Idiopathic septic arthritis of a lumbar facet joint associated with paraspinal abscess.

A 48-year-old woman presented with a 1-month history of severe lower back pain on a background of 24 h of mild fever and general tiredness with an associated right-sided foot drop. Five weeks after the onset and with no improvement in symptoms in spite of analgesia and physiotherapy, the patient had a lumbar spine MRI which demonstrated a collection extending from the facet joints of L5 and L6 to the iliacus muscle on the right. A CT-guided aspiration was performed with a lengthy hospital stay for intravenous antibiotic treatment. The culture and sensitivity study of the aspirate isolated Streptococcus pneumoniae.

Expression of CtBP family protein isoforms in breast cancer and their role in chemoresistance.

BACKGROUND INFORMATION: CtBPs [C-terminal (of E1A) binding protein] have roles in the nucleus as transcriptional co-repressors, and in the cytoplasm in the maintenance of vesicular membranes. CtBPs are expressed from two genes, CTBP1 and CTBP2, mRNA products of which are alternatively spliced at their 5'-ends to generate distinct protein isoforms. Extensive molecular and cellular analyses have identified CtBPs as regulators of pathways critical for tumour initiation, progression and response to therapy. However, little is known of the expression or regulation of CtBP isoforms in human cancer, nor of the relative contributions of CTBP1 and CTBP2 to the tumour cell phenotype. RESULTS: Expression of CtBP proteins and CTBP1 and CTBP2 mRNA splice forms in breast cancer cell lines and tumour tissue was examined. CtBP1 proteins are identifiable as a single band on Western blots and are ubiquitously detectable in breast tumour samples, by both Western blotting and immunohistochemistry. CtBP1 is present in six of six breast cancer cell lines, although it is barely detectable in SKBr3 cells due to reduced CTBP1 mRNA expression. In the cell lines, the predominant CTBP1 mRNA splice form encodes CtBP1-S protein; in tumours, both major CTBP1 mRNA splice forms are variably expressed. CtBP2 proteins are ubiquitously expressed in all lines and tumour samples. The predominant CTBP2 mRNA encodes CtBP2-L, although an alternatively spliced form that encodes CtBP2-S, previously unidentified in humans, is expressed at low abundance. Both CtBP2-L and CtBP2-S are readily detectable as two distinct bands on Western blots; here we show that the CTBP2-L mRNA is translated from two AUG codons to generate both CtBP2-L and CtBP2-S. We have also identified an autoregulatory feedback mechanism whereby CtBP protein abundance is maintained in proliferating breast cancer cells through the post-transcriptional regulation of CtBP2. This feedback is disrupted by UV-C radiation or exposure to cisplatin. Finally, we demonstrate that CtBP1 and CtBP2 both have p53-dependent and -independent roles in suppressing the sensitivity of breast cancer cells to mechanistically diverse cancer chemotherapeutic agents. CONCLUSIONS: These studies support recent evidence that CtBP family proteins represent potential targets for therapeutic strategies for the treatment of cancer in general, and breast cancer in particular.

Detection and quantitation of benzo[a]pyrene-derived DNA adducts in mouse liver by liquid chromatography-tandem mass spectrometry: comparison with 32P-postlabeling.

The polycyclic aromatic hydrocarbon, benzo[a]pyrene (B[a]P) is a proven animal carcinogen that is potentially carcinogenic to humans. B[a]P is an ubiquitous environmental pollutant and is also present in tobacco smoke, coal tar, automobile exhaust emissions, and charred food. A liquid chromatography-tandem mass spectrometry (LC-MS/MS) method using electrospray ionization and selected reaction monitoring (SRM) has been developed for the detection of 10-(deoxyguanosin-N(2)-yl)-7,8,9-trihydroxy-7,8,9,10-tetrahydrobenzo[a]pyrene (B[a]PDE-N(2)dG) adducts formed in DNA following the metabolic activation of B[a]P to benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (B[a]PDE). The method involves enzymatic digestion of the DNA sample to 2'-deoxynucleosides following the addition of a stable isotope internal standard, [(15)N(5)]B[a]PDE-N(2)dG, and then solid phase extraction to remove unmodified 2'-deoxynucleosides prior to analysis by LC-MS/MS SRM. The limit of detection of the method was 10 fmol (approximately 3 B[a]PDE-N(2)dG adducts per 10(8) 2'-deoxynucleosides) using 100 microg of calf thymus DNA as the matrix. Calf thymus DNA reacted with B[a]PDE in vitro and mouse liver DNA samples at different time points following dosing intraperitoneally with 50, 100, and 200 mg/kg B[a]P was analyzed. Three stereoisomers of the B[a]PDE-N(2)dG adduct were detected following the reaction of calf thymus DNA with B[a]PDE in vitro. The levels of B[a]PDE-N(2)dG DNA adducts in the mice livers were found to increase in a dose-dependent manner with adducts reaching maximal levels at 1-3 days and then gradually decreasing over time but still detectable after 28 days. A very good correlation (r = 0.962, p < 0.001) was observed between the results obtained for the mouse liver DNA samples using LC-MS/MS SRM as compared to those obtained using a (32)P-postlabeling method. However, the levels of adducts observed following (32)P-postlabeling using butanol enrichment were approximately 3.7-fold lower. The LC-MS/MS method allowed the more precise quantitation of DNA adduct levels that were structurally characterized, in addition to a reduction in the time taken to perform the analysis when compared with the (32)P-postlabeling method.

Specific adducts recognised by a monoclonal antibody against cisplatin-modified DNA.

Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values = from 1 to >100 pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2-7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin-DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence.