First Report of Moroccan pepper virus in Association with Yellows on Escarole in the United States and the World.

During the fall of 2013, endive (Cichorium endivia L.) and escarole (C. endivia ssp. latifolia) fields in New Jersey were found with severe disease symptoms. The cores of the heads were necrotic and rotted, while outer leaves were yellow with more pronounced yellowing of veins and occasional veinal necrosis. The disease occurred in plants grown in sandy loam soils, and developed following a period of extended soil moisture; most escarole and endive in the ground at that time developed symptoms. Similar symptoms have been observed for 15 to 20 years in the area and are commonly referred to as yellows. Initial ELISA tests (Agdia) identified tombusvirus infection in two composite samples of 10 plants each from two fields. To confirm tombusvirus infection and determine which tombusvirus was responsible, RNA was extracted from four plant samples using the RNeasy Plant Mini Kit (Qiagen). Complimentary DNA was synthesized using Maxima reverse transcriptase (Fermentas) and random primers. PCR was performed using GenScript enzymes (Genscript) and virus species specific primer sets designed to amplify a portion of the coat protein gene of either Tomato bushy stunt virus (TBSV) or Moroccan pepper virus (MPV) (2,3), the two tombusviruses responsible for a disease of lettuce that develops under similar environmental conditions. All samples tested negative for TBSV, but one sample of escarole was positive for MPV using primers MPVcp2766F 5' CGGTAAGATTGTAGGGTTCATGGTGG 3'; and MPVcp3603R 5' TGCTCCAGTGTCACGGAAGT 3', which amplify an 837-nt section of the MPV coat protein gene. Direct sequencing confirmed 94% identity with an isolate of MPV from Japan (AB704411) and 97% identity to isolates from Morocco (JX197071) and California (JN700748) (3). Secondary confirmation was obtained with an additional primer set designed to amplify a 372-nt region of ORF1 of select tombusviruses (Tombus270F 5' TGAGATACATGAGGACAGG 3'; and Tombus642R 5' AGCTTAAATACCGACAGTT 3'). Direct sequencing confirmed 96 (AB704411) to 99% (JX197071) identity to MPV isolates from Japan and Morocco, respectively. Eight additional samples of symptomatic escarole from three farms were tested, and two samples reacted positive to MPV using the methods described above. Attempts at mechanical transmission of virus from escarole to known hosts of MPV were unsuccessful; however, transmission of MPV from infected lettuce (Lactuca sativa L.) is often low efficiency as well; therefore, this result was not surprising. To our knowledge, this is the first report of MPV in escarole anywhere in the world, and the first report of MPV in a United States field crop outside of California and Arizona. MPV and TBSV are known to cause the disease, lettuce dieback, in the western United States. Like yellows on escarole, lettuce dieback is associated with saturated soils (1) and other stress factors (Wintermantel, unpublished). Further studies will be needed to determine if MPV is the sole cause of yellows in escarole and endive or if it is part of a disease complex; however, the identification of MPV in this important leafy greens production region and its association with yellowing and core rot symptoms in escarole warrant further study of the association of MPV and potentially other tombusviruses with yellows of escarole. References: (1) C. Obermeier et al. Phytopathology 91:797, 2001. (2) W. M. Wintermantel and A. G. Anchieta. Arch. Virol. 157:1407, 2012. (3) W. M. Wintermantel and L. L. Hladky. Phytopathology 105:501, 2013.

Different TBX5 interactions in heart and limb defined by Holt-Oram syndrome mutations.

To better understand the role of TBX5, a T-box containing transcription factor in forelimb and heart development, we have studied the clinical features of Holt-Oram syndrome caused by 10 different TBX5 mutations. Defects predicted to create null alleles caused substantial abnormalities both in limb and heart. In contrast, missense mutations produced distinct phenotypes: Gly80Arg caused significant cardiac malformations but only minor skeletal abnormalities; and Arg237Gln and Arg237Trp caused extensive upper limb malformations but less significant cardiac abnormalities. Amino acids altered by missense mutations were located on the three-dimensional structure of a related T-box transcription factor, Xbra, bound to DNA. Residue 80 is highly conserved within T-box sequences that interact with the major groove of target DNA; residue 237 is located in the T-box domain that selectively binds to the minor groove of DNA. These structural data, taken together with the predominant cardiac or skeletal phenotype produced by each missense mutation, suggest that organ-specific gene activation by TBX5 is predicated on biophysical interactions with different target DNA sequences.

