First Report of Papaya ringspot virus W in Sponge Gourd from India.

During August 2004, symptoms resembling a virus disease were observed in commercial cultivation of sponge gourd (Luffa cylindrica (L.) M. Roem. [cv. Chikni]) in Pune, India. Affected plants exhibited mosaic mottling, vein banding, and downward marginal curling on leaves. The incidence of disease was 10 to 30% based on the symptoms and confirmed using enzyme-linked immunosorbent assay (ELISA). Six fields of sponge gourd were visited, and 30 samples were collected randomly. Samples from affected fields were analyzed for the presence of virus by mechanical inoculation. Symptoms typical of those observed in the original field plants appeared 10 days after inoculation on sponge gourd. The virus isolate produced local lesions on Chenopodium amaranticolor and systemic symptoms on Cucumis melo, Cucumis sativus, Cucurbita maxima, Cucurbita pepo, L. acutangula, and L. cylindrica, but did not produce symptoms on Carica papaya (cvs. CO2 and Red Lady), Nicotiana glutinosa, N. tabacum (cv. White Burley), or Vigna unguiculata. Field-infected sponge gourd and all indicator plants were tested using double-antibody sandwich (DAS)-ELISA. The virus was identified as Papaya ringspot virus-W (PRSV-W) using DAS-ELISA (Agdia, Elkhart, IN). A strong, positive reaction was obtained with antiserum to PRSV-W but not with antisera to PRSV-P, Cucumber mosaic virus, Squash mosaic virus, Zucchini yellow mosaic virus, and Groundnut bud necrosis virus. To ensure virus purity, the isolate was passed through three successive single-lesion transfers on C. amaranticolor. Flexuous filamentous particles 775 nm long were observed with electron microscopy of leaf-dip preparation from symptomatic sponge gourd leaves. The virus particles were then decorated with a second PRSV-W antiserum obtained from the Plant Virology Unit, IARI, New Delhi. PRSV-W on sponge gourd has previously been reported from Taiwan (1). To our knowledge, this is the first report of natural occurrence of PRSV-W on sponge gourd in India. Reference: (1.) C. H. Huang et al. J. Agri. Res. China 36:413, 1987.

First Report of Zucchini yellow mosaic virus in Bottlegourd (Lagenaria siceraria) in India.

In December 2002, bottlegourd (Lagenaria siceraria L.) plants grown as a commercial crop in Pune, India (western Maharashtra) showed severe mosaic, interveinal chlorosis, and leaf deformation that resulted in fern-leaf appearance and severe fruit distortion in approximately 70% of the plants. Crude sap of collected samples was used to mechanically inoculate uninfected glasshouse-grown bottlegourd plants that reproduced symptoms observed in the field. Sap extracts from these glasshouse infected bottlegourd plants were used to mechanically inoculate selected indicator hosts. Chlorotic local lesions were produced on Chenopodium amaranticolor, and systemic symptoms were produced on Benincasa hispida, Citrullus lanatus, Cucumis sativus, Cucurbita moschata, C. pepo, Luffa cylindrical, and Trichosanthes anguina. The virus was specifically identified with serological testing using direct antigen coating enzyme-linked immunosorbent assay. The virus reacted strongly to Zucchini yellow mosaic virus (ZYMV) antiserum and did not react to Papaya ring spot virus-P (PRSV-P), Cucumber mosaic virus (CMV), and Watermelon mosaic virus (WMV) antisera. Electron microscopic examination of leaf-dip preparation from infected plants showed flexuous filamentous particles (720 to 760 nm long) that are typical of potyviruses. Natural infection of bottlegourd by ZYMV has been reported in the Hawaiian Islands (1). To our knowledge, this is the first report of this potentially destructive virus in bottlegourd in India. Reference: (1) D. E. Ullman et al. Plant Dis. 75:367, 1991.

Sodium sulphite yields improved DNA of higher stability for PCR detection of Citrus yellow mosaic virus from citrus leaves.

