracted from 28 samples of symptomatic leaves collected in three greenhouses and one field and analyzed by reverse transcription-polymerase chain reaction using primers specific for Tomato chlorosis virus (ToCV) (1) and Tomato infectious chlorosis virus (TICV) (2). The 501-bp TICV-specific DNA fragment was amplified in four samples collected during the summer in three greenhouses and one field, and the 439-bp ToCV-specific DNA fragment was amplified in 15 samples collected during the autumn in the same three greenhouses; no mixed infections were found. The DNA fragments amplified from TICV were sequenced and showed 99 to 100% identity with the TICV isolates (GenBank Accession Nos. U67449 and AY048855) from the United States and Italy, respectively, confirming the diagnosis. One sequence was deposited as GenBank Accession No. AF479662. To our knowledge, this is the first report of TICV in Spain and the second in Europe. References: (1) D. Louro et al. Eur. J. Plant Pathol. 106:539, 2000. (2) A. M. Vaira et al. Phytoparasitica. In Press.

Transgenically expressed T-Rep of tomato yellow leaf curl Sardinia virus acts as a trans-dominant-negative mutant, inhibiting viral transcription and replication.

We have previously shown that transgenic expression of a truncated C1 gene of Tomato yellow leaf curl Sardinia virus (TYLCSV), expressing the first 210 amino acids of the replication-associated protein (T-Rep) and potentially coexpressing the C4 protein, confers resistance to the homologous virus in Nicotiana benthamiana plants. In the present study we have investigated the role of T-Rep and C4 proteins in the resistance mechanism, analyzing changes in virus transcription and replication. Transgenic plants and protoplasts were challenged with TYLCSV and the related TYLCSV Murcia strain (TYLCSV-ES[1]). TYLCSV-resistant plants were susceptible to TYLCSV-ES[1]; moreover, TYLCSV but not TYLCSV-ES[1] replication was strongly inhibited in transgenic protoplasts as well as in wild-type (wt) protoplasts transiently expressing T-Rep but not the C4 protein. Viral circular single-stranded DNA (cssDNA) was usually undetectable in transgenically and transiently T-Rep-expressing protoplasts, while viral DNAs migrating more slowly than the cssDNA were observed. Biochemical studies showed that these DNAs were partial duplexes with the minus strand incomplete. Interestingly, similar viral DNA forms were also found at early stages of TYLCSV replication in wt N. benthamiana protoplasts. Transgenically expressed T-Rep repressed the transcription of the GUS reporter gene up to 300-fold when fused to the homologous (TYLCSV) but not to the heterologous (TYLCSV-ES[1]) C1 promoter. Similarly, transiently expressed T-Rep but not C4 protein strongly repressed GUS transcription when fused to the C1 promoter of TYLCSV. A model of T-Rep interference with TYLCSV transcription-replication is proposed.

First Report of Tomato chlorosis virus in Italy.

During winter 2000-2001, an unusual disease of tomato was observed in some greenhouses in Sardinia, Sicily, and Apulia, in southern Italy. Plants were chlorotic and reduced in size, expanded leaves showed interveinal yellowing, and older leaves developed interveinal reddish-bronze necrosis and downward rolling. The symptoms resembled those recently reported from Portugal (1) as induced by Tomato chlorosis virus (ToCV) (family Closteroviridae, genus Crinivirus), a whitefly-transmitted virus new to Europe. Symptomatic leaf tissues were extracted and analyzed by reverse transcription-polymerase chain reaction as described by Louro et al.(1). The 439-bp ToCV-specific DNA fragment was amplified in samples collected from 6 of 14 greenhouses in Sardinia, 2 of 5 greenhouses in Sicily, and 1 of 1 greenhouse in Apulia. The sequence of the fragment obtained from a Sicilian isolate (GenBank Accession No. AY048854) showed more than 99% identity to ToCV isolates (Accession Nos. AF024630 and AF234029) from the United States and Portugal, respectively. Infestations of Trialeurodes vaporariorum and Bemisia tabaci have been reported in autumn. To our knowledge, this is the first report of ToCV in Italy. Although we found the virus in three regions of the country, its distribution is likely to be wider, since the symptoms can be mistaken for those of a physiological disorder or of Tomato infectious chlorosis virus, another crinivirus infecting tomato. Reference: (1) Louro et al. Eur. J. Plant Pathol. 106:589, 2000.

