Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 8 de 8
Filter
Add more filters










Database
Language
Publication year range
1.
J Pers Med ; 13(12)2023 Nov 26.
Article in English | MEDLINE | ID: mdl-38138875

ABSTRACT

Interleukin-1-receptor-associated kinase 4 (IRAK4) possesses a crucial function in the toll-like receptor (TLR) signaling pathway, and the dysfunction of this molecule could lead to various infectious and immune-related diseases in addition to cancers. IRAK4 genetic variants have been linked to various types of diseases. Therefore, we conducted a comprehensive analysis to recognize the missense variants with the most damaging impacts on IRAK4 with the employment of diverse bioinformatics tools to study single-nucleotide polymorphisms' effects on function, stability, secondary structures, and 3D structure. The residues' location on the protein domain and their conservation status were investigated as well. Moreover, docking tools along with structural biology were engaged in analyzing the SNPs' effects on one of the developed IRAK4 inhibitors. By analyzing IRAK4 gene SNPs, the analysis distinguished ten variants as the most detrimental missense variants. All variants were situated in highly conserved positions on an important protein domain. L318S and L318F mutations were linked to changes in IRAK4 secondary structures. Eight SNPs were revealed to have a decreasing effect on the stability of IRAK4 via both I-Mutant 2.0 and Mu-Pro tools, while Mu-Pro tool identified a decreasing effect for the G198E SNP. In addition, detrimental effects on the 3D structure of IRAK4 were also discovered for the selected variants. Molecular modeling studies highlighted the detrimental impact of these identified SNP mutant residues on the druggability of the IRAK4 ATP-binding site towards the known target inhibitor, HG-12-6, as compared to the native protein. The loss of important ligand residue-wise contacts, altered protein global flexibility, increased steric clashes, and even electronic penalties at the ligand-binding site interfaces were all suggested to be associated with SNP models for hampering the HG-12-6 affinity towards IRAK4 target protein. This given model lays the foundation for the better prediction of various disorders relevant to IRAK4 malfunction and sheds light on the impact of deleterious IRAK4 variants on IRAK4 inhibitor efficacy.

2.
Diagnostics (Basel) ; 13(9)2023 May 02.
Article in English | MEDLINE | ID: mdl-37175004

ABSTRACT

Emerging research findings have shown that a centrosomal protein (CEP55) is a potential oncogene in numerous human malignancies. Nevertheless, no pan-cancer analysis has been conducted to investigate the various aspects and behavior of this oncogene in different human cancerous tissues. Numerous databases were investigated to conduct a detailed analysis of CEP55. Initially, we evaluated the expression of CEP55 in several types of cancers and attempted to find the correlation between that and the stage of the examined malignancies. Then, we conducted a survival analysis to determine the relationship between CEP55 overexpression in malignancies and the patient's survival. Furthermore, we examined the genetic alteration forms and the methylation status of this oncogene. Additionally, the interference of CEP55 expression with immune cell infiltration, the response to various chemotherapeutic agents, and the putative molecular mechanism of CEP55 in tumorigenesis were investigated. The current study found that CEP55 was upregulated in cancerous tissues versus normal controls where this upregulation was correlated with a poor prognosis in multiple forms of human cancers. Additionally, it influenced the level of different immune cell infiltration and several chemokines levels in the tumor microenvironment in addition to the response to several antitumor drugs. Herein, we provide an in-depth understanding of the oncogenic activities of CEP55, identifying it as a possible predictive marker as well as a specific target for developing anticancer therapies.

