First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Antifungal Activity of Plant-Derived Essential Oils on Pathogens of Pulse Crops.

Pulse crops such as chickpeas, lentils, and dry peas are grown widely for human and animal consumption. Major yield- and quality-limiting constraints include diseases caused by fungi and oomycetes. The environmental and health concerns of synthetic fungicides used for disease management, emergence of fungicide-resistant pathogens, and demand for organic pulse crop products necessitate the search for effective alternatives. Safe and environmentally friendly plant-derived essential oils (EOs) have been reported effective against some pathogenic fungi. Growth on EO-amended growth medium and an inverted Petri plate assay were used to determine the effects of 38 oils and their volatiles on mycelial growth and spore germination of important pathogenic fungi and oomycetes: Aphanomyces euteiches, Botrytis cinerea, Colletotrichum lentis, Didymella pisi, D. rabiei, D. lentis, Fusarium avenaceum, Stemphylium beticola, Sclerotinia sclerotiorum, and Pythium sylvaticum. Palmarosa, oregano, clove, cinnamon, lemongrass, citronella, and thyme oils incorporated in media inhibited mycelial growth of all the pathogens by 100% at 1:1,000 to 1:4,000 dilution. In addition, thyme oil (1:500 dilution) showed complete inhibition of conidial germination (0% germination) of F. avenaceum and D. pisi. All seven EO volatiles inhibited mycelial growth of all pathogens by 50 to 100% except for B. cinerea and S. sclerotiorum. EO effects on mycelial growth were fungistatic, fungicidal, or both and varied by EO. EOs show potential for management of major crop diseases in organic and conventional production systems.

Fusarium spp. Associated With Root Rot of Pulse Crops and Their Cross-Pathogenicity to Cereal Crops in Montana.

Root rot caused by Fusarium species is a major problem in the pulse growing regions of Montana. Fusarium isolates (n = 112) were obtained from seeds and roots of chickpea, dry pea, and lentil. Isolates were identified by comparing the sequences of the internal transcribed spacer region and the translation elongation factor 1-α in Fusarium-ID database. Fusarium avenaceum was the most abundant species (28%), followed by F. acuminatum (21%), F. poae (13%), F. oxysporum (8%), F. culmorum (6%), F. redolens (6%), F. sporotrichioides (6%), F. solani (4%), F. graminearum (2%), F. torulosum (2%), and F. tricinctum (0.9%). The aggressiveness of a subset of 50 isolates that represent various sources of isolation was tested on three pulse crops and two cereal crops. Nonparametric analysis of variance conducted on ranks of disease severity indicated that F. avenaceum and F. solani isolates were highly aggressive on pea and chickpea. In lentil, F. avenaceum and F. culmorum were highly aggressive. In barley, F. avenaceum, F. solani, F. culmorum, and F. graminearum were highly aggressive. In wheat, F. avenaceum, F. graminearum, and F. culmorum were highly aggressive. Two F. avenaceum isolates were highly aggressive across all the crops tested and found to be cross-pathogenic. One isolate of F. culmorum and an isolate of F. graminearum obtained from chickpea and lentil seed were highly aggressive on barley and wheat. The results indicate that multiple Fusarium spp. from seeds and roots can cause root rot on both pulse and cereal crops. Rotating these crops may still lead to an increase in inoculum levels, making crop rotation limited in efficacy as a disease management strategy.

Development and Application of Real-Time and Conventional SSR-PCR Assays for Rapid and Sensitive Detection of Didymella pisi Associated with Ascochyta Blight of Dry Pea.