Indian citrus ringspot virus: a proposed new species with some affinities to potex-, carla-, fovea- and allexiviruses.

An isolate of Indian citrus ringspot virus from Kinnow mandarin in northern India had flexuous particles with evident cross-banding and a modal length of 650 nm. It was mechanically transmitted to five herbaceous hosts including Phaseolus vulgaris cv Saxa, in which it became systemic. In thin sections, virus particles were observed in the cytoplasm of parenchyma cells but no specific inclusions were seen. The virus was purified from infected Saxa bean leaves and an antiserum prepared. There was no serological cross-reaction with representative allexi-, capillo-, potex- and trichoviruses, except a faint one-way reaction with Potato virus X. Purified virus yielded a major band, the presumed coat protein (CP), of about 34 kDa, and a single ssRNA of about 7.5 kb, which was infectious. Two ORFs encoding putative proteins of 34 kDa and 23 kDa were located in the 3' part of the RNA. The product of the 34 kDa ORF was confirmed as the CP by expression in E. coli. The derived amino acid sequence of the CP contained some short motifs similar to those of potex-, fovea-, carla- and allexiviruses but otherwise there was no strong similarity to any of these. The 23 kDa ORF contained a zinc finger-like sequence, as in similar ORFs in carla- and allexiviruses but overall amino acid homology with these was low. The virus does not appear to fall into any known genus. A new species is proposed. Serological and molecular diagnostic reagents were prepared.

Natural recombination between Tomato yellow leaf curl virus-is and Tomato leaf curl virus.

The complete genome sequences (2791 and 2793 nt) of isolates of Tomato yellow leaf curl virus-Is (TYLCV-Is) from Spain (SP72/97) and Portugal (Port2/95) were determined. These isolates are closely related to TYLCV-Is isolates reported in Japan (Japan-A and Japan-S) and Israel (Israel/Mild). Comparison of all sequenced isolates of TYLCV-Is showed that part of the genome comprising the intergenic region and the 5'-end of the rep gene of the Iran and Israel isolates was not closely related to that of other isolates. Phylogenetic analyses suggest that the Israel and Iran isolates may have chimeric genomes that have arisen by recombination between TYLCV-Is-like and tomato leaf curl virus (ToLCV)-like ancestors. The TYLCV-Is donors of the Iran and the Israel genomes were closely related to each other and to other known TYLCV-Is isolates. However, the ToLCV donors differed from each other, although both were related to ToLCV isolates from India (Bangalore-2 and Bangalore-4).

An Ophiovirus isolated from lettuce with big-vein symptoms.

Big-vein is a widespread and damaging disease of lettuce, transmitted through soil by the chytrid fungus Olpidium brassicae, and generally supposed to be caused by Lettuce big-vein virus (LBVV; genus Varicosavirus). This virus is reported to have rigid rod-shaped particles, a divided double-stranded RNA genome, and one capsid protein of 48 kD, but has not been isolated or rigorously shown to cause the disease. We provide evidence that a totally different virus, here named Mirafiori lettuce virus (MiLV), is also very frequently associated with lettuce showing big-vein symptoms. MiLV was mechanically transmissible from lettuce to Chenopodium quinoa and to several other herbaceous test plants. The virus was partially purified, and an antiserum prepared, which did not react with LBVV particles in decoration tests. As reported for LBVV, MiLV was labile, soil-transmitted and had a single capsid protein of 48 kD, but the particles morphologically resembled those of ophioviruses, and like these, MiLV had a genome of three RNA segments approximately 8.5, 1.9 and 1.7 kb in size. MiLV preparations reacted strongly in Western blots and in ISEM with antiserum to Tulip mild mottle mosaic virus, an ophiovirus from Japan also apparently Olpidium-transmitted. They reacted weakly but clearly in Western blots with antiserum to Ranunculus white mottle virus, another ophiovirus. When lettuce seedlings were mechanically inoculated with crude or partially purified extracts from MiLV-infected test plants, many became systemically infected with MiLV and some developed big-vein symptoms. Such plants did not react in ELISA using an LBVV antiserum or an antiserum to tobacco stunt virus, and varicosavirus-like particles were never seen in them in the EM after negative staining. We conclude that MiLV is a hitherto undescribed virus assignable to the genus Ophiovirus. The cause or causes of lettuce big-vein disease and the properties of LBVV may need to be re-evaluated in light of our results.

