Updating the epidemiology of dermatophyte infections in Palestine with special reference to concomitant dermatophytosis.

OBJECTIVE: To determine the epidemiology of dermatophytosis in Palestinian patients, detect changes in the etiological agents during the last three decades, and to correlate between concomitant tinea pedis infections, and other cutaneous lesions. MATERIALS AND METHODS: 220 suspected dermatophytosis patients were involved in this study. In an additional 38 cases, where consultation was prompted by tinea pedis, the presence of other lesions of concomitant dermatophytosis was studied, to further investigate the diagnosis. Clinical specimens were collected and identification of dermatophyte species was based on gross and microscopic morphology. RESULTS: Epidemiology of tinea capitis has gone the most radical changes in Palestine in the last three decades, with the zoophilic dermatophyte Microsporum canis replacing Trichophyton violaceum, becoming the predominant causative agent. During this study, 21.6% (38/176) patients with tinea pedis and concomitant lesions caused by the same dermatophytes at sites distant from the primary lesions in the foot were prospectively identified. About 63.2% of patients with tinea pedis have a concomitant toenail onychomycosis infection. CONCLUSIONS: The epidemiology of dermatophytosis, especially tinea capitis, has gone the most radical changes in Palestine in the last three decades, with M. canis replacing T. violaceum, and becoming the predominant causative agent of all cases of infections. The coexistence of tinea pedis with other types of fungal skin infections is a frequent phenomenon; we believe that the infected foot may be a site of primary infection. Thus, the effective therapy for tinea pedis is essential to prevent spreading the infection to other sites of the skin.

Squash leaf curl virus (SLCV): a serious disease threatening cucurbits production in Palestine.

The incidence of squash leaf curl disease and molecular characterization of the Palestinian isolate of Squash leaf curl virus [SLCV-(PAL)] are described in this study. Symptomatic leaf samples obtained from squash (Cucurbita pepo), watermelon [Citrullus lanatus (Thunb.)], and cucumber (Cucumis sativus L.) plants were tested for SLCV-[PAL] infection by PCR and RCA. SLCV was also found to occur naturally in Chenopodium murale, Convolvulus sp, and Prosporis farcta which showed yellowing. The disease incidence was 85 % in samples collected from Nablus in summer season, while it was 98 % in samples collected from Qalqilia in autumn. On the other hand, SLCV incidence did not exceed 25 % in winter season. The full-length DNA-A and DNA-B genomes of SLCV-[PAL] were amplified and sequenced, and the sequences were deposited in the GenBank. Sequence analysis reveals that SLCV-[PAL] is closely related to other isolates from Lebanon (SLCV-LB2), Jordan (SLCV-JO), Israel (SLCV-IL), and Egypt (SLCV-EG). DNA-A of SLCV-[PAL] showed the highest nucleotide identity (99.4 %) with SLCV-JO, and SLCV-LB2, while DNA-B had the highest nucleotide identity (99.3 %) with SLCV-IL. However, following genome sequencing, it was found that due to two separate point mutations, two viral open reading frames (ORF) were altered in some SLCV Palestinian isolates. The AC2 ORF was extended by 141 nucleotides, while the AC4 ORF was extended by 36 nucleotides.

First Report of Watermelon chlorotic stunt virus in Watermelon in the Palestinian Authority.