Immortalized rat proximal tubule cells produce membrane bound and soluble megalin.

Megalin (gp330), a glycoprotein receptor found on renal proximal tubule cells and several other epithelial cells, is deduced to be a type I integral membrane protein, but may also exist as a cell surface form lacking a cytoplasmic domain. Furthermore, soluble megalin products have been detected in urine, and in culture medium of a rat yolk sac carcinoma cell line, combined with receptor associated protein (RAP). Permanent renal cell lines expressing megalin were unavailable until the recent description of two immortalized rat proximal tubule cell lines (IRPTC). The present study demonstrated megalin on IRPTC surface by immunofluorescence, without surface staining for RAP, which was, however, readily detected within cells. Antibodies to ectodomain megalin epitopes immunoprecipitated megalin products both from cell lysates and culture medium, whereas antibodies to cytoplasmic domain epitopes precipitated megalin only from lysates. Western blots showed two major megalin products in medium, a prominent band at approximately 200 kDa, and a fainter band above 400 kDa, slightly below intact megalin in cell lysates. Anti-receptor associated protein antibodies immunoprecipitated megalin from IRPTC lysates, but not from media. We propose that portions of megalin are spontaneously produced by IRPTC, probably either by cleavage in the ectodomain or release of forms lacking a cytoplasmic domain.

Mutations in human TBX5 [corrected] cause limb and cardiac malformation in Holt-Oram syndrome.

Holt-Oram syndrome is characterized by upper limb malformations and cardiac septation defects. Here, we demonstrate that mutations in the human TBX5 gene underlie this disorder. TBX5 was cloned from the disease locus on human chromosome 12q24.1 and identified as a member of the T-box transcription factor family. A nonsense mutation in TBX5 causes Holt-Oram syndrome in affected members of one family; a TBX5 missense mutation was identified in affected members of another. We conclude that TBX5 is critical for limb and heart development and suggest that haploinsufficiency of TBX5 causes Holt-Oram syndrome.

Temperature-sensitive SV40 immortalized rat proximal tubule cell line has functional renin-angiotensin system.

Immortalized rat proximal tubule cell (IRPTC) lines should be useful for investigation of proximal tubule (PT) regulation and function but previously have been unavailable. We now report the establishment and characterization of an immortalized transformed, temperature-sensitive IRPTC cell line containing renin-angiotensin system (RAS) components. Primary PT cells prepared from male Wistar rats (4-5 wk old) after collagenase digestion, sieving, and Percoll gradient were cultured on collagen-coated T-75 flasks in Dulbecco's modified Eagle's medium containing 5% fetal calf serum. Subconfluent PT cells were transfected with the temperature-sensitive SV40 mutant viruses (tsA SV40) by direct exposure. After 7-8 wk, several clones were obtained, from which one has been characterized and designated as line 3-2. This cell line appears stable up to 45 passages. Clonal cells transformed with this virus exhibit a transformed phenotype at a permissive temperature of 34 degrees C and grow in multiple layers. When the cells are subsequently placed at a nonpermissive temperature of 41 degrees C, they return to morphology similar to that of untransformed cells of the same lineage. At either 34 degrees C or 41 degrees C, this cell line expresses a variety of PT markers including alkaline phosphatase, cytokeratin, carbonic anhydrase, and glucose transporter isoform 2 (GLUT2), while not expressing factor VIII. Uniquely, these cells also appear to express PT proteins gp330 and CHIP28, markers which are usually lost in cultured cells. Furthermore, the cell line expresses protein and mRNA components of RAS, including angiotensinogen, angiotensin converting enzyme, and renin. The IRPTC cell line expresses few angiotensin II (ANG II) receptors at 34 degrees C, the permissive temperature. However, at the nonpermissive temperature, 41 degrees C, IRPTC expresses ANG II receptor (dissociation constant of 0.7 nM; maximum binding capacity of 265 fmol/mg protein). ANG II (10(-8) M) induced a transient rise in cytoplasmic Ca2+ concentration, which was nearly abolished with losartan but not PD-123319, suggesting this finding is AT1 receptor mediated. This cell line should provide an excellent model of PT and should make it possible to study the cell and molecular biology of the RAS, as well as other regulatory systems of the PT.