Evaluation of resistance in Osteospermum ecklonis (DC.) Norl. plants transgenic for the N protein gene of tomato spotted wilt virus.

The nucleocapsid protein (N) gene of tomato spotted wilt virus (TSWV) was inserted into Osteospermum ecklonis via Agrobacterium tumefaciens leaf strips co-cultivation. Sixteen primary transformant clones of two O. ecklonis genotypes were analysed. Southern blots of restricted genomic DNA demonstrated integration of the transgene and indicated the number of integrated copies. Expression of the transgene was estimated by DAS-ELISA and Western and Northern blotting. Plants were challenged with TSWV inoculation, either mechanically or by the thrips Frankliniella occidentalis; they were then monitored for symptom appearance and tested by TAS-ELISA for infection. Inoculation of the transgenic clones via the natural TSWV vector was more efficient and led to the identification of 1 clone, characterised by multiple transgene integration and no transgene expression, with improved resistance to TSWV.

First Report of Tobacco vein banding mosaic virus in China (Xian, Shaanxi Province) in Datura stramonium and Tobacco.

Tobacco vein banding mosaic virus (TVBMV) has been reported in Taiwan (1), North America (Tennessee) (2), and Japan (3) and induces a severe disease of tobacco. During surveys on viruses of vegetables in China, TVBMV was isolated from a Datura stramonium weed plant in July 1998 in Shaanxi Province. It showed severe mosaic with blistering of the leaves. The plant was also infected by Cucumber mosaic virus (CMV). When sap from D. stramonium was frozen, thawed, and mechanically inoculated, only TVBMV was recovered. The 3'-end of the viral genome was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using primers derived from the potyviridae primers (4) and cloned in pBlueScript. The sequence of 1,630 bp (GenBank AF274315) was determined on both DNA strands and found to have approximately 94% homology with other TVBMV sequences (L 28816 from Tennessee, X77637 from Taiwan, and AB020524 from Japan). The host range of the Chinese isolate was similar to that reported for the U.S. isolate. D. stramonium, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum Samsun, White Burley type and Xanthi, Lycopersicon esculentum cv. Marmande, and Petunia hybrida were systemically infected. A local infection developed in N. rustica, Chenopodium amaranticolor, C. quinoa, and Ocimum basilicum. The Chinese isolate did not infect Capsicum annuum cv. Quadrato d'Asti, Solanum melongena, or several Cucurbitaceae and Leguminosae species. Myzus persicae transmitted the Chinese TVBMV in a non-persistent mode from both D. stramonium and tobacco to the same plants and to tomato. No seed transmission occurred in experimentally infected D. stramonium (20 seedlings), tobacco White Burley type (200 seedlings), and tomato cv. Marmande (100 seedlings). The virus was found in the roots of D. stramonium and tobacco. Since the virus was not seed-transmissible, overwintering rootstocks may provide sites for winter survival of the virus. An antiserum was produced against the virus and an enzyme-linked immunosorbent assay survey was carried out in solanaceous crops including D. stramonium collected in July 1999 in Shaanxi, Shanxi, Henan, and Hebei provinces and Beijing surroundings. TVBMV was found only in the same field as in 1998 in four D. stramonium plants in association with CMV and in a tobacco plant 200 m from D. stramonium. TVBMV was not found in the closest tomato crops, where infection of CMV was severe. This is the first report of TVBMV in China, and Xian is the most northern location in which this virus has been found. References: (1) J. K. Chiang et al. Bull. Tobacco Res. Inst. 32:39, 1990. (2) B. B. Reddick et al. Plant Dis. 76:856, 1992. (3) H. Tochihara. Rev. Plant Prot. Res. 13:122, 1980. (4) A. Gibbs and A. Mackenzie. J. Virol. Meth. 63:9, 1997.