In the summer of 2010, watermelon plants (Citrullus lanatus Thunb.) from eight fields surveyed in two districts (Jenin and Qalqilia) in the West Bank of the Palestinian Authority (PA) exhibited typical Watermelon chlorotic stunt virus (WmCSV) symptoms including yellow veining, chlorotic mottling, stunting of young leaves, and reduction of yield. Disease incidence ranged from 8 to 98% and was associated with whitefly (Bemisia tabaci) infestation. In symptomatic leaves of 79 of 215 watermelon plants examined, geminiviral DNA was detected by PCR (3) and rolling circle amplification (RCA) (2). Geminivirus DNA-A and DNA-B component fragments were amplified by PCR using degenerated and specific primers (3). The full-length DNA-A of WmCSV-[PAL] was amplified from field-collected watermelon plants using WAI-XbaI-(v)/WAI-XbaI-(c) primer pair, and the generated PCR product was sequenced (3). A DNA-A fragment (2,017 bp) (GenBank Accession No JN673223) comprising a conserved region of the coat protein (AV1), AC5, AC3, AC1, and AC2 genes, showed 99, 99, 99, 98, 98, and 97% nucleotide identity with sequences of WmCSV isolates from Jordan (GenBank Accession No. EU561237), Israel (LEF201809), Lebanon (HM368371), Sudan (AJ245650), Iran (AJ245652), and Yemen (AJ012081), respectively. The circular genomic DNA-A and DNA-B of WmCSV-[PAL] were amplified from a whitefly-inoculated watermelon plant by RCA (2) and used to inoculate 30 watermelon plants with a nonvacuum gene gun (4). Typical WmCSV symptoms developed in all these plants 4 weeks postinoculation and virus infection was confirmed by PCR. In 2011, WmCSV was detected from the southern and eastern parts of neighboring Jordan (1). The new emergent disease in the PA was detected in all of the surveyed watermelon fields in regions where cucurbits are intensively grown, only a few kilometers east of Israel. This suggests that the introduction of WmCSV to the PA might have occurred through transplant movement between Israel and the PA or through viruliferous whiteflies that moved from infected plants in Israel to neighboring fields in Jenin and Qalqilia districts. This is in accordance with the observation that disease incidence was always associated with high population of B. tabaci. The virus endangers the production of watermelon in the affected areas to the point of becoming the limiting factor of growing watermelon in open fields. To our knowledge, this is the first report of WmCSV infecting cucurbits in the PA. References: (1) A. Al-Musa et al. Virus Genes 43:79, 2011. (2) H. Jeske. Curr. Topics Microbiol. Immunol. 331:185, 2009. (3) A. Kheyr-Pour et al. Phytopathology 90:629, 2000. (4) S. Sikorskaite et al. J. Virol. Methods 165:320, 2010.

First Report of Squash leaf curl virus in Squash (Cucurbita pepo), Melon (Cucumis melo), and Cucumber (Cucumis sativa) in the Northern West Bank of the Palestinian Authority.

In the summers and falls of 2008 and 2009, cucurbit plants (squash, Cucurbita pepo L.; cucumber, Cucumis sativus L.; and melon, Cucumis melo L.) from 23 of 33 cucurbit fields surveyed at three districts (Jenin, Nablus, and Tulkarm) in the West Bank of the Palestinian Authority exhibited curled, blistered, yellowed, and mottled leaves and small deformed fruits. Disease incidence ranged from 24 to 100% and was associated with whitefly (Bemesia tabaci) infestation. In symptomatic leaves of 94 plants (89 squash, 3 cucumber, and 2 melon) of 208 plants examined, geminiviral DNA was detected by PCR and rolling circle amplification (1). Geminivirus DNA-A and DNA-B component fragments were amplified by PCR using degenerate primers PAL1v1978/pPAR1c496, for DNA-A component and PBL1v2040l/PCRc1 for DNA- B component (4). A fragment from DNA-A was amplified using specific primers for DNA-A: SLCVSTCF1F (ATAATCTAGACCATGGGGTGTCCTCTCAACTTTCTCA) and SLCVSTCF3R (ATATGGATCCATTTAAATTCTTCACAAAGCGTTCCTG) and the generated PCR product was sequenced. A DNA-A fragment (922 bp) from a conserved region of the coat protein (AV1) gene showed 98, 98, 97, and 96% nucleotide identity with sequences of Squash leaf curl virus (SLCV) isolates from Jordan (GenBank Accession No. EF532620), Egypt (DQ285019), California (DQ285016), and Arizona (AF256203), respectively. Nonviruliferous whiteflies were allowed to feed on symptomatic cucurbit plants for 48 h. The whiteflies were then transferred to 30 healthy squash seedlings at the first-leaf stage and given a 48-h inoculation access period. Typical SLCV symptoms developed in these plants 9 to 10 days postinoculation (1). Until recently, SLCV was restricted to North America; however, in 2003, the first record on its occurrence in the Middle East was in Israel where it caused severe epidemics and disease incidence reached 100% (2). In 2006, the virus was reported to cause the severe symptoms observed in squash fields in Egypt (3). More recently, in 2008, it was detected in all surveyed areas in Jordan and disease incidence reached 95% in squash samples collected from the Dir Alla area (1). The new emergent disease in the Palestinian Authority was detected in all surveyed squash fields located in the Jenin District, in an area (Al-Fara') about 25 km to the west of Dir Alla in Jordan. Only a few sporadic cases were found in cucumber fields (three isolates) in Tulkarm and in melon fields (two isolates) in Nablus. This indicates that the virus might have spread from Jordan via viruliferous whiteflies or seedlings. The virus endangers the production of squash in the affected areas to the point of becoming the limiting factor of growing squash in open fields. To our knowledge, this is the first report of a whitefly-transmitted geminivirus infecting cucurbits in the Palestinian Authority. References: (1) A. Al-Musa et al. J. Phytopathol. 156:311, 2008. (2) Y. Antignus et al. Phytoparasitica 31:415, 2003. (3) A. M. Idris et al. Plant Dis. 90:1262, 2006. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Synthesis of a new series of heterocyclic scaffolds for medicinal purposes.

