A finite element model for predicting impact-induced damage to a skin simulant.

A finite element model was developed for assessing the efficacy of rugby body padding in reducing the risk of sustaining cuts and abrasions. The model was developed to predict the onset of damage to a soft tissue simulant from concentrated impact loading (i.e., stud impact) and compared against a corresponding experiment. The damage modelling techniques involved defining an element deletion criterion, whereby those on the surface of the surrogate were deleted if their maximum principal stress reached a predefined value. Candidate maximum principal stress values for element deletion criteria were identified independently from puncture test simulations on the soft tissue simulant. Experimental impacts with a stud were carried out at three energies (2, 4 and 6 J), at three angular orientations (0°, 15° and 30°) and compared to corresponding simulations. Suitable maximum principal stress values for element deletion criteria settings were first identified for the 4 J impact, selecting the candidates that best matched the experimental results. The same element deletion settings were then applied in simulations at 2 and 6 J and the validity of the model was further assessed (difference < 15% for the force at tear and < 30% for time to tear). The damage modelling techniques presented here could be applied to other skin simulants to assess the onset of skin injuries and the ability of padding to prevent them.

Deciphering genetic factors contributing to enhanced resistance against Cercospora leaf blight in soybean (Glycine max L.) using GWAS analysis.

Cercospora leaf blight (CLB), caused by Cercospora cf. flagellaris, C. kikuchii, and C. cf. sigesbeckiae, is a significant soybean [Glycine max (L.) Merr.] disease in regions with hot and humid conditions causing yield loss in the United States and Canada. There is limited information regarding resistant soybean cultivars, and there have been marginal efforts to identify the genomic regions underlying resistance to CLB. A Genome-Wide Association Study was conducted using a diverse panel of 460 soybean accessions from maturity groups III to VII to identify the genomic regions associated to the CLB disease. These accessions were evaluated for CLB in different regions of the southeastern United States over 3 years. In total, the study identified 99 Single Nucleotide Polymorphism (SNPs) associated with the disease severity and 85 SNPs associated with disease incidence. Across multiple environments, 47 disease severity SNPs and 23 incidence SNPs were common. Candidate genes within 10 kb of these SNPs were involved in biotic and abiotic stress pathways. This information will contribute to the development of resistant soybean germplasm. Further research is warranted to study the effect of pyramiding desirable genomic regions and investigate the role of identified genes in soybean CLB resistance.

Characterization of QoI-Fungicide Resistance in Cercospora Isolates Associated with Cercospora Leaf Blight of Soybean from the Southern United States.

Cercospora leaf blight (CLB) of soybean, caused by Cercospora cf. flagellaris, C. kikuchii, and C. cf. sigesbeckiae, is an economically important disease in the southern United States. Cultivar resistance to CLB is inconsistent; therefore, fungicides in the quinone outside inhibitor (QoI) class have been relied on to manage the disease. Approximately 620 isolates from plants exhibiting CLB were collected between 2018 and 2021 from 19 locations in eight southern states. A novel polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay based on two genes, calmodulin and histone h3, was developed to differentiate between the dominant species of Cercospora, C. cf. flagellaris, and C. cf. sigesbeckiae. A multilocus phylogenetic analysis of actin, calmodulin, histone h3, ITS rDNA, and transcription elongation factor 1-α was used to confirm PCR-RFLP results and identify remaining isolates. Approximately 80% of the isolates collected were identified as C. cf. flagellaris, while 15% classified as C. cf. sigesbeckiae, 2% as C. kikuchii, and 3% as previously unreported Cercospora species associated with CLB in the United States. PCR-RFLP of cytochrome b (cytb) identified QoI-resistance conferred by the G143A substitution. Approximately 64 to 83% of isolates were determined to be QoI-resistant, and all contained the G143A substitution. Results of discriminatory dose assays using azoxystrobin (1 ppm) were 100% consistent with PCR-RFLP results. To our knowledge, this constitutes the first report of QoI resistance in CLB pathogen populations from Alabama, Arkansas, Kentucky, Mississippi, Missouri, Tennessee, and Texas. In areas where high frequencies of resistance have been identified, QoI fungicides should be avoided, and fungicide products with alternative modes-of-action should be utilized in the absence of CLB-resistant soybean cultivars.

Investigations into Economic Returns Resulting from Foliar Fungicides and Application Timing on Management of Tar Spot in Indiana Hybrid Corn.

