The E35 stopper mutant of Neurospora crassa: precise localization of deletion endpoints in mitochondrial DNA and evidence that the deleted DNA codes for a subunit of NADH dehydrogenase.

Two types of defective mitochondrial DNA molecules with large deletions (5 kbp and 40 kbp) have previously been identified in the stopper mutant, E35, of Neurospora crassa. The junction fragments spanning the deletion endpoints have now been cloned and sequenced, and their sequences compared with those of the corresponding wild-type fragments. We show that both types of defective mitochondrial DNAs result from deletions of sequences flanked by short direct repeats, which are themselves parts of larger inverted repeat sequences. In every case, the short direct repeat sequences consist of a run of pyrimidines in one strand and purines in the other. We also report the sequence of a 2151-bp HindIII fragment, which is deleted in both of the defective mitochondrial DNAs. Besides the previously identified gene for a methionine tRNA, the 2151-bp DNA sequence contains an open reading frame with the potential to code for a hydrophobic protein 583 amino acids long. This hydrophobic protein has three blocks of significant homology with proteins coded by URF2 found in other mitochondrial genomes. Since the mammalian mitochondrial URF2 has recently been shown to code for a subunit of NADH dehydrogenase, part of the DNA sequence missing in the E35 stopper mutant of N. crassa may also code for a subunit of NADH dehydrogenase.

RNA processing in Neurospora crassa mitochondria: use of transfer RNA sequences as signals.

We have used RNA gel transfer hybridization, S1 nuclease mapping and primer extension to analyze transcripts derived from several genes in Neurospora crassa mitochondria. The transcripts studied include those for cytochrome oxidase subunit III, 17S rRNA and an unidentified open reading frame. In all three cases, initial transcripts are long, include tRNA sequences, and are subsequently processed to generate the mature RNAs. We find that endpoints of the most abundant transcripts generally coincide with those of tRNA sequences. We therefore conclude that tRNA sequences in long transcripts act as primary signals for RNA processing in N. crassa mitochondria. The situation is somewhat analogous to that observed in mammalian mitochondrial systems. The difference, however, is that in mammalian mitochondria, noncoding spacers between tRNA, rRNA and protein genes are very short and in many cases non-existent, allowing no room for intergenic RNA processing signals whereas, in N. crassa mtDNA, intergenic non-coding sequences are usually several hundred nucleotides long and contain highly conserved GC-rich palindromic sequences. Since these GC-rich palindromic sequences are retained in the processed mature RNAs, we conclude that they do not serve as signals for RNA processing.

A selenium-containing nucleoside at the first position of the anticodon in seleno-tRNAGlu from Clostridium sticklandii.

In previous studies, the single selenonucleoside component of a selenium-containing tRNAGlu isolated from Clostridium sticklandii has been shown to be 5-methyl-aminomethyl-2-selenouridine. Here, we show that this selenonucleoside is most likely located at the "wobble" position of the anticodon of the clostridial seleno-tRNAGlu. Nuclease T1 digestion of this seleno-tRNAGlu generated one major selenium-containing oligonucleotide (25 bases long). The selenium-containing residue within this oligonucleotide was located by sequence analysis of the oligonucleotide before and after removal of selenium by treatment with cyanogen bromide. The sequence of this oligonucleotide, A-A-C-C-G-C-C-C-U-U+-U-C-A+C-G-G-C-G-G-U-A-A-C-A-G, is homologous to that of the Escherichia coli tRNAGlu2 from residues 27 to 50, including the anticodon region and the variable loop, except that the E. coli tRNA has 5-methylaminomethyl-2-thiouridine instead of the selenonucleoside.

Expression of a X. laevis tRNATyr gene in mammalian cells.

Expression of a X. laevis tRNATyr gene has been studied in mammalian cells. This tRNATyr gene has a 13 base intervening sequence adjacent to its anticodon. A fragment containing the tRNATyr gene was cloned into the late region of SV40. Cells infected with a recombinant virus stock vastly overproduce a tRNATyr that is properly spliced, processed and modified. It was also found that the X. laevis tRNATyr is identical or nearly identical to an endogenous tRNATyr of monkey kidney cells. The possibility of using the X. laevis tRNATyr gene to create an amber suppressor for mammalian cells is discussed.