A new series of substituted 8-fluro-4H-pyrimido[2,1-b] [1,3]benzothiazole-4-ones () substituted 7-methyl-4H-isoxazolo[2,3-a]pyrimidin-4-ones, and substituted 2-methyl-5,6,7,8-tetrahydro-9H-isoxazolo[2,3-a]pyridopyrimidin-9-ones, compounds I-VII, have been prepared via condensation of beta-keto esters with 2-aminopyridine derivatives, in the presence of polyphosphoric acid. The same technique has also been used to prepare diazepine compounds, VIII-X, by condensation of a gamma-keto ester with 2-aminopyridine derivatives. Details of synthetic procedures are shown. The new compounds have been characterized by elemental analysis, GC-MS, FT-IR and NMR spectrometry. Antibacterial, antifungal and anticancer (cytotoxic) activities, for three of these compounds, have been investigated and are presented.

Prevalence of tinea capitis as well as of asymptomatic carriers in school children in Nablus area (Palestine).

A study of tinea capitis was carried out during October 1998, involving 8531 school children aged 6-14 years (4718 males and 3813 females), attending 12 primary schools located in urban, rural, and refugee camp communities in the Nablus district in the Palestinian Authority. A total of approximately 1389 of the school children aged 6-12 years (724 males and 665 females) were also surveyed on three occasions at 2-3 month intervals, over a 9-month period (October 1998-May 1999) using the hair brush technique, for prevalence of asymptomatic tinea capitis carriage. Twenty-three(0.27%) mycologically proven cases of tinea capitis were detected.

Ecology of dermatophytes and other keratinophilic fungi in swimming pools and polluted and unpolluted streams.

The biodiversity and richness of keratinophilic fungal communities including dermatophytes were assessed in three stream sites and three swimming pools in the Nablus district in Palestine, using hair baiting (HBT) and surface dilution plate (SDP) techniques, over 8- and 6-month periods, respectively. The effect of wastewater effluent and selected ecological factors on these fungi in relation to species diversity and population densities were also considered. Fifty keratinophilic fungal species were recovered from the aquatic habitats studied, of which 42 were recovered from stream sites and 22 from swimming pools. Of these fungi 6 were either dermatophytes (Microsporum gypseum, and Trichophyton mentagrophytes) or dermatophyte related species (Chrysosporium merdarium, Ch. tropicum, Ch. keratinophilum and T. terrestre). The most frequently isolated species in the three pools were Acremonium strictum and Cladosporium cladosporioides, using Sabouraud dextrose agar medium (SDA). The most abundant species were Acr. strictum, and Aspergillus flavus. However, only 4 species were isolated using the SDA medium amended with 5-flurocytosine (5-FC). The most frequent and abundant species in the three stream sites using SDA medium were Geotricum candidum, and Penicillium chrysogenum. The most frequent species in the three sites using the 5-FC medium, was Paecilomyces lilacinus. Using HBT, the most abundant and frequent species in the three stream sites were G. candidum, and Pa. lilacinus, on SDA medium, and Pa. lilacinus, and Gliocladium nigrovirens on the 5-FC medium. The 5-FC medium was more suitable for the isolation of dermatophytes and closely related species than the SDA medium; 6 were recovered on 5-FC, whereas only one on the SDA medium. Variation in the levels of keratinophilic fungal populations from the three stream sites sampled 5 times over an 8-month period, followed comparable fluctuation patterns. Wastewater affected fungal population densities with the highest levels in the un-polluted stream sites, and lowest in the heavily polluted sites. Swimming pools, polluted and un-polluted stream sites were found to be rich in pathogenic and potentially pathogenic fungi.