Tar spot, caused by Phyllachora maydis, is the most significant yield-limiting disease of corn (Zea mays L.) in Indiana. Currently, fungicides are an effective management tool for this disease, and partial returns from their use under different disease severity conditions has not previously been studied. Between 2019 and 2021, two separate field experiments were conducted in each year in Indiana to assess the efficacy of nine foliar fungicide products and nine fungicide application timings based on corn growth stages on tar spot symptoms and stromata, canopy greenness, yield, and influence on partial returns. All fungicides evaluated significantly suppressed tar spot development in the canopy and increased canopy greenness over the nontreated control. Additionally, applications of mefentrifluconazole + pyraclostrobin, metconazole + pyraclostrobin, cyproconazole + picoxystrobin at tassel, and propiconazole + benzovindiflupyr + azoxystrobin between the tassel and dough growth stages were the most effective at significantly reducing disease severity, increasing canopy greenness, protecting yield, and offered the greatest partial return. Fungicide products varied in their ability to protect yield under low and high disease severity conditions relative to the nontreated control. Consistently, positive yield increases were observed when disease severity was high, which translated to greater profitability relative to low severity conditions. On average, the yield increases across foliar fungicide products and timed application treatments were 544.6 and 1,020.7 kg/ha greater, and partial returns using a grain value of $0.17/kg were $92.6/ha and $173.5/ha greater, respectively, when high severity conditions occurred. This research demonstrates that foliar fungicides and appropriately timed fungicide applications can profitably be used to manage tar spot in Indiana under high disease severity conditions.

Uncovering the environmental conditions required for Phyllachora maydis infection and tar spot development on corn in the United States for use as predictive models for future epidemics.

Phyllachora maydis is a fungal pathogen causing tar spot of corn (Zea mays L.), a new and emerging, yield-limiting disease in the United States. Since being first reported in Illinois and Indiana in 2015, P. maydis can now be found across much of the corn growing regions of the United States. Knowledge of the epidemiology of P. maydis is limited but could be useful in developing tar spot prediction tools. The research presented here aims to elucidate the environmental conditions necessary for the development of tar spot in the field and the creation of predictive models to anticipate future tar spot epidemics. Extended periods (30-day windowpanes) of moderate mean ambient temperature (18-23 °C) were most significant for explaining the development of tar spot. Shorter periods (14- to 21-day windowpanes) of moisture (relative humidity, dew point, number of hours with predicted leaf wetness) were negatively correlated with tar spot development. These weather variables were used to develop multiple logistic regression models, an ensembled model, and two machine learning models for the prediction of tar spot development. This work has improved the understanding of P. maydis epidemiology and provided the foundation for the development of a predictive tool for anticipating future tar spot epidemics.

First report of areolate mildew of cotton, caused by Ramulariopsis pseudoglycines in Mississippi.

In August of 2022, cotton (Gossypium hirsutum L.) growing in several north central Mississippi counties was observed to exhibit yellowish lesions on the adaxial leaf surface with white powdery fungal growth on the corresponding abaxial surface. By the end of the 2022 growing season, 19 Mississippi counties were observed to have infected cotton. Symptomatic leaves were collected from affected plants, sealed in plastic freezer bags, stored on ice in a cooler, and transported to the laboratory. Prior to isolation, the pathogen was microscopically examined and determied to be morphologically similar to the description of Ramulariopsis spp. (Ehrlich and Wolf 1932). Using a sterile needle, conidia were transferred to V8 medium amended with chloramphenicol (75 mg/liter) and streptomycin sulfate (125 mg/liter) and incubated in the dark at 25°C. After 14 days, the colony diameter was measured, and morphological characteristics were consistent with previous descriptions (Videira et al. 2016; Volponi et al. 2014). On V8 medium, the 7 mm diameter colonies grew raised, lumpy, and lobed, with iron-grey coloration. The mycelia were hyaline, septate, branched, and 1 to 3 µm in diameter. Conidia ranged from 2.8 to 25.6 µm in length and 1.0 to 4.9 µm in width (x = 12.8 × 3.1 µm; n = 20). Pure cultures were obtained on V8 medium, and DNA was extracted from a 14-day-old-culture. TW098-22, a representative isolate, was amplified, and sequenced targeting the internal transcribed spacer (ITS), translation elongation factor 1-α (TEF 1-α), and actin (ACT) genes as described by Videira et al. (2016). The consensus sequences were deposited in GenBank (accession no. OQ653427, OR157986, OR157987). BLASTn query of the NCBI GenBank showed 100% identity of the 483-bp (ITS) and 706-bp TEF 1-α sequences from TW098-22 with Ramulariopsis pseudoglycines CPC 18242 (type culture; Videira et al. 2016). Koch's postulates were performed after multiplying individual colonies by streaking on V8 medium as above. Culture plates were subsequently incubated at 25°C for 14 days in the dark. Colonies were aseptically transferred to 50 ml centrifuge tubes containing 50 ml of autoclaved reverse osmosis (RO) water amended with Tween 20 (0.01%). The resulting inoculum suspension was adjusted to 13.5 × 105 conidia/ml using a hemocytometer. The foliage of five, 25-day-old cotton plants were sprayed with 10 ml of the suspension and a plastic bag was placed over each plant to maintain humidity for 30 days. Five plants were sprayed with sterilized RO water to serve as controls. Plants were incubated in a growth chamber at 25°C and ~70% relative humidity with 16:8 h of light:dark. Thirty days post-inoculation, foliar symptoms and signs were observed on all inoculated plants including small necrotic lesions and white powdery growth. Control plants remained asymptomatic. The trial was repeated. When reisolated, the colony and conidia morphology and DNA sequence (ITS) were consistent with the description of the original field isolate. Areolate mildew of cotton can be caused by two species of Ramulariopsis: R. gossypii and R. pseudoglycines (Videira et al. 2016). The two species have been reported in Brazil (Mathioni et al. 2021); however, this is the first report of R. pseudoglycines in the United States. In addition, even though areolate mildew has previously been reported from much of the southeastern U.S. (Anonymous 1960), the report herein serves as the first description of R. pseudoglycines in Mississippi and U.S. cotton.