Water channel expression in human ADPKD kidneys.

Cyst enlargement in autosomal dominant polycystic kidney disease (ADPKD) results in part from the transport of solute and fluid into the lumen of the cyst. In proximal tubules and thin descending limbs of normal kidneys, the high transepithelial water permeability of these segments is due to the presence of the water channel protein, aquaporin-CHIP (AQP-CHIP, i.e., AQP-1). The collecting ducts of normal kidneys express another member of this gene family, the aquaporin collecting duct (AQP-CD, i.e., AQP-2). The expression and distribution of these two members of the aquaporin gene family were examined in ADPKD and normal human kidneys. In both tissues, Western blotting with the anti-AQP-CHIP antibody revealed a major 28-kDa band. By immunofluorescence, AQP-CHIP was present in proximal tubules and thin descending limbs of Henle of both normal and ADPKD kidneys. In the latter, AQP-CHIP was detected in the epithelia lining 71% of cysts. Many cysts were positive for the proximal tubule marker gp330 (44%). Some cysts expressing AQP-CHIP did not stain for gp330, suggesting a descending thin limb origin, and a few cysts were negative for both markers. In normal human kidney, Western blotting with the anti-AQP-CD antibody revealed a band at 28 kDa. AQP-CD was localized to collecting ducts and did not show colocalization with gp330 in normal human kidney. In ADPKD kidney, AQP-CD was expressed by only 8% of cysts. In summary, water channels, primarily AQP-CHIP, are expressed in epithelial cells lining cysts in approximately 80% of cysts in ADPKD kidneys.(ABSTRACT TRUNCATED AT 250 WORDS)

Expression of gp330 and gp330/alpha 2-macroglobulin receptor-associated protein in renal tubular differentiation.

The gp330/alpha 2-macroglobulin receptor-associated protein (RAP) is a 39- to 45-kd protein that binds to the low-density lipoprotein receptor-related protein/alpha 2-macroglobulin receptor and to gp330, a major glycoprotein of the brush border of proximal tubule cells. Despite evidence that gp330 functions as a receptor for several ligands and that soluble RAP inhibits ligand binding to gp330 in vitro, the physiologic function of RAP is unknown. Given the predominant location of RAP within the rough endoplasmic reticulum (RER), RAP might be involved in the intracellular processing and/or transport of gp330. The developing rat kidney was used as a dynamic model to study in detail the relationship between gp330 and RAP in vivo by immunohistochemical techniques. RAP was expressed in the renal vesicle and continued to be present, with a vesicular and perinuclear pattern of staining, in both proximal tubule cells and glomerular cells at subsequent stages. Immunoperoxidase electron microscopy demonstrated RAP in cisternae of the RER and in large subapical vesicles. gp330 was initially expressed in early proximal tubule cells in S-shaped bodies and was located in the perinuclear envelope and cytoplasmic vesicles as well as at the apical surface. Cytoplasmic gp330 staining was more evident at a stage subsequent to the S-shaped body, possibly related to more active biosynthesis. By comparative analysis of the patterns of immunofluorescence and immunoperoxidase staining, gp330 and RAP colocalized in the RER and in some large subapical vacuoles, but no definite RAP staining could be detected at the surface of proximal tubule cells at any stage, despite the presence of abundant gp330 in this location. The expression of gp330 at the apical surface of immature tubular cells was associated with the onset of fluid-phase endocytosis of fluoroscein isothiocyanate-dextran and, therefore, of reabsorption of material from the tubular lumen, in the absence of concomitant changes in RAP expression in the same cells. These findings indicate that the role of endogenous RAP may not be directly related to ligand binding of gp330 at the surface of proximal tubule cells, although RAP may be involved in the processing and the intracellular trafficking of newly synthesized gp330, in particular in the delivery of gp330 to the plasma membrane.

Organ distribution in rats of two members of the low-density lipoprotein receptor gene family, gp330 and LRP/alpha 2MR, and the receptor-associated protein (RAP).