3.
Front Surg ; 9: 1056458, 2022.
Article in English | MEDLINE | ID: mdl-36504572

ABSTRACT

Introduction: Despite the growing popularity of laparoscopic sleeve gastrectomy (SG) for managing severe obesity in children, adolescents, and adults, there is a paucity of studies reporting the effects of SG on metabolic and hormonal outcomes in pediatric populations. Methodology: In this single-centre, retrospective study, we assessed nutritional biomarkers (hemoglobin, ferritin, iron profile, Vitamin B12, Vitamin D, and calcium), glucose homeostasis indicators (C-peptide, HbA1C, and random blood glucose), blood lipids (triglycerides and cholesterol components), hormones involved in the hypothalamic-pituitary-adrenal axis (cortisol and adrenocorticotropic hormone), and thyroid hormones (T3, T4, thyroid-stimulating hormone, and parathyroid hormone) preoperatively and 12-month after SG in children aged 5-15 years. Results: This study included 64 adolescents (mean age = 11.2 ± 2.3 years) who underwent laparoscopic SG. Significant reduction in circulatory C-peptide (-62.1%; p = 0.005), HbA1C (-10.9%; p = 0.001), random blood glucose (-15.4%; p = 0.036), and triglycerides (-39.4%; p = 0.003) were observed postoperatively at 12 months compared to baseline. Although we did not observe any changes in cortisol levels, adrenocorticotropic hormone levels declined significantly by -40.9% postoperatively (p = 0.033). However, cholesterol components, thyroid hormones, and nutritional biomarkers remained unchanged from baseline. Conclusions: Consistent with prior literature, our study demonstrates improvement or resolution of diabetes and hypertriglyceridemia in the year following SG. However, given that blood cholesterol components, nutritional biomarkers, and thyroid profiles remained unchanged warrants long-term monitoring of nutritional, metabolic, and endocrine factors in adolescents undergoing laparoscopic SG. To the best of our knowledge, this is the first study reporting the effects of SG on thyroid and hypothalamic-pituitary-adrenal axis hormones in pediatric populations.

4.
J Family Med Prim Care ; 11(9): 5340-5344, 2022 Sep.
Article in English | MEDLINE | ID: mdl-36505613

ABSTRACT

Epilepsy affects nearly 50 million people worldwide. Epilepsy can affect the quality of life of both the child and the caregiver leaving them unable to function in other areas of life. This quality of life is highly dependent on treatment adherence and how individuals feel about taking their medication. In our study, we aimed to investigate the frequency of medication adherence and the quality of life of caregivers of children with epilepsy. For this purpose, we conducted a cross-sectional survey at the Abha Maternity and Children's Hospital. We enrolled 133 consecutive participants and asked them to complete a questionnaire. The results showed that 37.6% of the participants forgot to take their medications, 9.8% of the participants reported that they were sometimes careless about giving their children medications and sometimes stopped giving them when the children were feeling better, 15.8% of the participants indicated that they sometimes stopped giving the medication when they felt that their children were getting worse when they took the medication., and 26.3% of the participants agreed that they only administered the medication when the children were sick. It was also found that the quality of life of the caregivers decreased when they forgot to give their children the medication and the quality of life of the caregivers increased when they continued to take the medication. In conclusion, quality of life increases as adherence to treatment increases, indicating that more intervention programs are needed to improve the adherence of epilepsy patients.

5.
Ann Med ; 54(1): 1938-1951, 2022 12.
Article in English | MEDLINE | ID: mdl-35801810

ABSTRACT

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.


Subject(s)
Epilepsy , NAV1.1 Voltage-Gated Sodium Channel , Epilepsy/drug therapy , Epilepsy/genetics , Humans , NAV1.1 Voltage-Gated Sodium Channel/genetics , NAV1.2 Voltage-Gated Sodium Channel/genetics , NAV1.3 Voltage-Gated Sodium Channel/genetics , Polymorphism, Genetic , Prognosis , Saudi Arabia , Sodium Channels/genetics , Voltage-Gated Sodium Channel beta-1 Subunit/genetics
6.
Medicina (Kaunas) ; 58(7)2022 Jul 20.
Article in English | MEDLINE | ID: mdl-35888681