Hair and scalp mycobiota in school children in Nablus area.

Hair and scalp mycobiota of 1389 clinically normal children aged 6-12 years attending 12 schools in the Nablus District, Palestinian Authority, was assessed on three occasions over 8-month period (October 1998-May 1999) using the hair brush technique. One hundred and one fungal species belonging to 33 genera were recovered: 6 dermatophytes, 16 dermatophyte-like keratinophilic fungi, and 79 other keratinophilic fungal species. Species varied considerably in their frequency of occurrence and abundance based on their relative importance values (RIVs). The most frequent and abundant species were: Cladosporium cladosporioides, Cl. herbarum, Penicillium chrysogenum and Aspergillus flavus, Microsporum canis, Aphanoascus fulvescence and Chrysosporum sulfureum were the most frequent and abundant species of all dermatophytes and dermatophyte-like keratinophilic fungi recovered. The most frequent and abundant dermatophytes in different communities were M. canis in rural (RIV 0.87) and urban children (0.45), and Trichophyton violaceum (1.41) in refugee camp children. Chrysosporium species were the most frequent and abundant dermatophyte-like keratinophilic fungus in children from all localities followed by Aphanoascus fulvescence. Comparable results on the frequency and abundance of human hair and scalp mycobiota component fungi were obtained based on age group and sex of children. Higher number of species was recovered in spring months (73 species) than in autumn (57) and winter (44) months. Similar occurrence pattern was also noted for dermatophyte-like keratinophilic species and dermatophytes. Higher percentages of children with moderate (11-50) and heavy (< or = 50) spore loads (7.54 and 0.73, respectively) were found in urban school children community than in rural and refugee camp school children (4.7 and 0.1, respectively). Also significantly higher light (1-10) spore load percentages were found in rural (63.67) and refugee camp (62.9) than in urban children (52.6). Of all localities, school children with light spore load comprised the highest percentage of the children examined (37.4), followed by moderate (6.13), and heavy (0.41) spore load categories. However, children with undetected spore load comprised 36.05% of all children. Spore load distribution did not show clear seasonal variations in the study period. Higher percentages of moderate and heavy spore loads were found in male children (8.72 and 0.69, respectively) than in female children (3.4 and 0.1, respectively). However, higher percentages of undetected (38.3) or light spore loads (58.4) were found in females than in males (34.04 and 56.53, respectively).

Ethnobotanical survey in the Palestinian area: a classification of the healing potential of medicinal plants.

An ethnobotanical survey was carried out in the West Bank to evaluate the relative efficacy of the plants used to treat skin diseases and prostate cancer. A total number of 102 informants, 30 years and older and either native born or had been living in the West Bank for more than 30 years, were interviewed using a previously prepared questionnaire. Of about 165 plant species mentioned by the informants, 63 (38.1%) were mentioned by three or more informants. On the basis of their primary uses, 21 of these plants were reported to relieve skin disorders, 17 for urinary system disorders, 16 for gastric disorders, nine for cancer and prostate disorders, eight for arthritis, five for respiratory problems, and five for other ailments. Indices on fidelity levels (FLs), relative popularity level (RPL), and rank-order priority (ROP) were calculated. Plants were classified in two groups: 'popular' (RPL=1) or 'unpopular' (RPL<1). The following plant species were classified as popular in this study: Teucrium polium, Matricaria aurea, Urtica pilulifera, Paronychia argentea, Petroselinum sativum, and Salvia fruticosa. The remaining 57 species were classified as 'unpopular'. Fifty-nine plants were claimed to be effective against cancer and prostate disorders, which include Arum dioscorides, U. pilulifera, Allium sativum, Viscum cruciatum, and Allium cepa.

Antifungal activity of plant extracts against dermatophytes.

