[Health status and quality of life in ß-thalassemia adults in Marseille, France]. / État de santé et qualité de vie des patients ß-thalassémiques adultes à Marseille, France.

INTRODUCTION: The life expectancy of ß-thalassemia patients has increased over the last 20 years. In this study, we evaluated the current health status and quality of life of these patients managed in a reference center in Marseille. METHODS: This is a single-center, descriptive study conducted between June and August 2019 in patients over 18 years of age with ß-thalassemia major or intermedia. Clinical and paraclinical data were collected retrospectively and the SF-36 health survey questionnaire was proposed to each patient. RESULTS: 43 of 64 selected patients were included and divided into 2 groups: 35 patients with transfusion-dependent ß-thalassemia and 8 patients with non-transfusion-dependent ß-thalassemia. Liver iron overload is the most frequent complication, present in 80% of transfusion-dependent and 62.5% of non-transfusion-dependent patients. Cardiac iron overload is present only in the transfusion dependent ß-thalassemia group (20%). Hypogonadotropic hypogonadism remains the most common endocrine disorder (41.9%) followed by osteoporosis (37.2%). Among the 31 patients who completed the SF-36 questionnaire, physical and mental quality of life scores were lowered in transfusion dependent (respectively 42.7 and 46.8) as in non-transfusion-dependent patients (respectively 43.8 and 28.9). CONCLUSION: Despite an improvement in medical care, our patients with ß-thalassemia show an alteration in their quality of life that will need to be characterized in the entire French cohort.

New KCNN4 Variants Associated With Anemia: Stomatocytosis Without Erythrocyte Dehydration.

The K+ channel activated by the Ca2+, KCNN4, has been shown to contribute to red blood cell dehydration in the rare hereditary hemolytic anemia, the dehydrated hereditary stomatocytosis. We report two de novo mutations on KCNN4, We reported two de novo mutations on KCNN4, V222L and H340N, characterized at the molecular, cellular and clinical levels. Whereas both mutations were shown to increase the calcium sensitivity of the K+ channel, leading to channel opening for lower calcium concentrations compared to WT KCNN4 channel, there was no obvious red blood cell dehydration in patients carrying one or the other mutation. The clinical phenotype was greatly different between carriers of the mutated gene ranging from severe anemia for one patient to a single episode of anemia for the other patient or no documented sign of anemia for the parents who also carried the mutation. These data compared to already published KCNN4 mutations question the role of KCNN4 gain-of-function mutations in hydration status and viability of red blood cells in bloodstream.

Dunnigan lipodystrophy syndrome: French National Diagnosis and Care Protocol (PNDS; Protocole National de Diagnostic et de Soins).

Dunnigan syndrome, or Familial Partial Lipodystrophy type 2 (FPLD2; ORPHA 2348), is a rare autosomal dominant disorder due to pathogenic variants of the LMNA gene. The objective of the French National Diagnosis and Care Protocol (PNDS; Protocole National de Diagnostic et de Soins), is to provide health professionals with a guide to optimal management and care of patients with FPLD2, based on a critical literature review and multidisciplinary expert consensus. The PNDS, written by members of the French National Reference Center for Rare Diseases of Insulin Secretion and Insulin Sensitivity (PRISIS), is available on the French Health Authority website (in French). Dunnigan syndrome is characterized by a partial atrophy of the subcutaneous adipose tissue and by an insulin resistance syndrome, associated with a risk of metabolic, cardiovascular and muscular complications. Its prevalence, assessed at 1/100.000 in Europe, is probably considerably underestimated. Thorough clinical examination is key to diagnosis. Biochemical testing frequently shows hyperinsulinemia, abnormal glucose tolerance and hypertriglyceridemia. Elevated hepatic transaminases (hepatic steatosis) and creatine phosphokinase, and hyperandrogenism in women, are common. Molecular analysis of the LMNA gene confirms diagnosis and allows for family investigations. Regular screening and multidisciplinary monitoring of the associated complications are necessary. Diabetes frequently develops from puberty onwards. Hypertriglyceridemia may lead to acute pancreatitis. Early atherosclerosis and cardiomyopathy should be monitored. In women, polycystic ovary syndrome is common. Overall, the management of patients with Dunnigan syndrome requires the collaboration of several health care providers. The attending physician, in conjunction with the national care network, will ensure that the patient receives optimal care through regular follow-up and screening. The various elements of this PNDS are described to provide such a support.