Cucurbit yellow stunting disorder virus (Genus Crinivirus) Associated with the Yellowing Disease of Cucurbit Crops in Portugal.

During autumn 1998, chlorotic mottling, yellowing, and stunting symptoms were observed on cucumber (Cucumis sativus L.) plants in an experimental plot, in Algarve, southern Portugal. The first symptoms appeared 3 weeks after planting, associated with a heavy infestation of Bemisia tabaci (Gennadius). Plants affected early produced few and small fruits. Analysis of double-stranded RNA (dsRNA) extracted from symptomatic cucumber leaves revealed the presence of two dsRNAs of about 8 and 9 kbp, not present in healthy cucumber plants. Reverse-transcription polymerase chain reaction (RT-PCR) using dsRNA or total RNA extracts as template and the oligonucleotide primers 410L and 410U (1), specifically amplified a fragment of expected size of the HSP70-homolog gene of Cucurbit yellow stunting disorder virus (CYSDV). The RT-PCR-amplified fragment was sequenced (Acc. No. AF287474) and showed 99% sequence identities with the corresponding sequences (GenBank accessions AJ223619 and U67170) from two CYSDV isolates belonging to group I (2), confirming CYSDV detection. CYSDV was also detected in samples of cucumber, melon (Cucumis melo L.) and watermelon (Citrullus lanatus [Thunb.] Matsun.) collected during the summer of 1999 in commercial greenhouses. CYSDV is an emerging and important virus of cucurbits in the Middle East and Mediterranean Europe (2). This is the first report of CYSDV infecting cucurbit crops in Portugal. References: (1) A. Célix et al. Phytopathology 86:1370, 1996. (2) L. Rubio et al. Phytopathology 89:707, 1999.

Using non-radioactive probes on plants: a few examples.

Due to costs in using and disposing of radiochemicals and to health considerations, we have been developing applications which include non-isotopic detection of DNA and proteins using chemiluminescence. Our major interests are in the detection of viral nucleic acids and in the analysis of transgenic plants. Generally, probes were labelled with digoxigenin, either by the random priming method or by PCR, and then detected with CSPD or CDP-Star. We routinely use a tissue blotting protocol for diagnosing TYLCV, a plant virus becoming a post in the Mediterranean region. Test results were comparable with those using the same radiolabelled probe. When total nucleic acids are extracted from the plant samples and used in dot-blot or Southern blot assays, viral DNAs are promptly detected by chemiluminescence. In transgenic plants, chemiluminescence was used to detect the transgene on genomic Southern blots, the transgenic mRNAs on Northern blots, and the transgenic protein on Western blots. In Southern and Northern blots, the quality of the results obtained was usually satisfactory, but not as good as with a radiolabelled probe, the main problem being the signal-to-background ratio. Our goal is now to improve the quality of results in demanding applications such as genomic Southern blots, by reducing the background on membranes.

Amino acids in the capsid protein of tomato yellow leaf curl virus that are crucial for systemic infection, particle formation, and insect transmission.

A functional capsid protein (CP) is essential for host plant infection and insect transmission in monopartite geminiviruses. We studied two defective genomic DNAs of tomato yellow leaf curl virus (TYLCV), Sic and SicRcv. Sic, cloned from a field-infected tomato, was not infectious, whereas SicRcv, which spontaneously originated from Sic, was infectious but not whitefly transmissible. A single amino acid change in the CP was found to be responsible for restoring infectivity. When the amino acid sequences of the CPs of Sic and SicRcv were compared with that of a closely related wild-type virus (TYLCV-Sar), differences were found in the following positions: 129 (P in Sic and SicRcv, Q in Sar), 134 (Q in Sic and Sar, H in SicRcv) and 152 (E in Sic and SicRcv, D in Sar). We constructed TYLCV-Sar variants containing the eight possible amino acid combinations in those three positions and tested them for infectivity and transmissibility. QQD, QQE, QHD, and QHE had a wild-type phenotype, whereas PHD and PHE were infectious but nontransmissible. PQD and PQE mutants were not infectious; however, they replicated and accumulated CP, but not virions, in Nicotiana benthamiana leaf discs. The Q129P replacement is a nonconservative change, which may drastically alter the secondary structure of the CP and affect its ability to form the capsid. The additional Q134H change, however, appeared to compensate for the structural modification. Sequence comparisons among whitefly-transmitted geminiviruses in terms of the CP region studied showed that combinations other than QQD are present in several cases, but never with a P129.

Partial characterization of a new virus from ranunculus with a divided RNA genome and circular supercoiled thread-like particles.

An undescribed virus, here named ranunculus white mottle virus, was isolated in Italy from cultivated ranunculus showing mottle and distortion of leaves. The virus was mechanically transmissible to several herbaceous hosts. In negative stain, the particles appeared as circularised supercoiled threads 3 nm in diameter of different contour lengths; in some conditions the circles collapsed to form linear pseudobranched structures 9 nm in diameter. Immunolabeling of thin sections showed that viral antigen was widely distributed in the cytoplasm of parenchyma cells. The virus was not serologically related to the morphologically similar tenuiviruses, citrus psorosis-ringspot virus and tulip mild mottle mosaic virus. A major 43 kDa protein was present in purified preparations and in infected plant tissue, as also was a minor 28 kDa protein, serologically related to the major one. Nucleic acids extracted from purified particles consisted of at least three RNAs, of approximately 7.5, 1.8 and 1.5 kb, which appeared partly in single- and partly in double-stranded form. Purified preparations, but not viral RNAs, when mechanically inoculated, were infectious. Host range, tissue tropism, particle morphology and coat protein size place the virus closest to citrus psorosis-ringspot and tulip mild mottle mosaic viruses. These three viruses in turn show similarities with the Tenuiviruses and Bunyaviridae.

Resistance to tomato yellow leaf curl geminivirus in Nicotiana benthamiana plants transformed with a truncated viral C1 gene.

The C1 gene of tomato yellow leaf curl geminivirus (TYLCV) encodes a multifunctional protein (Rep) involved in replication. A truncated form of this gene, capable of expressing the N-terminal 210 amino acids (aa) of the Rep protein, was cloned under the control of the CaMV 35S promoter and introduced into Nicotiana benthamiana using Agrobacterium tumefaciens. The same sequence was also cloned in antisense orientation. When self-pollinated progeny of 19 primary transformants were tested for resistance to TYLCV by agroinoculation, some plants proved to be resistant, particularly in the sense lines. Two such lines were further studied. The presence of the transgene was verified and its expression was followed at intervals. All plants that were resistant to TYLCV at 4 weeks postinoculation (wpi) contained detectable amounts of transgenic mRNA and protein at the time of infection. Resistance was overcome in a few plants at 9 wpi, and in most at 15 wpi. Infection of leaf discs derived from transgenic plants showed that expression of the transgene correlated with a substantial reduction of viral DNA replication. Cotransfections of tobacco protoplasts demonstrated that inhibition of viral DNA replication requires expression of the truncated Rep protein and suggested that the small ORF C4, also present in our construct, plays no role in the resistance observed. The results obtained using both transient and stable gene expression systems show that the expression of the N-terminal 210 aa of the TYLCV Rep protein efficiently interferes with virus infection.

DNA-binding activity of the C2 protein of tomato yellow leaf curl geminivirus.

The in vitro DNA-binding activity of the C2 protein of tomato yellow leaf curl geminivirus (TYLCV) was studied following its expression in Escherichia coli as a fusion protein with an His tag N-terminal extension (His-C2). Southwestern blotting experiments demonstrated that the C2 protein is able to bind both single-stranded and double-stranded DNA probes. In electrophoretic mobility shift assays performed using purified protein and single-stranded DNA probes several shifted complexes were formed. The presence of NaCl (up to 800 mM) did not substantially affect binding profiles, demonstrating a stable interaction. His-C2 appeared to bind single-stranded DNA in a sequence-nonspecific manner, with a preference for single-stranded compared to double-stranded DNA. Deletion mutants demonstrated that the central core of C2 (amino acids 33 to 104), which contains a Cys-His rich region, is sufficient for conferring binding activity. The potential significance of this DNA-binding activity with respect to possible biological functions of TYLCV C2 protein is discussed.