The aqueous extracts (15 micrograms ml-1 medium) of 22 plants used in folkloric medicine in Palestine were investigated for their antifungal activity and minimum inhibitory concentrations (MICs) against nine isolates of Microsporum canis, Trichophyton mentagrophytes and Trichophyton violaceum. The extract of the different plant species reduced colony growth of the three dermatophytes by 36 to 100% compared with the control treatment. Antimycotic activity of the extract against the three dermatophytes varied significantly (P < 0.05) between test plants. Extracts of Capparis spinosa and Juglans regia completely prevented growth of M. canis and T. violaceum. The most active extracts (90-100% inhibition) were those of Anagallis arvensis, C. spinosa, J. regia, Pistacia lentiscus and Ruta chalapensis against M. canis; Inula viscosa, J. regia and P. lentiscus against T. mentagrophytes; and Asphodelus luteus, A. arvensis, C. spinosa, Clematis cirrhosa, I. viscosa, J. regia, P. lentiscus, Plumbago europea, Ruscus aculeatus, Retema raetam and Salvia fruticosa against T. violaceum. The MICs of these most active plants ranged from 0.6 to 40 micrograms ml-1. The three dermatophytes differed significantly with regard to their susceptibility to plant extracts. Trichophyton violaceum was the most susceptible being completely inhibited by 50% of the extracts followed by M. canis and T. mentagrophytes which were completely inhibited by only 23 and 14% of the extracts, respectively.

Epidemiological study of tinea capitis in schoolchildren in the Nablus area (West Bank).

A study of tinea capitis was carried out during the period January-June 1996 in 7525 primary schoolchildren aged 6-14 years comprising 4050 boys and 3475 girls in the Nablus district in the Palestinian area. Fourteen primary schools located in rural, urban and refugee camp areas were surveyed in this study. Seventy-five (1.0%) mycologically proven cases of tinea capitis were detected. The incidence was higher in schools in rural areas (1.9%) than in refugee camps (1.1%) or urban areas (0.4%). Also, the incidence was higher in young children (1.4%) aged 6-10 years than in older children (0.5%) aged 10-14 years. Boys 52 (1.3%) were more commonly affected than girls 23 (0.7%). Higher disease incidence was found to be correlated with larger family and class sizes. Trichophyton violaceum was the most common aetiological agent (82.7%) followed by Microsporum canis (16%) and Trichophyton schoenleinii (1.3%). The findings are discussed in relation to the children's different socioeconomic and hygienic backgrounds. A mycological investigation carried out on 117 tinea capitis cases at a clinic in the area under study showed similar results to those of the school survey.

Antimicrobial activity of 20 plants used in folkloric medicine in the Palestinian area.

Ethanolic and aqueous extracts of 20 Palestinian plant species used in folk medicine were investigated for their antimicrobial activities against five bacterial species (Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Proteus vulgaris, Pseudomonas aeruginosa) and one yeast (Candida albicans). The plants showed 90% of antimicrobial activity, with significant difference in activity between the different plants. The most antimicrobially active plants were Phagnalon rupestre and Micromeria nervosa, whereas, the least active plant was Ziziphus spina-christi. Only ten of the tested plant extracts were active against C. albicans, with the most active from M. nervosa and Inula viscosa and the least active from Ruscus aculeatus. Of all extracts the ethanolic extract of M. nervosa was the most active, whereas, the aqueous extract of Phagnalon rupestre was the most active of all aqueous extracts tested. The ethanolic extracts (70%) showed activity against both Gram positive and negative bacteria and 40% of these extracts showed anticandidal activity, whereas, 50% of the aqueous extracts showed antibacterial activity and 20% of these extracts showed anticandidal activity.

Ecology of cycloheximide-resistant fungi in field soils receiving raw city wastewater or normal irrigation water.