Citrus yellow mosaic virus (CYMV), a non-enveloped bacilliform DNA virus causes a severe mosaic disease in sweet oranges in India. CYMV is weakly immunogenic, thus serodiagnosis is not a preferred method for its detection. As an alternative a rapid and reliable detection protocol by polymerase chain reaction (PCR) was developed. However, high levels of polyphenolics and tannins in citrus leaves generally interfered with obtaining good quality DNA, and thus affected the reliable detection of virus by PCR. Consequently, we evaluated the addition of sodium sulphite to a DNA extraction protocol used previously and compared the two methods with a commercially available plant DNeasy Kit (Qiagen). The addition of sodium sulphite improved the yield, quality and stability of DNA. The CYMV DNA was not only amplified at lower template DNA concentration, but also provided better DNA yields. In addition, the sodium sulphite extracted DNA survived at various temperatures much longer than those extracted without addition of sodium sulphite or with the commercial kit. The amplified product of CYMV DNA was cloned, sequenced and found to have 89% sequence identity with the only other sequenced Indian isolate of CYMV.

First Report of Citrus Greening Disease and Associated Bacterium "Candidatus Liberibacter asiaticus" from Bhutan.

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, "Candidatus Liberibacter asiaticus" in Asian countries and "Candidatus Liberibacter africanus" in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5'TATAAAGGTTGACCTTTCGAGTTT/5'ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of ß-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from "Candidatus Liberibacter asiaticus". The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of "Candidatus Liberibacter asiaticus" confirming that "Candidatus Liberibacter asiaticus" is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

Isolation of an Isometric Virus Causing Sunflower Necrosis Disease in India.

Sunflower necrosis disease (SND) is becoming a potential threat to sunflower (Helianthus annuus L.) cultivation in the Indian subcontinent. The disease was first recorded in parts of Karnataka state in 1997. Since then the disease has become increasingly important in Andhra Pradesh, Karnataka, Maharashtra, and Tamil Nadu, the four major sunflower-growing states of India, and is a limiting factor in sunflower production; up to 80% of the plants of some open pollinated and hybrids were affected during the 1999 survey in sunflower growing areas. Field symptoms of the disease include extensive necrosis of leaf lamina, petiole, stem and floral calyx and severe stunting with malformation of flowering head when plants are infected early. The association of a tospovirus, antigenically related to groundnut bud necrosis (GBNV) and watermelon silver mottle (WSMV) viruses, with the disease has been reported (1). However, the etiology of the disease remains unaddressed. In this study a sap-transmissible isometric virus was transferred to cowpea (cvs. Pusa Komal and C152) inciting localized chlorotic and necrotic lesions and systemic veinal necrosis. Electron-microscopic studies of leaf-dip preparations from field samples revealed two types of particles (isometric measuring 25 to 28 nm in diameter and flexuous rods with a length of about 600 nm). The sap-inoculated cowpea and sunflower contained only the isometric particles. Some preparations also showed the presence of tubules containing virus particles. The presence of flexuous particles in field samples could be due to mixed infection as the mosaic disease, known to be caused by a flexuous virus, was common in the sunflower fields surveyed in the present investigations. Extracts from the field collected samples or sap-inoculated plants did not react with antisera to cucumber mosaic (CMV) or potato Y (PVY) viruses in direct antigen-coated (DAC)-ELISA and immunosorbent electron microscopy tests. The isometric virus isolated from sunflower was purified from sap-inoculated cowpea plants by differential and sucrose density-gradient centrifugations. The virus was sap transmitted back to sunflower (cv. Morden), which developed symptoms identical to those observed under field conditions. Disease symptoms were also reproduced on sunflower upon mechanical inoculation with the purified virus. Polyclonal antiserum raised in rabbits using purified virus preparations, detected the virus from field and glasshouse collected sunflower plants in DAC-ELISA tests. This will help in epidemiological studies and breeding for disease resistance. The particle size and structure and the presence of tubule containing virus particles in plant extracts suggest that the virus belongs to ILAR group. An ILAR virus is reported to infect sunflower (2), but details of its natural occurrence are not known. This is the first report on the etiology of the sunflower necrosis disease in India. Further studies are in progress. References: (1) Anon. 2000. Annual Report (1999-2000), Indian Agricultural Research Institute, New Delhi, India. (2) A. A. Brunt et al. CAB International, Wallingford, UK, 1210, 1996.

Drought induces many forms of cysteine proteases not observed during natural senescence.

Drought-induced senescence and natural senescence was characterised in the cowpea leaf, with a focus on cysteine proteases. Soluble protein content and ribulose 1,5-bisphosphate carboxylase (Rubisco) content declined as senescence progressed. Endopeptidase activity with Rubisco as a physiological substrate exhibited significant increase at acidic (pH 4.8) than at neutral (pH 7.0) during drought induced senescence and declined during recovery. Natural senescence was associated with a several-fold increase in the endopeptidase activity at both the pHs. Cysteine proteases were analyzed using western blot with polyclonal antibodies raised against papain. Several polypeptides of molecular weights 57, 52, and 43 kDA were recognized by the antibodies, the levels of which showed an increase under water deficit conditions, followed by a decrease during recovery. Three polypeptides of molecular weights 69, 60, and 48 kDa appeared only during the water stress conditions, whereas, during natural senescence, only a single 48 kDa polypeptide with maximum intensity at 9 days after flowering was observed. The results suggests the possibility of distinguishing drought-induced and natural senescence.

Occurrence of Witches'-Broom, a New Phytoplasma Disease of Acid Lime (Citrus aurantifolia) in India.

In India, acid lime (Citrus aurantifolia (L.) Swingle) is one of the most important citrus fruits grown. It constitutes nearly 20% of the total citrus production. During 1995, an unusual type of disease was observed on a 6-year-old acid lime plant in an orchard in the Nagpur District in eastern Maharashtra. It was named witches'-broom disease (WBD) to reflect the most conspicuous symptom. Other symptoms included small chlorotic leaves, highly proliferated shoots, and shortened internodes. Leaves dropped prematurely and infected twigs were distorted. In advanced stages, infected branches had dieback symptoms. WBD of lime has been reported from Oman and UAE (1) and the causal phytoplasma was designated "Candidatus Phytoplasma aurantifolia" (2). Subsequent surveys in 1995-1998 revealed disease incidences as high as 5% in Maharashtra and in other major acid-lime-growing states-Andhra Pradesh, Tamilnadu, and Karnataka. After the grafting of infected acid lime shoots, disease symptoms developed on Troyer citrange, rough lemon, and Rangpur lime, but not on sweet orange (mosambi), mandarin (Nagpur), or trifoliate orange. The WBD agent was transmitted from infected acid lime to periwinkle (Catharanthus roseus) plants and vice versa by dodder (Cuscuta reflexa). Ultrathin sections of leaf midrib of infected acid lime plants were fixed on copper grids, stained with uranyl acetate and lead acetate, and examined in a JEM 100S transmission electron microscope. Numerous bodies having the characteristic morphology of phytoplasmas were observed in phloem sieve tubes of acid lime in diseased but not in healthy leaves. The phytoplasmal bodies ranged from 100 to 800 nm in diameter and were bounded by a poorly defined membrance. Freehand transverse sections of young internode regions of a WBD-infected periwinkle plant were stained in DAPI (4', 6 diamidino-2-phenylindole; 1.0 µg/ml) and were observed with a fluorescent microscope (Leica). An intense bluish-white fluorescence in the phloem elements of diseased periwinkle and its absence in healthy samples were consistent with the presence of phytoplasmas. This is the first report of phytoplasma-induced witches'-broom disease of acid lime in India. References: (1) M. Garnier et al. Plant Dis. 75:546, 1991. (2) L. Zreik et al. Int. J. Syst. Bacteriol. 45:449,1995.

Identification and Characterization of Banana Bract Mosaic Virus in India.

We have identified banana bract mosaic potyvirus (BBMV) in banana plants growing in the Coimbatore and Tiruchchirappalli regions of southern India based on symptomatology, particle morphology, sequence homology, and nucleic acid hybridization assays. Potyvirus-like particles typical of BBMV also were detected in sap dips from banana plants growing in Maharashtra State. Sequence comparisons of the C terminus of the coat protein-coding and 3' untranslated regions revealed that the Indian isolates of BBMV had greater than 96.6 and 97.2% homology with a Philippines isolate at the nucleotide and amino acid levels, respectively. BBMV-infected banana cultivars from the Coimbatore region showed the characteristic mosaic on the bract of the banana inflorescence. In contrast, infected plants growing in the Tiruchchirappalli region and Maharashtra State displayed symptoms similar to those associated with cucumber mosaic cucumovirus and not the characteristic bract mosaic symptom. These results indicate that BBMV is more widespread than previously thought.