Assessment of Parental Knowledge, Awareness, and Perception About Autism Spectrum Disorders in Aseer Region, Southwestern Saudi Arabia.

Background: Autism spectrum disorder (ASD) is a neurodevelopmental condition that affects young children in social relatedness and communication besides other characteristics. A community's awareness and early intervention services in diagnosing and treating autistic children are essential for preventing the expected complications, eg language delay, social interaction, and intellectual ability. Aim: To assess the parent's knowledge and perceptions regarding autism and its associated clinical features and effects. Methodology: A cross-sectional study was conducted targeting all available parents aged 18 years or more living in Aseer region. Data were collected using a self-reported questionnaire from randomly selected parents who attended outpatient clinics at Abha Maternity and Children Hospital and Aseer Central Hospital. Parents' knowledge regarding autism was assessed covering general knowledge, clinical features, social effects, consequences, and curability. Results: A total of 477 parents participated. Parents' ages ranged from 18 to 85 years. 261 (54.7%) parents were male and 216 (45.3%) were females. Nearly 65.6% of parents were university graduates and 28.3% had a secondary level of education. About 50.9% of the parents know that genetics play a major role in causing autism, 69.6% think that most children with autism have special talents or abilities, 64.2% know that delayed language development is one of the main symptoms of autism, 61.2% also know that repetitive movements of the hands and head are a common symptom of autism. About 36.9% of parents think that diagnosing a child with autism will lead to discrimination against the child, 33.3% of parents think that autism is a rare condition in this country compared to the West. Conclusion: The study showed that parents had poor knowledge levels regarding autism and its related clinical features, especially male parents with low levels of education. On the other hand, their perception of the disease and its frequency in the study area was satisfactory.

Perceptions of Parents towards COVID-19 Vaccination in Children, Aseer Region, Southwestern Saudi Arabia.

Vaccines are an important part of the COVID-19 pandemic response plan. This cross-sectional study aims to assess the attitude and perception levels of parents toward COVID-19 vaccines for children aged 0-18 years in the Aseer region of Saudi Arabia. Data were analyzed using SPSS version 16.0. Out of a total of 1463 parents, 30.6% assumed that COVID-19 vaccination may be more dangerous for children than adults. Nearly 36.5% parents don't have any concern about children's vaccination. About 12.8% of children have not received the vaccination, 55% of parents have some sort of hesitation and 32.2% of parents did not hesitate before vaccinating their children against COVID-19. Only 15.4% of parents expect that the COVID-19 vaccine affects their child's genes. About 23.4% parents strongly agreed and 35.1% agreed about the importance of getting their children vaccinated. About 22.1% of parents strongly agreed and 33.3% agreed regarding their willingness to get their children vaccinated to prevent Coronavirus disease. More than 80% of parents recommended rushing to receive the COVID-19 vaccine. Health professionals and policymakers should implement and support strategies to ensure children are vaccinated for COVID-19. They also need to educate parents and families regarding childhood vaccination.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Knowledge, Attitudes, and Practices towards Food Poisoning among Parents in Aseer Region, Southwestern Saudi Arabia.

Background: Food poisoning is caused by eating contaminated food. Improper food safety knowledge, poor food handling, and inadequate personal hygiene may allow microbes to grow in sufficient numbers to cause a food-borne illness. The aim of this paper was to assess the knowledge, attitudes, and practices regarding food poisoning and its determinants of parents in the Aseer region of Saudi Arabia. Methodology: This is a descriptive cross-sectional study conducted on 3011 parents in the Aseer region in the southwest region of Saudi Arabia. An online questionnaire was used to collect the data. The level of knowledge of the participants was scored as a percentage and further classified as "good" or "poor". Attitudes were classified as "positive", "neutral", or "negative" based on a calculated composite mean score. The participants were asked about standard food hygiene practices, and the practices were recorded based on how often they were performed, with the results recorded as "usually", "sometimes", or "never". Results: The age range of the parents was between 18 and 65 years old, with a mean age of 28.9 ± 10.4 years. Among the participants, 96.2% were Saudi, and 81.8% were female. Almost 53% of the fathers and 41% of the mothers were university graduates. About 55% of the mothers were housewives. Almost equal proportions of the parents had "good" and "poor" levels of knowledge on food poisoning. Around 41% of the parents had positive attitudes towards safe food consumption. Older parents (defined as above 30 years of age), males, university graduates, and urban residents had significantly higher levels of knowledge regarding food poisoning. Conclusions: This study provided much needed information on the knowledge, attitudes, and practices related to food poisoning among parents in the Aseer region of Saudi Arabia. Although most respondents reported satisfactory practices, gaps were identified in knowledge and attitudes. This suggests a need for further investigation focused on the observed practices and strengthening health education activities for the community.

Awareness and Perception of Parents Regarding Well Baby Clinic in Primary Health Care Centres in Abha City, Southwestern Saudi Arabia.

BACKGROUND: Well-baby clinic (WBC) service is implemented in all primary health care centers and is provided based on international standards to all children under 5 years in Saudi Arabia. It is a comprehensive package of health promotion and curative care to improve and maintain the health status and well-being of this age group. AIM: The main aim is to assess parents' awareness and perception regarding WBC in primary health care centers in Abha sector, Kingdom of Saudi Arabia (KSA). METHODOLOGY: A descriptive cross-sectional approach was used in the current study. The study targeted all babies' caregivers attending WBCs in primary health care centers in Abha city. The children's parents were included using three stages cluster sample technique. The questionnaire included participants' demographic data such as age, gender, relation to the baby, educational level, work, and monthly income. Awareness regarding the WBC was assessed using two main items covering hearing about the clinic provided services. RESULTS: The study included 1593 participants whose ages ranged from 19 to 55 years old with a mean age of 34.6 ± 11.8 years. About 64% of the respondents knew about the WBC, which was significantly higher among the females than males (P = .003). Also, 71.2% of respondents aged 25-34 years knew about well-baby clinic (WBC) compared to 35% of parents aged less than 25 years (P = .001). Exact 57.1% of the respondents went to the nearest governmental health office at vaccination times. About 46% of the respondents reported that the clinic nurse was the main person who dealt with them. Regarding services provided by a nurse at the vaccination clinic, registering child vaccination was the most reported (66.2%), followed by helping the mother make the child calm (56.8%). CONCLUSIONS: In conclusion, the study revealed that proper care is vital for a child's survival as well as optimal physical and mental development. Adequately cared child has proper well-being and happiness. Mothers and children caregivers had adequate awareness and acceptable attitude towards WBCs and provided services. Some barriers were declared including lack of available WBCs within the residence range, not all WBCs usually working, and more information should be provided about WBCs.