The effect of raw city wastewater irrigation on biodiversity and population densities of a cycloheximide-resistant (CH) fungal community was studied in 13 field soils receiving either raw city wastewater or normal irrigation, and in raw city wastewater in the Nablus area, using the hair baiting technique (HBT) and a surface soil dilution plating (SSDP) technique. Three of these fields [one had been receiving raw city wastewater for more than ten years and was designated a heavily polluted field, and the other 2 were cultivated for the first time and were either irrigated with raw city wastewater (newly polluted field) or normal irrigation water (nonpolluted)], were sampled 4-7 times over a 9-month period. The other ten fields, which had been under raw city wastewater irrigation for more than 10 years, were sampled only once. Fifty-seven CH-resistant species belonging to 18 genera were recovered, of which 49 species were recovered from soil habitats and 28 species from raw city wastewater. The HBT had shown to be more efficient in the isolation of pathogenic and potentially pathogenic fungi including dermatophytes. A higher percentage of this group of fungi was recovered from the three main field soils studied using HBT (70% of all isolates), than the SSDP (35.5%); no dermatophytes were recovered by the SSDP method. Two dermatophytes (Microsporum gypseum, and Trichophyton ajelloi), and five more fungi (Arthroderma cuniculi, A. curreyi, Chrysosporium keratinophilum, C. tropicum, C. pannorum), were recovered from these habitats. Wastewater irrigation seemed to have affected the fungal population densities, with the highest population densities being found in the heavily polluted field soil, while lower population densities were found in the nonpolluted field soil. Increases in organic matter were also observed as a result of sewage effluent irrigation. However, basic similarities in the biodiversity of CH-resistant fungal communities existed in nonpolluted and polluted field soils, and raw city wastewater. Comparable numbers of fungal species were recovered from the three main field soils. The species most commonly found in those habitats included: Alternaria alternata, Aspergillus candidus, Geotrichum candidum, and Paecilomyces lilacinus. Field soils receiving either raw city wastewater or normal irrigation water, were found to be rich in pathogenic and potentially pathogenic CH-resistant fungi, including dermatophytes, with raw city wastewater yielding the highest percentage (81%), followed by the newly wastewater irrigated field (77.7%), the nonpolluted field (67%), and the heavily polluted field (63.4%) Hygienic measures should therefore be taken to control the spread of these fungi in the environment of human communities, and to avoid mycotic infections among farmers.

Antimicrobial activity of Micromeria nervosa from the Palestinian area.

Organic and aqueous solvent extracts and fractions of Micromeria nervosa (Desf.) Benth. (Labiatae) were investigated for antimicrobial activities on several microorganisms including bacteria and yeast. The different extracts differed significantly in their antimicrobial activities with the ethanolic extract being most active, followed by ethyl acetate and petroleum ether extracts. The least active extract was the aqueous. No significant difference between the different test microorganisms in their susceptibility to different extracts, with Candida albicans being the most susceptible to ethanolic extract giving 1.5 times the effect of nystatin. One of the main active ingredients of M. nervosa was isolated and identified as carvacrol. No significant difference in antimicrobial activity was found between carvacrol and its isomer thymol. The most susceptible test microorganism was Proteus vulgaris to carvacrol, and P. vulgaris and C. albicans to thymol. The least susceptible bacterium to both fractions was Pseudomonas aeruginosa. Minimum inhibitory concentration (MIC) and minimum bactericidal or fungicidal concentrations (MBC or MFC) were determined for both compounds.

Phytophthora Root and Crown Rot of Sage Caused by Phytophthora cryptogea in California.

In 1996, commercial plantings of sage (Salvia officinalis) in the Salinas Valley in Monterey County, CA, were affected by a root and crown disease. Roots were necrotic, and crowns and lower stems turned black. Affected plants withered and died. A Phytophthora sp. was consistently isolated from roots and stems of the symptomatic plants. The species was identified as Phytophthora cryptogea based upon the formation of hyphal swellings, morphology of sporangia and oospores, and growth at cardinal temperatures (1). Pathogenicity of representative isolates was confirmed by applying 2 ml of a zoospore suspension (2.0 × 105 zoospores per ml) to roots and crowns of 3-month-old potted sage plants. After treatment, plants were placed for 24 h in shallow trays of water to saturate the root zone, then were removed from trays and incubated in a greenhouse. After 4 days, foliage of all inoculated plants began to wilt. After 7 days, plant crowns and stems turned black and the plants collapsed. P. cryptogea was reisolated and recharacterized from all plants. Control plants, which were treated with water and then handled in the same way as inoculated plants, did not develop any symptoms. The tests were repeated and the results were similar. This is the first report of P. cryptogea attacking commercial plantings of sage. The authors also detected this disease in experimental plantings of sage in Stanislaus County in 1990. Reference: (1) D. C. Erwin and O. K. Ribeiro. 1996. Phytophthora Diseases Worldwide. American Phytopathological Society, St. Paul, MN.

Keratinophilic fungi of school playgrounds in the Nablus area, West Bank of Jordan.