Efficacy and Profitability of Fungicides for Managing Frogeye Leaf Spot on Soybean in the United States: A 10-Year Quantitative Summary.

Frogeye leaf spot (FLS), caused by Cercospora sojina, is an economically important disease of soybean in the United States. Data from 66 uniform fungicide trials (UFTs) conducted from 2012 to 2021 across eight states (Alabama, Arkansas, Illinois, Iowa, Kentucky, Louisiana, Mississippi, and Tennessee) were gathered and analyzed to determine the efficacy and profitability of the following fungicides applied at the beginning pod developmental stage (R3): azoxystrobin + difenoconazole (AZOX + DIFE), difenoconazole + pydiflumetofen (DIFE + PYDI), pyraclostrobin (PYRA), pyraclostrobin + fluxapyroxad + propiconazole (PYRA + FLUX + PROP), tetraconazole (TTRA), thiophanate-methyl (TMET), thiophanate-methyl + tebuconazole (TMET + TEBU), and trifloxystrobin + prothioconazole (TFLX + PROT). A network meta-analytic model was fitted to the log of the means of FLS severity data and to the nontransformed mean yield for each treatment, including the nontreated. The percent reduction in disease severity (%) and the yield response (kg/ha) relative to the nontreated was the lowest for PYRA (11%; 136 kg/ha) and the greatest for DIFE + PYDI (57%; 441 kg/ha). A significant decline in efficacy over time was detected for PYRA (18 percentage points [p.p.]), TTRA (27 p.p.), AZOX + DIFE (18 p.p.), and TMET + TEBU (19 p.p.) by using year as a continuous covariate in the model. Finally, probabilities of breaking even were the greatest (>65%) for the most effective fungicide DIFE + PYDI and the lowest (<55%) for PYRA. Results of this meta-analysis may be useful to support decisions when planning fungicide programs.

Meta-Analytic Modeling of the Severity-Yield Relationships in Soybean Frogeye Leaf Spot Epidemics.

Frogeye leaf spot (FLS), caused by Cercospora sojina, is an important foliar disease affecting soybean in the United States. A meta-analytic approach including 39 fungicide trials conducted from 2012 to 2021 across eight states (Alabama, Arkansas, Illinois, Iowa, Kentucky, Louisiana, Mississippi, Tennessee) was used to assess the relationship between FLS severity and soybean yield. Correlation and regression analyses were performed separately to determine Fisher's transformation of correlation coefficients (Zr), intercept (ß0) and slope (ß1). Disease pressure (low severity, ≤34.5; high severity, >34.5%) and yield class (low, ≤3,352; high, >3,352 kg/ha) were included as categorical moderators. Pearson's [Formula: see text], obtained from back-transforming the [Formula: see text]r estimated by an overall random-effects model, showed a significant negative linear relationship between FLS severity and yield ([Formula: see text] = -0.60). The [Formula: see text]r was affected by disease pressure (P = 0.0003) but not by yield class (P = 0.8141). A random-coefficient model estimated a slope of -19 kg/ha for each percent severity for a mean attainable yield of 3,719.9 kg/ha. Based on the overall mean (95% CI) of the intercept and slope estimated by the random-coefficients model, the estimated overall relative damage coefficient was 0.51% (0.36 to 0.69), indicating that a percent increase in FLS severity reduced yield by 0.51%. The best model included yield class as a covariate, and population-average intercepts differed significantly between low (3,455.1 kg/ha) and high (3,842.7 kg/ha) yield classes. This highlights the potential impact of FLS on soybean yield if not managed and may help in disease management decisions.