Dispersed 5S RNA genes in N. crassa: structure, expression and evolution.

The 5S RNA genes (5S genes) in N. crassa are not tandemly arranged or tightly clustered as in other eucaryotes that have been examined. 55 RNA or cloned 5S DNA hybridizes to at least 30 different restriction fragments of Neurospora DNA. Of 34 5S DNA clones examined, each contains a single 5S gene. Saturation hybridization analyses indicate that there are about 100 copies of 5S genes in the genome of this organism. We have partially or completely sequenced the 5S region of 15 clones. Both identical and highly divergent 5S coding regions were found. Nine are of one type (alpha). The other six include four different types (beta, beta', gamma and delta) which differ from each other and from the alpha genes to various degrees. Eleven of 15 genes have distinct flanking regions. Analysis of Neurospora 5S RNA showed that it consists of one principal species which matches the alpha-type gene sequence. Additional 5S species corresponding to the less abundant 5S gene types were also detected. The pattern of nucleotide substitutions between the predicted Neurospora 5S RNAs and between these and S. cerevisiae 5S RNA suggests that a particular 5S RNA secondary structure occurs in vivo and is conserved.

Novel features in the genetic code and codon reading patterns in Neurospora crassa mitochondria based on sequences of six mitochondrial tRNAs.

We report the sequences of Neurospora crassa mitochondrial alanine, leucine(1), leucine(2), threonine, tryptophan, and valine tRNAs. On the basis of the anticodon sequences of these tRNAs and of a glutamine tRNA, whose sequence analysis is nearly complete, we infer the following: (i) The N. crassa mitochondrial tRNA species for alanine, leucine(2), threonine, and valine, amino acids that belong to four-codon families (GCN, CUN, ACN, and GUN, respectively; N = U, C, A, or G) all contain an unmodified U in the first position of the anticodon. In contrast, tRNA species for glutamine, leucine(1), and tryptophan, amino acids that use codons ending in purines (CA(G) (A), UU(G) (A), and UG(G) (A), respectively) contain a modified U derivative in the same position. These findings and the fact that we have not detected any other isoacceptor tRNAs for these amino acids suggest that N. crassa mitochondrial tRNAs containing U in the first position of the anticodon are capable of reading all four codons of a four-codon family whereas those containing a modified U are restricted to reading codons ending in A or G. Such an expanded codon-reading ability of certain mitochondrial tRNAs will explain how the mitochondrial protein-synthesizing system operates with a much lower number of tRNA species than do systems present in prokaryotes or in eukaryotic cytoplasm. (ii) The anticodon sequence of the N. crassa mitochondrial tryptophan tRNA is U(*)CA and not CCA or CmCA as is the case with tryptophan tRNAs from prokaryotes or from eukaryotic cytoplasm. Because a tRNA with U(*)CA in the anti-codon would be expected to read the codon UGA, as well as the normal tryptophan codon UGG, this suggests that in N. crassa mitochondria, as in yeast and in human mitochondria, UGA is a codon for tryptophan and not a signal for chain termination. (iii) The anticodon sequences of the two leucine tRNAs indicate that N. crassa mitochondria use both families of leucine codons (UU(A) (G) and CUN; N = U, C, A, or G) for leucine, in contrast to yeast mitochondria [Li, M. & Tzagoloff, A. (1979) Cell 18, 47-53] in which the CUA leucine codon and possibly the entire CUN family of leucine codons may be translated as threonine.

The nucleotide sequence of phenylalanine tRNA from the cytoplasm of Neurospora crassa.

The phenylalanine tRNA from the cytoplasm of Neurospora crassa has been purified and sequenced. The sequence is: pGCGGGUUUAm2GCUCA (N) GDDGGGAGAGCm22GpsiCAGACmUGmAAYApsim5CUGAAGm7GDm5CGUGUGTpsiCGm1AUCCACACAAACCGCACCAOH. Both in the nature of modified nucleotides which are present in this tRNA and in the overall sequence, this tRNA resembles more closely phenylalanine tRNAs of eukaryotic cytoplasm than those of prokaryotes. The sequence of this tRNA differs from those of the corresponding tRNAs of wheat germ and yeast by only 6 and 7 nucleotides respectively out of 76 nucleotides.U

Mapping and cloning of Neurospora crassa mitochondrial transfer RNA genes.

We have obtained collections of recombinant Escherichia coli plasmids containing restriction fragments of Neurospora crassa mitochondrial DNA cloned into pBR322. By hybridization of 32P end-labeled total mitochondrial tRNAs and seven different purified tRNAs to restriction digests of mitochondrial DNA and of recombinant plasmids carrying specific restriction fragments, we have located the tRNA genes on the mitochondrial DNA. We have found that the mitochondrial tRNA genes are present in two major clusters, one between the two ribosomal RNA genes and the second closely following the large rRNA gene. Only one of the two DNA strands within these clusters codes for tRNAs. All of the genes for the seven specific purified tRNAs examined--those for alanine, formylmethionine, leucine 1, leucine 2, threonine, tyrosine, and valine--lie within these clusters. Interestingly, the formylmethionine tRNA hybridizes to two loci within one of these gene clusters. We have obtained a fairly detailed restriction map of part of this cluster and have shown that the two "putative" genes for formylmethionine tRNA are not arranged in tandem but are separated by more than 900 base pairs and by at least two other tRNA genes, those for alanine and for leucine 1 tRNAs.

Interesting and unusual features in the sequence of Neurospora crassa mitochondrial tyrosine transfer RNA.

The mitochondrial tyrosine tRNA from Neurospora crassa has been sequenced and found to have several interesting features: (i) It resembles prokaryotic rather than eukaryotic tyrosine tRNAs in that it possesses a large variable loop (loop III); moreover, it can be quantitatively aminoacylated by Escherichia coli tyrosyl-tRNA synthetase but not by yeast tyrosyl-tRNA synthetase. (ii) This tRNA differs from all tRNA's sequenced to date in lacking the A residue at position 14 and the constant purine residue at position 15, two nucleosides that have been found so far in loop I of all tRNA's and that have been implicated in base-base tertiary interactions, respectively, with the universal U residue at position 8 and the constant pyrimidine residue at the end of loop III. (iii) Unlike the N. crassa mitochondrial initiator tRNA, this tRNA contains the usual TpsiC sequence in loop IV and the highly conserved GG sequence in loop I common to other tRNAs.

Sequence analysis of 5'[32P] labeled mRNA and tRNA using polyacrylamide gel electrophoresis.

Sequence analysis of 5'-[32P] labeled tRNA and eukaryotic mRNA using an adaptation of a method recently described by Donis-Keller, Maxam and Gilbert for mapping guanines, adenines and pyrimidines from the 5'-end of an RNA is described. In addition, a technique utilizing two-dimensional polyacrylamide gel electrophoresis for identification of pyrimidines within a sequence is described. 5'-[32P] Labeled rabbit beta-globin mRNA and N. crassa mitochondrial initiator tRNA were partially digested with T1- RNase for cleavage at G residues, with U2-RNase for cleavage at A residues, with an extracellular RNase from B. cereus for cleavage at pyrimidine residues and with T2-RNase or with alkali for cleavage at all four residues. The 5'-[32P] labeled partial digestion products were separated according to their size, by electrophoresis in adjacent lanes of a polyacrylamide slab gel and the location of G's, A's and of pyrimidines extending 60-80 nucleotides from the 5'-end of the RNA determined. Two-dimensional polyacrylamide gel electrophoresis was used to separate the 5'-[32P] labeled fragments present in partial alkali digests of a 5'-[32P] labeled mRNA. The mobility shifts corresponding to the difference of a C residue were distinct from those corresponding to a U residue and this formed the basis of a method for distinguishing between the pyrimidines.

Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.