We investigated immunohistochemically the distribution in rats of the homologous proteins gp330 and the LDL receptor-related protein (LRP/alpha 2MR), and a receptor-associated protein (RAP), and the sites to which soluble exogenous RAP binds. We found gp330 in a restricted group of epithelial cells, including renal proximal tubule cells, podocytes, Type II pneumocytes, cells of the parathyroid, thyroid, epididymis, lining of the uterus, ependyma, retina, ciliary body, yolk sac, and placenta. In these cells gp330 was detected mainly at the cell surface, except for parathyroid and retinal epithelial cells, where diffuse cell staining was found. LRP/alpha 2MR was widely distributed in interstitial cells, notably in fibroblasts and macrophages, and was also present in a selected group of epithelial or specialized cells, including hepatocytes, adrenal cortical cells, follicular cells of the ovary, cells of the choroid plexus, ciliary body, mesangial cells, and some neurons. In certain cells, notably hepatocytes and adrenal cortical cells, LRP/alpha 2MR was detected mainly on the surface, but in others, including macrophages, fibroblasts, and epithelial cells of the choroid plexus and ciliary body, staining throughout the cell was seen. The only cells that clearly expressed both LRP/alpha 2MR and gp330 were retinal and ciliary epithelial cells. RAP was found in intracellular vesicles in all cells that expressed gp330 or LRP/alpha 2MR. RAP was not definitely detected on the cell surface. Binding sites for RAP were found on the surface of those cells with surface gp330 or LRP, and also throughout the cytoplasm in cells with diffuse cellular LRP/alpha 2MR or gp330. Because of their different locations, we conclude that gp330 and LRP/alpha 2MR serve distinct functions in vivo, despite similarities in ligand-binding properties observed in vitro. Since RAP is found largely within cells, its major physiological function may be concerned with intracellular assembly or trafficking of the receptors to which it binds.

Mapping of the glycoprotein 330 (Gp330) gene to mouse chromosome 2.

Glycoprotein 330 (Gp330) is a member of the low-density lipoprotein receptor gene family that is expressed in the kidney. We have mapped the Gp330 gene to mouse chromosome 2, 4.5 cM proximal to Acra, in an interspecific backcross of (C57BL/6J x Mus spretus) F1 x C57BL/6J.

Detection of two forms of GP330. Their role in Heymann nephritis.

Heymann nephritis is characterized by glomerular immune deposits that contain a glycoprotein called gp330. The deposits are believed to result from shedding of immune complexes formed on podocytes. Complexes are also shed from proximal tubule cells, when antibodies combine with gp330 on the cell surface. We performed the present study to investigate what portion of the gp330 molecule is shed, using a rabbit antiserum against a peptide deduced to be in the cytoplasmic domain of gp330, as well as a rabbit antiserum and two monoclonal antibodies that recognize extracellular epitopes of gp330. The anti-cytoplasmic peptide antiserum precipitated from Fx1A (a crude renal cortical membrane preparation), a protein with a mass of about 440 kd that was reactive with two monoclonal anti-gp330 antibodies. (In our experiments, the protein called gp330 generally has a mass estimated to be about 440 kd.) The anti-cytoplasmic peptide antiserum also reacted with a truncated gp330 protein produced in transfected COS cells. Immunohistochemical studies showed that all the antibodies recognized the same group of epithelial cells. However, as seen in immunoultrastructural studies of proximal tubules, the anti-cytoplasmic peptide antiserum reacted only with components at the base of microvilli, whereas the anti-gp330 ectodomain antibodies identified material not only at the base, but over the surface of microvilli as well. In rats with Heymann nephritis, glomerular deposits and material shed into tubule lumens reacted with antibodies against extracellular epitopes of gp330, but not with the anti-cytoplasmic peptide antiserum. We propose that there are two forms of gp330 on the cell surface of proximal renal tubules. One form is restricted to coated pit regions at the base of microvilli and has a cytoplasmic domain containing a sequence deduced from a partial complementary DNA encoding gp330. The other form is present over microvilli (and possibly at the base of microvilli as well) and lacks the cytoplasmic domain deduced from the complementary DNA. The complexes that are shed in Heymann nephritis contain either a portion of gp330 cleaved from the full-length molecule or a form of gp330 that lacks the cytoplasmic domain.

Location of gp330/alpha 2-m receptor-associated protein (alpha 2-MRAP) and its binding sites in kidney: distribution of endogenous alpha 2-MRAP is modified by tissue processing.