Didymella pisi is the primary causal pathogen of Ascochyta blight (AB) of dry pea in Montana. Diagnosis of AB is challenging because there are six different species that cause AB worldwide and that can co-occur. Additionally, agar plate identification of D. pisi is challenging due to its slow growth rate. Currently, there are no PCR-based assays developed for specific detection of D. pisi or any fungal pathogen in the AB complex of dry pea. In this study, we evaluated simple sequence repeat (SSR) primer pairs for their specificity and sensitivity in real-time and conventional SSR-PCR both in vitro and in planta. The specificity of the assay was determined by testing DNA of 10 dry pea varieties, fungal species in the AB complex, and fungal species associated with dry pea. To avoid false-negative results, plant and fungal DNA markers were included as controls in a conventional multiplex SSR-PCR, to amplify any plant or fungal DNA in the absence of the D. pisi SSR target. SYBR Green SSR-quantitative PCR (qPCR) detection was conducted using the same primer pairs but in a uniplex format. D. pisi was specifically amplified, whereas other fungi and host DNA were not. Also, sensitivity experiments showed that the detection limit was 0.01 ng of DNA of D. pisi for both assays and 100 conidia in SSR-qPCR. These assays are valuable diagnostic tools for the detection of D. pisi.

First microsatellite markers developed and applied for the genetic diversity study and population structure of Didymella pisi associated with ascochyta blight of dry pea in Montana.

Didymella pisi is the predominant causal pathogen of ascochyta blight of dry pea causing yield losses in Montana, where 415 000 acres were planted to dry pea in 2018. Thirty-three microsatellite markers were developed for dry pea pathogenic fungus, Didymella pisi, these markers were used to analyze genetic diversity and population structure of 205 isolates from four different geographical regions of Montana. These loci produced a total of 216 alleles with an average of 1.63 alleles per microsatellite marker. The polymorphic information content values ranged from 0.020 to 0.990 with an average of 0.323. The average observed heterozygosity across all loci varied from 0.000 to 0.018. The gene diversity among the loci ranged from 0.003 to 0.461. Unweighted Neighbor-joining and population structure analysis grouped these 205 isolates into two major sub-groups. The clusters did not match the geographic origin of the isolates. Analysis of molecular variance showed 85 % of the total variation within populations and only 15 % among populations. There was moderate genetic variation in the total populations (PhiPT = 0.153). Information obtained from this study could be useful as a base to design strategies for improved management such as breeding for resistance to ascochyta blight of dry pea in Montana.

The Detection and Characterization of QoI-Resistant Didymella rabiei Causing Ascochyta Blight of Chickpea in Montana.

Ascochyta blight (AB) of pulse crops (chickpea, field pea, and lentils) causes yield loss in Montana, where 1.2 million acres was planted to pulses in 2016. Pyraclostrobin and azoxystrobin, quinone outside inhibitor (QoI) fungicides, have been the choice of farmers for the management of AB in pulses. However, a G143A mutation in the cytochrome b gene has been reported to confer resistance to QoI fungicides. A total of 990 isolates of AB-causing fungi were isolated and screened for QoI resistance. Out of these, 10% were isolated from chickpea, 81% were isolated from field peas, and 9% isolated from lentil. These were from a survey of grower's fields and seed lots (chickpea = 17, field pea = 131, and lentil = 21) from 23 counties in Montana sent to the Regional Pulse Crop Diagnostic Laboratory, Bozeman, MT, United States for testing. Fungicide-resistant Didymella rabiei isolates were found in one chickpea seed lot each sent from Daniels, McCone and Valley Counties, MT, from seed produced in 2015 and 2016. Multiple alignment analysis of amino acid sequences showed a missense mutation that replaced the codon for amino acid 143 from GGT to GCT, introducing an amino acid change from glycine to alanine (G143A), which is reported to be associated with QoI resistance. Under greenhouse conditions, disease severity was significantly higher on pyraclostrobin-treated chickpea plants inoculated with QoI-resistant isolates of D. rabiei than sensitive isolates (p-value = 0.001). This indicates that where resistant isolates are located, fungicide failures may be observed in the field. D. rabiei-specific polymerase chain reaction primer sets and hydrolysis probes were developed to efficiently discriminate QoI- sensitive and - resistant isolates.

Detection and characterization of the first North American mastrevirus in switchgrass.

Virus infections have the potential to reduce biomass yields in energy crops, including Panicum virgatum (switchgrass). As a first step towards managing virus-induced biomass reduction, deep sequencing was used to identify viruses associated with mosaic symptoms in switchgrass. Two sequences with homology to mastreviruses were identified. Total DNA extracted from switchgrass varieties 'Dewey Blue' and 'Cloud Nine' was used as template to amplify mastrevirus DNA by the rolling-circle method. Complete mastrevirus genome sequences were obtained from cloned amplicons. The two nucleotide sequences were 88 % identical to each other but only 56-57 % identical to the closest relatives in the genus Mastrevirus. Predicted amino acid sequences of the coat protein, replication-associated protein A, replication-associated protein, and putative movement protein encoded by the two mastrevirus-like sequences were 95 %, 79 %, 79 %, and 87 % identical to each other, respectively, and 46-48 %, 31 %, 31 %, and 42-48 % identical to those of the closest mastrevirus relatives. Based on a genome-wide identity threshold of 75 % set by the International Committee on Taxonomy of Viruses and phylogenetic analyses, the two virus sequences appear to represent a new mastrevirus species. The mastrevirus is tentatively named switchgrass mosaic-associated virus 1 (SgMaV-1) and is the first mastrevirus reported from North America.

Complete genome sequence of switchgrass mosaic virus, a member of a proposed new species in the genus Marafivirus.

The complete genome sequence of a virus recently detected in switchgrass (Panicum virgatum) was determined and found to be closely related to that of maize rayado fino virus (MRFV), genus Marafivirus, family Tymoviridae. The genomic RNA is 6408 nucleotides long. It contains three predicted open reading frames (ORFs 1-3), encoding proteins of 227 kDa, 43.9 kDa, and 31.5 kDa, compared to two ORFs (1 and 2) for MRFV. The complete genome shares 76 % sequence identity with MRFV. The nucleotide sequence of ORF2 of this virus and the amino acid sequence of its encoded protein are 49 % and 77 % identical, respectively, to those of MRFV. The virus-encoded polyprotein and capsid protein aa sequences are 83 % and 74-80 % identical, respectively, to those of MRFV. Although closely related to MRFV, the amino acid sequence of its capsid protein (CP) forms a clade that is separate from that of MRFV. Based on the International Committee on Taxonomy of Viruses (ICTV) sequence-related criteria for delineation of species within the genus Marafivirus, the virus qualifies as a member of a new species, and the name Switchgrass mosaic virus (SwMV) is proposed.

Application of sequence-independent amplification (SIA) for the identification of RNA viruses in bioenergy crops.

Miscanthus x giganteus, energycane, and Panicum virgatum (switchgrass) are three potential biomass crops being evaluated for commercial cellulosic ethanol production. Viral diseases are potentially significant threats to these crops. Therefore, identification of viruses infecting these bioenergy crops is important for quarantine purposes, virus resistance breeding, and production of virus-free planting materials. The application is described of sequence-independent amplification, for the identification of RNA viruses in bioenergy crops. The method involves virus partial purification from a small amount of infected leaf tissue (miniprep), extraction of viral RNA, amplification of randomly primed cDNAs, cloning, sequencing, and BLAST searches for sequence homology in the GenBank. This method has distinct advantage over other virus characterization techniques in that it does not require reagent specific to target viruses. Using this method, a possible new species was identified in the genus Marafivirus in switchgrass related to Maize rayado fino virus, its closest relative currently in GenBank. Sugarcane mosaic virus (SCMV), genus Potyvirus, was identified in M.xgiganteus, energycane, corn (Zea mays), and switchgrass. Other viruses identified were: Maize dwarf mosaic virus (MDMV), genus Potyvirus, in johnsongrass (Sorghum halepense); Soil borne wheat mosaic virus (SBWMV), genus Furovirus, in wheat (Triticum aestivum); and Bean pod mottle virus (BPMV), genus Comovirus, in soybean (Glycine max). The method was as sensitive as conventional RT-PCR. This is the first report of a Marafivirus infecting switchgrass, and SCMV infecting both energycane and M. x giganteus.