ABSTRACT

Background and Objectives: A third of the American adult population is currently pre-diabetic/morbidly obese and is, therefore, at an elevated risk for developing type 2 diabetes. Unfortunately, such a condition does not spare children from also developing morbid obesity, where incidence rates of childhood obesity-coupled with type 2 diabetes-are markedly elevated. Laparoscopic sleeve gastrectomy (LSG) is gradually becoming the novel benchmark in bariatric surgery for the treatment of morbid obesity and associated co-morbidities, also within pediatric cases. However, no comprehensive study has been conducted in children that emphasizes the effect of LSG on HbA1C levels within such a patient population suffering from type 2 diabetes. Aim: Since HbA1C is a major biomarker for type 2 diabetes progression, this study aimed to identify any dysregulated serum levels for this key molecular player (together with other parameters), for post-surgical monitoring of the beneficial metabolic effects of LSG surgery on type 2 diabetes amelioration/remission within pediatric patients. Materials and Methods: A total of 64 pediatric patients, ranging in age from 5 to 14 years old, were enrolled in this retrospective study. Multiple laboratory-based analyses datasets were also collected from individual study participants, including HbA1C and random blood sugar (RBS). All participating patients were designated for undergoing laparoscopic sleeve gastrectomy, as per standardized surgical protocols and each participant was followed-up for two years post-surgery. Laboratory investigations were re-performed in order to identify any major variations in clinical parameters. Results: HbA1c was significantly reduced among children, from 6.0 ± 0.8 (pre-LSG) to 5.4 ± 0.4 post-surgery, with a reduction rate of 10.9% (p = 0.001). Furthermore, RBS significantly decreased from 102.9 ± 34.0 (pre-LSG) to 87.1 ± 17.3 post- surgery, with a reduction rate of 15.4% (p = 0.036). Conclusions: This study provides further concrete evidence for the beneficial metabolic influence provided by LSG surgery on morbidly obese, childhood-aged patient populations, with effectiveness in reducing co-morbidity progress, in the form of type 2 diabetes, through the reduction in HbA1c levels within such patients post-surgery.


Subject(s)
Diabetes Mellitus, Type 2 , Laparoscopy , Obesity, Morbid , Pediatric Obesity , Adolescent , Adult , Aged , Body Mass Index , Child , Child, Preschool , Diabetes Mellitus, Type 2/complications , Diabetes Mellitus, Type 2/surgery , Gastrectomy/methods , Glycated Hemoglobin , Humans , Laparoscopy/methods , Obesity, Morbid/complications , Obesity, Morbid/surgery , Retrospective Studies , Treatment Outcome , Weight Loss
7.
Case Rep Pediatr ; 2022: 1712651, 2022.
Article in English | MEDLINE | ID: mdl-35371576

ABSTRACT

Extrapulmonary manifestations of COVID-19 infection include a wide spectrum of cutaneous, endocrine, and cardiovascular complications. We report three cases of new-onset Henoch-Schonlein purpura (HSP) in COVID-19 infected children that were diagnosed and treated in Abha Maternity and Children Hospital, Saudi Arabia, between 28th July 2020 and 10th August 2020. All three cases were males younger than 5 years of age that presented with Henoch-Schonlein purpura characteristic rash and arthralgia without a recent history of any infection, especially respiratory infections. They all tested positive for COVID-19. At the time of the admission, pediatric COVID-19 cases were managed conservatively and we ruled out any other diagnosis before establishing the diagnosis of Henoch-Schonlein purpura according to the clinical picture. The three boys responded significantly to prednisolone and achieved a rapid recovery. We present the clinical scenario and laboratory tests of these children along with pictures of the lesions detected in each case.

8.
Epilepsy Behav Rep ; 16: 100442, 2021.
Article in English | MEDLINE | ID: mdl-33997759

ABSTRACT

Differences in the sociocultural practice and biases against people with epilepsy (PWE) largely contribute to the development of stigmatization. In this study, we evaluated factors that impact stigma for PWE involved in evolution and maintenance to report changes in the public awareness and cultural practices. We performed a cross-sectional study in which data were collected from a self-administered electronic survey composed of 33 items targeting the population in the Aseer region. Feedback response was obtained from 937 respondents. Of these, 921 participants (98.3%) had heard or read about the disorder previously. Approximately 84.8% believed that epilepsy was one of the brain disorders. 95.8% disagreed that epilepsy was due to a contagious disease. However, 40.1% of the responders were convinced that it was the result of a spiritual reason. Still, more than 9% believed treating PWE should be approached spiritually. About 75% felt that epilepsy could be the results of a test delievered by God. In addition to the clinical impact from seizures in PWE, it carries a social label and public stigma that influences one's social prognosis. Raising awareness through campaigns would improve the knowledge and practices of the population and hence provide a healthier environment for PWE, alleviating feelings of stigma, and improving their quality of life.

SELECTION OF CITATIONS
SEARCH DETAIL
...