The distribution of keratinophilic fungi in the soil of 57 school playgrounds in the Nablus area was studied with relation to human presence. A total number of 73 species was recovered. Thirteen of these species were dermatophytes and closely related fungi. The most common and frequent species of the latter fungi were: Arthroderma cuniculi (found in 32.1% of school playgrounds), Chrysosporium keratinophilum (32.1%), Microsporum gypseum (10.7%), T. terrestre (7.1%), and C. asperatum (7.1%). Twenty eight of the isolated species had been reported to be pathogenic; these comprised 64.3% of the keratinophilic mycoflora of school playgrounds.

Keratinophilic fungi on sheep hairs from the West Bank of Jordan.

The mycoflora of the hair in 285 sheep from the West Bank of Jordan was analysed and the frequency of occurrence and the relative importance value for different fungal species found were calculated. Ninety six species which belong to 36 genera were isolated. Forty one of these species were either well-known agents of animal and human mycoses (Trichophyton verrucosum, T. mentagrophytes, Microsporum nanum, M. canis, and others), or have been isolated from human and animal lesions (Arthroderma cuniculi, A. curreyi, Chrysosporium tropicum, Acremonium kiliense, Aphanoascus fulvuscens, Aspergillus versicolor, Paecilomyces lilacinus, Scopulariopsis brevicaulis, and others). These pathogenic fungi comprised 75.4% of all fungi recovered from the hair of sheep. This animal seems to represent an adequate reservoir for several dermatophytes and several potentially pathogenic fungi.

Isolation of keratinophilic fungi from floor dust in Arab elementary and preparatory schools in the West Bank of Jordan.

Floor dust collected from classrooms of thirty three elementary schools (16 for girls, and 17 for boys) (children aged 6-11), and twenty four preparatory schools (13 for girls, and 11 for boys) (children aged 12-14) was studied for the occurrence of keratinophilic fungi with respect to human presence and age of children. Tichophyton mentagrophytes was present in 15.4% of the preparatory schools for girls, in 12.5% of elementary schools for girls, and in 11.8% of elementary schools for boys. It was not found in preparatory schools for boys. Microsporum gypseum was found in preparatory schools for girls only (7.7%). Trichophyton terrestre was also only isolated from elementary schools for boys (5.9%). Chrysosporium species were present in 30.3% of all elementary schools (10 schools/33), and in 20.8% of all preparatory schools (5 schools/24). Geotrichum candidum was the most frequent and predominant keratinophilic species in all schools. Pathogenic and potentially pathogenic keratinophilic fungi comprised a large proportion of all fungal isolates recovered from all schools; they comprised 87.2%-89.5% of all fungal isolates in the elementary schools, and 90.4%-93.5% of all fungal isolates in preparatory schools.

Prevalence and seasonal fluctuations of intestinal parasitic infections in the Nablus area, West Bank of Jordan.

A total of 22,970 stool specimens collected from patients attending the Central Medical Laboratory in the city of Nablus in the period of 1981-1986 were examined for intestinal parasites. Of these 7412 (32.3%) were positive. Entamoeba histolytica (22.9%), Giardia lamblia (7.3%), and Ascaris lumbricoides (5.7%) were the most prevalent intestinal parasites found. Other intestinal parasites present included Hymenolepis nana, Trichomonas hominis, Trichuris trichiura, Taenia saginata, Enterobius vermicularis and Strongyloides stercoralis. Seasonal occurrence of intestinal parasites in the West Bank of Jordan was also studied in the period January 1981-August 1987. Lower prevalence rates of intestinal parasites generally occurred during winter and early spring. Peak incidence occurred during summer and early autumn. The reasons for these seasonal variations are discussed.

Keratinophilic fungi on the hair of goats from the West Bank of Jordan.

The mycoflora of the hair in 178 goats from the West Bank of Jordan was analysed and the frequency of occurrence and the relative importance value for the different keratinophilic fungi found were calculated. One hundred and seven species which belong to 38 genera were isolated. Thirty six of these species were either well recognised agents of mycoses (Trichophyton mentagrophytes, T. verrucosum, and M. nanum), or have been frequently isolated from human and animal lesions (Arthroderma spp., Acremonium kiliense, Alternaria alternata, Aspergillus flavus, Cladosporium carionii, and several other species). These potentially pathogenic fungal species comprised 66.9% of all keratinophilic fungi found on the hair of goats. The role of this animal as a reservoir for dermatophytes and other potentially pathogenic fungi is discussed.