Macroarray Detection of Eleven Potato-Infecting Viruses and Potato spindle tuber viroid.

A macroarray was developed for the detection of 11 potato viruses and Potato spindle tuber viroid. The 11 viruses detected included those commonly found or tested for in North American potato seed certification programs: Alfalfa mosaic virus, Cucumber mosaic virus, Potato mop top virus, Potato leafroll virus, Potato latent virus, Potato virus A, Potato virus M, Potato virus S, Potato virus X, Potato virus Y, and Tobacco rattle virus. These viruses were detected using oligonucleotide 70-mer probes and labeled targets prepared by a random primed amplification procedure. Potato plants analyzed included those infected with 12 reference virus stocks and 36 field isolates. Results from the macroarray were entirely consistent with those obtained using a standard serological assay (enzyme-linked immunosorbent assay). Four isolates of Potato spindle tuber viroid, in mixed infection with one or more viruses, also were detected in the array, although strong hybridization signals required amplification with viroid-specific primers in combination with anchored-random primers. In individual plants, up to four viruses, or a viroid plus two viruses, were detected, with no apparent competition or inhibition. Macroarrays are a cost-effective approach to the simultaneous diagnostic detection of multiple pathogens from infected plants.

Simultaneous detection of potato viruses, PLRV, PVA, PVX and PVY from dormant potato tubers by TaqMan real-time RT-PCR.

The requirements of sprouting dormant potato tubers for biological or serological assays or RNA extraction for nucleic acid and PCR assays add to the cost of virus screening. Recently, cheaper, reliable and more rapid methods for the screening of potato tuber-seed pieces for viruses have been developed that do not require sprouted tubers for indexing, including TaqMan real-time RT-PCR. Although the assays are often designed for minimal time and reagent use, they still require a time-consuming and laborious RNA extraction step. This paper describes an assay where four common potato-infecting viruses, Potato leafroll virus, Potato virus A, Potato virus X and Potato virus Y, were detected simultaneously from total RNA and saps of dormant potato tubers in a quadruplex real-time RT-PCR. Factors critical for the detection of these viruses in saps of dormant potato tubers included: optimum dilution and inhibition of RNAses, and the optimization of the reverse transcription and PCR steps. Potato virus detection directly from tuber saps was comparable to that from purified total plant RNA, and this represents significant savings of time and expense. The TaqMan system developed in this study detected between 200 and 400 copies of potato virus RNA.

Macroarray Detection of Plant RNA Viruses Using Randomly Primed and Amplified Complementary DNAs from Infected Plants.

ABSTRACT Membrane-based macroarrays provide a relatively inexpensive technology with the potential to detect hundreds of pathogens in a single assay. For the simultaneous detection of a large number of pathogens, it is necessary to obtain sufficient nucleic acids for labeling, and any amplification reactions need to be performed using unbiased, pathogen-non-specific primers. A nonradioactive macroarray system is described to test for plant RNA viruses using 70-mer oligonucleotide probes immobilized on nylon membranes. Starting with a total plant RNA extract, complementary DNA (cDNA) and second-strand syntheses were carried out using an anchor primer sequence with random pentamers coupled at the 3' end. Subsequent synthesis by polymerase chain reaction using the anchor primer alone resulted in a relatively unbiased amplification of plant and viral RNAs. These cDNAs were chemically labeled and the product used as a target in hybridization analyses. The system was validated using RNA extracts from plants infected with Cucumber mosaic virus, Potato virus Y, and Potato leaf roll virus (PLRV). Despite the relative excess of host-derived nonviral sequences, viral RNAs were amplified between 100- and 1,000-fold and were detected in single and mixed infections. The macroarray sensitivity was comparable to that of double-antibody sandwich enzyme-linked immunosorbent assay, with PLRV being detected in sap dilutions of 1:100. The potential for the development of a relatively inexpensive multipathogen detection system is discussed.