Effects of using rigid tape with bandaging techniques on wrist joint motion during boxing shots in elite male athletes.

OBJECTIVES: To investigate the effects of bandaging techniques on wrist motion on impact during different shot types in elite male boxers. DESIGN: Repeated-measures study. SETTING: Field Experiment PARTICIPANTS: Two shot types, straight and bent arm, were assessed with 18 elite male boxers wearing either bandage only or bandage plus tape. MAIN OUTCOMES MEASURES: Wrist motions and time to peak wrist angles, on impact, were measured with an electromagnetic tracking system. RESULTS: Wrist motion on impact occurred concurrently in flexion and ulnar deviation for both shot types. For both motions, significant (p < 0.001) effects for bandaging techniques (η2 = 0.580-0.729) and shot types (η2 = 0.165-0.280) were observed. For straight and bent arm shots, wrist motion on impact occurred within 50% and 40% respectively of total active wrist motion for bandage only compared to within 20% and 15% for bandage plus tape. Time to peak wrist angle on impact increased significantly (p < 0.001) for both shot types when adding tape to bandage. CONCLUSIONS: Adding tape provided an additional 25-30% reduction in wrist motion compared to bandage only, with a 1.2-1.4 increase in time to peak wrist angle, on impact for both shot types. This information could assist various individuals and organisations towards better hand-wrist protection.

Defining Fungicide Resistance Mechanisms in the Corynespora cassiicola Population from Mississippi Soybean.

Target spot, caused by Corynespora cassiicola, is a common lower canopy soybean disease in the southern United States. Recently, target spot has resurged in importance especially following the identification of resistance to the quinone outside inhibitor (QoI) fungicides. As a result, a survey of C. cassiicola from soybean throughout Mississippi began in 2018. A total of 819 C. cassiicola monoconidial isolates were obtained from 228 fields in 75 counties. The molecular mechanism of QoI resistance was determined, which resulted from an amino acid substitution from glycine (G) to alanine (A) at position 143 using a PCR-RFLP method and comparing nucleotide sequences of the cytochrome b gene. Five previously defined geographic regions were used to present the distribution of the G143A substitution and included the Capital, Coast, Delta, Hills, and Pines. The Capital had the greatest proportion of G143A-containing isolates (95.0%), followed by the Coast (92.9%), Delta (89.8%), Pines (78.8%), and Hills (69.4%). In all, 85.8% of the C. cassiicola isolates carried the G143A substitution. In addition, the effective fungicide concentration (EC50) of randomly selected C. cassiicola isolates to azoxystrobin was used to characterize isolates as resistant (n = 14) (based on the presence of the G143A substitution and EC50 values >52 µg/ml) or sensitive (n = 11) (based on the absence of the G143A substitution and EC50 values <46 µg/ml). The EC50 values varied among isolates (P < 0.0001), with QoI-sensitive isolates exhibiting lower EC50 values than QoI-resistant isolates. The current study revealed that a reduction in sensitivity to QoI fungicides has likely resulted based on the percentage of C. cassiicola isolates containing the G143A substitution identified in Mississippi.

Interchangeability of optical tracking technologies: potential overestimation of the sprint running load demands in the English Premier League.

PURPOSE: The purpose of this study was to assess the agreement between match-derived running load outputs; total distance (TD), high-speed running (HSR) and sprint distance (SPR) obtained by two optical tracking systems. METHODS: Data were collected from 31 elite footballers from the first team and under-21 squads of an English Premier League (EPL) football club across three competitive matches. One EPL game (game 2) and one under-21 Premier League game (game 3) were played at the team's home stadium and one EPL game (game 1) at an away venue. All matches were tracked concomitantly using eight colour cameras sampling at 10 Hz (PROZONE®) and six high-definition motion cameras sampling at 25 Hz (TRACAB®). RESULTS: TD displayed a perfect (r = 0.99) correlation while HSR and SPR displayed very large (r = 0.81 and r = 0.73) correlations between TRACAB® and PROZONE®. Mean biases were 5% for TD, -3% for HSR and 61% for SPR. Between games, mean biases for TD were 6% for game 1, and 5% for game 2 and game 3. For HSR, 9% for game 1, -5% for game 2 and 6% for game 3 and for SPR, 31% for game 1, 71% for game 2 and 84% for game 3. CONCLUSION: TD and HSR can be interchanged between PROZONE® and TRACAB®, to allow accurate interpretation between the two optical systems. PROZONE® overestimated SPR compared to the TRACAB®, with the magnitude of difference considered meaningful, altering interpretation of historical match outputs, sprint volume trends in the EPL and forecasts of the modern game.

Evaluating In Vitro Fitness Parameters of G143A-Containing and Wild-Type Corynespora cassiicola Isolates from Mississippi Soybean.

Quinone outside inhibitor (QoI) fungicides have been widely used to manage diseases of soybean including target spot caused by Corynespora cassiicola. However, resistance to QoI fungicides has recently been reported within the C. cassiicola population from Alabama, Arkansas, Mississippi, and Tennessee as a result of isolates in the population containing the G143A amino acid substitution. Therefore, the relative fitness and stability of isolates containing the G143A substitution compared with wild-type C. cassiicola isolates from Mississippi soybean were investigated by analyzing several fitness parameters in vitro. In addition, in vivo virulence assays were conducted in the greenhouse on a target spot-susceptible cultivar. The evaluations of fitness considered the difference between isolates from the wild-type and G143A-containing genotypes by evaluating colony growth parameters following the first and the 10th subcultures on microbiological media. When considered as an average of all G143A-containing isolates, the G143A-containing isolates following the 10th subculture produced 6.2% greater colony diameter growth but produced 2.3% less conidia. Conversely, over the same period, wild-type isolates produced 6.7% less colony growth but produced 10.9% more conidia. Based on our results, the C. cassiicola isolates that contained the G143A substitution appear stable since successive subculturing did not significantly affect the measured fitness parameters. The lack of fitness cost accompanying the genotypic shift to the G143A amino acid substitution which confers fungicide resistance in C. cassiicola indicates that these isolates may have fitness advantages and may remain stable in the population as well as displace wild-type isolates with repeated fungicide applications of QoI-containing products.

First report of pothos latent virus infecting upland cotton (Gossypium hirsutum) in the United States.

Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al. 2016; Kumar et al. 2001). PoLV has not been previously reported on the American continent. During 2019, we carried out a state-wide, RT-PCR-based survey for cotton leafroll dwarf virus (CLRDV), as previously described (Aboughanem-Sabanadzovic et al. 2019). Plants exhibiting symptoms reported associated with CLRDV (Avelar et al. 2019) were collected from cotton fields throughout Mississippi. Samples consisted of individually bagged, six inch-long, apical portions collected from five to twelve cotton plants per field. At the end of the season, the total RNAs extracted from a subset of CLRDV-infected samples using a Spectrum RNA extraction kit (Sigma, St Louis, MO), were randomly selected for additional characterization by Illumina 150 nt paired-end high-throughput sequencing at the UIUC Core Sequencing Facility (University of Illinois, Urbana, IL). De novo assembly of 46 to 60 million raw reads/sample was performed by metaSPAdes (Nurk et al. 2017). In addition to several CLRDV-specific contigs, analyses of 184,173 contigs assembled from a sample collected in Clay County (lab code CL-112) revealed a large contig # 63556 of 4298 nt in size with identities ranging from 90.5% to 94.3% with three PoLV genome sequences available in GenBank, suggesting that an isolate of this virus (PoLV-cot; GenBank OP584699) was coinfecting the sample along with CLRDV. Sequence analyses showed that contig #63556 represents approx. 97-98% of the entire PoLV-cot genome. To verify HTS data, specific primers (PoLV-F 5'ACATATATCAGAGAGAGCTCAGGTC3' and PoLV-R 5'GCTCCCATGACAGACCTCACT3') were designed on conserved sequences of all four PoLV genomes and used in a single-tube RT-PCR. The initial tests on RNAs from CL-112 and six other samples from the same field confirmed PoLV-cot infections in the original and an additional cotton plant. Sanger sequencing of the two 294 bp-long RT-PCR products revealed >99% nt mutual identity and 97.5-99% with PoLV isolates. However, none of the additional 226 cotton samples collected in 2019 across the state of Mississippi and 12 samples collected in the same field in 2020 tested positive for PoLV-cot. At this moment, it is not clear whether the PoLV infections originated from infected seeds or, more likely, from soil-borne inoculum. Indeed, several aureusviruses are known to be transmitted by soil either involving vectors belonging to the fungal genera Olpidium and/or Polymyxa (i.e., cucumber leaf spot virus, maize white line mosaic virus), or in a vectorless manner (Rochon et al. 2012). Previous studies on this virus demonstrated low-rate experimental transmission through the soil with no apparent involvement of specific vectors (Chen et al. 2016; Kumar et al. 2001; Sabanadzovic et al. 1995). In summary, results of our study indicate an original report of PoLV on the North American continent, along with description of a new host. Possible impact of PoLV-cot on the cotton industry, or any other susceptible crop in the US, is yet to be understood. Funding: This work has been partially supported by financial support from Cotton Inc, Cotton Foundation, USDA-ARS 58-6066-9-033 and 2020 MAFES-SRI grants. NAS and SS acknowledge partial support from the National Institute of Food and Agriculture, US Department of Agriculture, Hatch Projects Numbers 7001412 and1021494, respectively. The author(s) declare no conflict of interest. 1. Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis 103: 1798. 2. Avelar, S., et al. 2019. Plant Dis 103: 592. 3. Chen, Y-K., et al. 2016. J Phytopath 164: 650. 4. Kumar, P.L., et al. 2001. Plant Dis 85: 208. 5. Martelli, G.P., et al. 1998. Arch Virol 143: 1847. 6. Nurk, S., et al. 2017. Genome Res 27: 824. 7. Rochon, D., et al. 2012. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam, NL, Elsevier Academic Press, pp 1111-1138. 8. Rubino, L., et al. 1995. J Gen Virol 76: 2835. 9. Sabanadzovic, S., et al.1995. Eur J Plant Pathol 101:171.