The alpha 2-macroglobulin receptor-associated protein (alpha 2-MRAP) is a 39 to 44 kDa protein that copurifies with the alpha 2-macroglobulin receptor (alpha 2-MR/LRP) and also with gp330, a highly glycosylated protein located within kidney proximal tubules and glomerular podocytes. Both gp330 and the alpha 2-macroglobulin receptor are members of the low density lipoprotein receptor family but the physiological ligands for gp330 are unknown. In order to understand potential functions of the alpha 2-MRAP, specific anti-alpha 2-MRAP antibodies were used for immunocytochemical studies on paraformaldehyde lysine periodate (PLP)-fixed rat kidneys and on snap-frozen/acetone-fixed tissue. Conflicting results were obtained. After PLP fixation, alpha 2-MRAP was detected almost exclusively in rough endoplasmic reticulum (RER) cisternae; cell surface staining was virtually absent. In snap-frozen tissue, intense staining of the proximal tubule brush border was found, with little or no cytoplasmic staining. A series of experiments showed that during incubation of snap-frozen tissues, endogenous alpha 2-MRAP is released in soluble form from its intracellular location (i.e., the RER) and binds to gp330 on the brush border of proximal tubules. The location of binding sites for alpha 2-MRAP in rat kidney was also examined, using an alpha 2-MRAP-IgG fusion protein. In both snap-frozen and PLP-fixed tissues, this probe bound exclusively to brush borders, and not to intracellular sites. Our results demonstrate: a) that in renal proximal tubule cells, alpha 2-MRAP is located predominantly in the RER, b) that alpha 2-MRAP-binding sites are present on gp330, which is on the proximal tubule brush border, and c) that the apparent brush border localization of alpha 2-MRAP detected in snap-frozen sections is due to an artifactual redistribution of endogenous alpha 2-MRAP that occurs during tissue processing.

Mutational analysis of a patient with mucopolysaccharidosis type VII, and identification of pseudogenes.

PCR of cDNA produced from patient fibroblasts allowed us to determine the paternal mutation in the first patient reported with beta-glucuronidase-deficiency mucopolysaccharidosis type VII (MPS VII). The G-->T transversion 1,881 bp downstream of the ATG translation initiation codon destroys an MboII restriction site and converts Trp627 to Cys (W627C). Digestion of genomic DNA PCR fragments with MboII indicated that the patient and the father were heterozygous for this missense mutation in exon 12. Failure to find cDNAs from patient RNA which did not contain this mutation suggested that the maternal mutation leads to greatly reduced synthesis or reduced stability of mRNA from the mutant allele. In order to identify the maternal mutation, it was necessary to analyze genomic sequences. This approach was complicated by the finding of multiple unprocessed pseudogenes and/or closely related genes. Using PCR with a panel of human/rodent hybrid cell lines, we found that these pseudogenes were present over chromosomes 5-7, 20, and 22 and the Y chromosome. Conditions were defined which allowed us to amplify and characterize genomic sequences for the true beta-glucuronidase gene despite this background of related sequences. The patient proved to be heterozygous for a second mutation, in which a C-->T transition introduces a termination codon (R356STOP) in exon 7. The mother was also heterozygous for this mutation. Expression of a cDNA containing the maternal mutation produced no enzyme activity, as expected. Expression of the paternal mutation in COS-7 cells produced a surprisingly high (65% of control) level of activity. However, activity was 13% of control in transiently transfected murine MPS VII cells. The level of activity of this mutant allele appears to correlate with the level of overexpression, suggesting that high concentrations of mutant monomers can drive the folding and tetramerization of mutant enzyme to produce an active and stable enzyme.

Cloning and characterization of the human beta-glucuronidase gene.

We have isolated a cosmid clone that contains GUSB, the human gene encoding beta-glucuronidase. The 21-kb gene contains 12 exons ranging from 85 to 376 bp in length. Exon 6 corresponds to the 153-bp deletion in the shorter of two types of cDNAs reported earlier, supporting the hypothesis that this cDNA arose by alternate splicing leading to exon skipping. The insert contains 4.2 kb of sequence upstream from the first exon and 6 kb 3' of the last exon. The clone expresses human beta-glucuronidase in stably transformed rat XCtk- cells. Comparison of the human gene organization with that recently reported for the murine beta-glucuronidase gene revealed that the intron/exon boundaries are identical. In the splice junctions, the most highly conserved regions are those identified as consensus sequences, and these are at least as highly conserved as bases encoding the translated portion of the gene.