First Report of Neocosmospora Stem Rot of Soybean Caused by Fusarium neocosmosporiellum in Mississippi.

In September 2021, diseased soybean [Glycine max (L.) Merr.] plants were observed in a commercial field in Lamar County, Mississippi (MS). Foliar symptoms included mild interveinal chlorosis and necrosis in the affected plants (Fig. 1a). Stems and roots exhibited orange to black lesions and pith discoloration (Fig. 1b). Signs of the fungus included orange-to-red spherical perithecia, observed in clusters on crowns and roots. Perithecia were surface-sterilized with 70% ethanol for 1 min. Subsequently they were gently pressed in a droplet of 5 µl of sterilized reverse osmosis (RO) water and the suspension was streaked onto potato dextrose agar (PDA) amended with chloramphenicol (75 mg/liter) and streptomycin sulfate (125 mg/liter). Plates were incubated in the dark at 25°C. White to light pink and floccose mycelia developed after four days of incubation and hyaline, one celled, cylindrical to oblong-ellipsoidal microconidia were observed (Fig. 2b; ×400). Conidia measured 8.8 to 19 × 2.8 to 5 µm (n=15). Abundant orange to brown perithecia developed on PDA after three weeks of incubation (Fig. 2a). The asci within the perithecia were cylindrical, eight-spored, thin walled and measured 94.6 to 123.6 µm × 10 to 14 µm (n=10). Ascospores were uniseriate, globose to ellipsoidal, hyaline to brown and measured 11.6 to 16 µm × 7 to 10 µm (n=10; Fig. 2c). The morphological characteristics were consistent with those of Fusarium neocosmosporiellum O'Donnell & Geiser (≅ Neocosmospora vasinfecta E. F. Sm.; Geiser et al. 2013). Genomic DNA was extracted from isolate TW068-21 from a 3-week-old culture plate. The internal transcribed spacer region (ITS), elongation factor 1-alpha (EF1-alpha) and calmodulin (cmdA) gene were amplified, and consensus sequences deposited in GenBank (OM640625, OM681343, OM681344). ITS and EF1-alpha sequence comparison using NCBI BLAST, showed > 99.2% similarity with N. vasinfecta JL2210 while cmdA sequence was 99.8% similar to strain CBS 517.71. A pathogenicity test was performed on 2-week-old Asgrow 46X6 soybean seedlings grown in 10.2 cm pots in a growth chamber. Isolate TW068-21 was grown on antibiotic-amended PDA for 4-weeks and inoculum suspension was prepared with sterilized RO water and adjusted to 2 × 105 ascospores/ml. Soybean seedlings (n=8) were removed from pots and roots were dipped into the inoculum suspension for 20 min. Four control plants were dipped in autoclaved RO water. Plants were re-planted in potting mix, and the inoculated plants were immediately drenched with 20 ml of the inoculum and placed in a growth chamber (25°C; 14 h light). The experiment was repeated once. Inoculated plants presented dark brown discoloration at the base of the stem after 3 weeks of incubation, but no foliar lesions were observed. Control plants remained asymptomatic. Symptomatic stems were placed in a moist chamber (≈23°C; 12 h:h light:dark) and light brown perithecia developed after 1 week. Fusarium neocosmosporiellum was re-isolated from perithecia and stems and colony and spore morphology were similar as described above. To our knowledge, this is the first report of F. neocosmosporiellum in MS. Signs and symptoms of this disease resemble red crown rot. Consequently, careful morphological and molecular assessments should be used for confirmation. Neocosmospora stem rot has been previously reported in Alabama (Gray et al. 1980), Arkansas (Greer et al. 2015), and Georgia (Phillips 1972). Yield losses due to this pathogen in MS are currently unknown.

Meta-Analysis of the Field Efficacy of Seed- and Soil-Applied Nematicides on Meloidogyne incognita and Rotylenchulus reniformis Across the U.S. Cotton Belt.

Meta-analysis was used to compare yield protection and nematode suppression provided by two seed-applied and two soil-applied nematicides against Meloidogyne incognita and Rotylenchulus reniformis on cotton across 3 years and several trial locations in the U.S. Cotton Belt. Nematicides consisted of thiodicarb- and fluopyram-treated seed, aldicarb and fluopyram applied in furrow, and combinations of the seed treatments and soil-applied fluopyram. The nematicides had no effect on nematode reproduction or root infection but had a significant impact on seed cotton yield response ([Formula: see text]), with an average increase of 176 and 197 kg/ha relative to the nontreated control in M. incognita and R. reniformis infested fields, respectively. However, because of significant variation in yield protection and nematode suppression by nematicides, five or six moderator variables (cultivar resistance [M. incognita only], nematode infestation level, nematicide treatment, application method, trial location, and growing season) were used depending on nematode species. In M. incognita-infested fields, greater yield protection was observed with nematicides applied in furrow and with seed-applied + in-furrow than with solo seed-applied nematicide applications. Most notable of these in-furrow nematicides were aldicarb and fluopyram (>131 g/ha) with or without a seed-applied nematicide compared with thiodicarb. In R. reniformis-infested fields, moderator variables provided no further explanation of the variation in yield response produced by nematicides. Furthermore, moderator variables provided little explanation of the variation in nematode suppression by nematicides in M. incognita- and R. reniformis-infested fields. The limited explanation by the moderator variables on the field efficacy of nematicides in M. incognita- and R. reniformis-infested fields demonstrates the difficulty of managing these pathogens with nonfumigant nematicides across the U.S. Cotton Belt.

Morphometrics for sports mechanics: Showcasing tennis racket shape diversity.

Tennis racket design has changed from its conception in 1874. While we know that modern tennis rackets are lighter and have larger heads than their wooden predecessors, it is unknown how their gross shape has changed specifically. It is also unknown how racket shape is related to factors that influence performance, like the Transverse and Polar moments of inertia. The aim of this study was to quantify how tennis racket shape has changed over time, with a view to furthering our understanding of how such developments have influenced the game. Two-dimensional morphometric analysis was applied to silhouettes extracted from photographs of 514 rackets dating from 1874 to 2017. A principal component analysis was conducted on silhouette outlines, to allow racket shape to be summarised. The rackets were grouped by age and material for further analysis. Principal Component 1 accounted for 87% of the variation in racket shape. A pairwise Pearson's correlation test indicated that head width and length were both strongly correlated to Principal Component 1 (r = 0.916 & r = 0.801, p-values<0.001). Principal Component 1 was also correlated to the Polar (r = 0.862, p<0.001) and Transverse (r = -0.506, p<0.001) moments of inertia. Racket age and material had a medium (p<0.001, η2p = 0.074) and small (p = 0.015, η2p = 0.017) effect on Principal Component 1, respectively. Mean racket shapes were also generated from the morphometric analyses for the material and age groupings, and we consider how these shape changes may have influenced performance and injury risk. These mean shape groupings could support the development of models, such as finite element analysis, for predicting how historical developments in tennis equipment have affected performance and injury risk.

Investigating Foot Morphology in Rock Climbing Mammals: Inspiration for Biomimetic Climbing Shoes.

The sporting goods sector can serve as a proving ground for new technologies. We propose that climbing shoes are an excellent case study for showcasing a systematic approach to bio-inspired design. Foot adaptations to climbing have been described before in some animals and have even been incorporated into bio-inspired products. However, there has not yet been a systematic description of climbing adaptations in mammals, and especially in rock climbing species. We present a description of foot morphology in mammals and compare rock climbing species to those with other locomotion types. Our results show that rock climbing species in our sample had fewer digits and larger anterior pads than arboreal species. Rock climbing species often had hooves or, if they had foot pads, these were relatively smooth. These examples look a bit like current climbing shoe designs, perhaps suggesting convergent evolution. However, there was also variation, with rock climbing species having pads varying in shape, placement and texture. Much of this variation is likely to be dependent on the relatedness of species, with those that are more related having more similar feet. We suggest that incorporation of novel textures and compliant pads might be an interesting focus for future climbing shoe designs.

Xylaria necrophora, sp. nov., is an emerging root-associated pathogen responsible for taproot decline of soybean in the southern United States.

Taproot decline (TRD) is a disease of soybean that has been reported recently from the southern United States (U.S.). Symptoms of TRD include foliar interveinal chlorosis followed by necrosis. Darkened, charcoal-colored areas of thin stromatic tissue are evident on the taproot and lateral roots along with areas of necrosis within the root and white mycelia within the pith. Upright stromata typical of Xylaria can be observed on crop debris and emerging from infested roots in fields where taproot decline is present, but these have not been determined to contain fertile perithecia. Symptomatic plant material was collected across the known range of the disease in the southern U.S., and the causal agent was isolated from roots. Four loci, ⍺-actin (ACT), ß-tubulin (TUB2), the nuclear rDNA internal transcribed spacers (nrITS), and the RNA polymerase subunit II (RPB2), were sequenced from representative isolates. Both maximum likelihood and Bayesian phylogenetic analyses showed consistent clustering of representative TRD isolates in a highly supported clade within the Xylaria arbuscula species complex in the "HY" clade of the family Xylariaceae, distinct from any previously described taxa. In order to understand the origin of this pathogen, we sequenced herbarium specimens previously determined to be "Xylaria arbuscula" based on morphology and xylariaceous endophytes collected in the southern U.S. Some historical specimens from U.S. herbaria collected in the southern region as saprophytes as well as a single specimen from Martinique clustered within the "TRD" clade in phylogenetic analyses, suggesting a possible shift in lifestyle. The remaining specimens that clustered within the family Xylariaceae, but outside of the "TRD" clade, are reported. Both morphological evidence and molecular evidence indicate that the TRD pathogen is a novel species, which is described as Xylaria necrophora.

Diaporthe Seed Decay of Soybean [Glycine max (L.) Merr.] Is Endemic in the United States, But New Fungi Are Involved.

Diaporthe seed decay can compromise seed quality in soybean [Glycine max (L.) Merr.] in the warm and humid production areas of the United States during crop maturation. In the current study, 45 isolates of Diaporthe were recovered from seed sampled from soybean fields affected by Diaporthe-associated diseases in eight U.S. states in 2017. The isolates obtained belonged to 10 species of Diaporthe based on morphology and phylogenetic analyses of the internal transcribed spacer, partial translation elongation factor 1-α, and ß-tubulin gene sequences. The associated species included D. aspalathi, D. caulivora, D. kongii, D. longicolla, D. sojae, D. ueckerae, D. unshiuensis, and three novel fungi, D. bacilloides, D. flavescens, and D. insulistroma. One isolate each of the 10 species was examined for pathogenicity on seed of cultivar Sava under controlled conditions. Seven days postinoculation, significant differences in the percentages of decayed seeds and seedling necrosis were observed among the isolates and the noninoculated control (P < 0.0001). While the isolates of D. bacilloides, D. longicolla, and D. ueckerae caused a significantly greater percentage of decayed seeds (P < 0.0001), the isolate of D. aspalathi caused the greatest seedling necrosis (P < 0.0001). The observation of new fungi causing Diaporthe seed decay suggests the need for a more comprehensive survey in U.S. soybean producing areas since members of the genus Diaporthe appear to form a complex that causes seed decay.

Modeling the relationship between estimated fungicide use and disease-associated yield losses of soybean in the United States II: Seed-applied fungicides vs seedling diseases.

Use of seed-applied fungicides has become commonplace in the United States soybean production systems. Although fungicides have the potential to protect seed/seedlings from critical early stage diseases such as damping-off and root/stem rots, results from previous studies are not consistent in terms of seed-applied fungicide's ability to mitigate yield losses. In the current study, the relationship between estimated soybean production losses due to seedling diseases and estimated seed-applied fungicide use was investigated using annual data from 28 soybean growing states in the U.S. over the period of 2006 to 2014. National, regional (northern and southern U.S.), state, and temporal scale trends were explored using mixed effects version of the regression analysis. Mixed modeling allowed computing generalized R2 values for conditional (R2GLMM(c); contains fixed and random effects) and marginal (R2GLMM(m); contains only fixed effects) models. Similar analyses were conducted to investigate how soybean production was related to fungicide use. National and regional scale modeling revealed that R2GLMM(c) values were significantly larger compared to R2GLMM(m) values, meaning fungicide use had limited utility in explaining the national/regional scale variation of yield loss and production. The state scale analysis revealed the usefulness of seed-applied fungicides to mitigate seedling diseases-associated soybean yield losses in Illinois, Indiana, North Carolina, and Ohio. Further, fungicide use positively influenced the soybean production and yield in Illinois and South Dakota. Taken together, use of seed-applied fungicide did not appear to be beneficial to many of the states. Our findings corroborate the observations made by a number of scientists through field scale seed-applied fungicide trials across the U.S and reiterate the importance of need base-use of seed-applied fungicides rather than being a routine practice in soybean production systems.