Mutations in NBAS and SCYL1, genetic causes of recurrent liver failure in children: Three case reports and a literature review.

Acute liver failure (ALF) in childhood is a life-threatening emergency. ALF is often caused by drug toxicity, autoimmune hepatitis, inherited metabolic diseases, and infections. However, despite thorough investigations, a cause cannot be determined in approximately 50% of cases. Here, we report three cases with recurrent ALF caused by NBAS and SCYL1 pathogenic variants. These patients did not present with any other phenotypic sign usually associated with NBAS and SCYL1 pathogenic variants. Two of them underwent liver transplantation and are healthy without recurrence of ALF. We propose NBAS and SCYL1 genetic analysis in children with unexplained fever-triggered recurrent ALF even without a typical phenotype.

Primary red cell hydration disorders: Pathogenesis and diagnosis.

Hydration status is critical for erythrocyte survival and is mainly determined by intracellular cation content. Active pumps, passive transporters, and ion channels are the key components of volume homeostasis, whereas water passively fits ionic movements. Whenever cation content increases, erythrocyte swells, whereas it shrinks when cation content decreases. Thus, inappropriate cation leak causes erythrocyte hydration disorders, hemolytic anemia, and characteristic red cell shape abnormalities named stomatocytosis. All types of stomatocytosis either overhydrated or dehydrated are linked to inherited or de novo mutations in genes encoding ion transporters or channels. Although intracellular ion content can be assessed by experimental methods, laboratory diagnosis is guided by a combination of red blood cell parameters and deformability measurement when possible, and confirmed by sequencing of the putative genes. A better knowledge of the mechanisms underlying erythrocyte hydration imbalance will further lead to therapeutic improvements.

[NISCH syndrome, a rare cause of neonatal cholestasis: A case report]. / Le syndrome NISCH, une cause rare de cholestase néonatale : à propos d'un cas.

NISCH syndrome is a rare autosomal recessive disease. It is characterized by scalp hypotrichosis, scarring alopecia, ichthyosis, and neonatal sclerosing cholangitis. It is caused by mutations in the CLDN1 gene encoding the claudin-1 protein, which is located at tight junctions. Fifteen cases have been reported to date and three different mutations have been identified. We report on the case of a 2-year-old boy from a consanguineous Moroccan family, presenting with NISCH syndrome and carrying the so-called Moroccan homozygous mutation (c.200-201delTT). The patient presented with the characteristic symptoms of the syndrome and a favorable progression with normalization of hepatic analyses under symptomatic treatment (vitamin supplementation and ursodeoxycholic acid). The currently limited availability of clinical and therapeutic data does not allow accurate prediction of the course of the disease and short- and long-term prognosis. Moreover, substantial interindividual variability has been reported. Description of new cases will provide new insights into the understanding and the overall management of this syndrome, the course of which remains elusive.

[Next-generation DNA sequencing in clinical diagnostics]. / Le séquençage d'ADN à haut débit en pratique clinique.

The advent of next generation sequencing (NGS) technologies is so scale-changing that it modifies molecular diagnostics indications and induces laboratories to rethink their diagnostic strategies, until now based on the Sanger sequencing routine. Several high-throughput approaches are available from the sequencing of a gene panel, to an exome, or even a genome. In all cases, a tremendous amount of data is generated, which has to be filtered, interpreted and analyzed using powerful bioinformatics tools. In parallel, ethical considerations are raised to avoid the potential drifts of these powerful approaches. In all medical fields, and particularly in pediatrics, this new strategy offers better efficacy and faster mutation identification, allowing better support and care for patients and their families and even improving genetic counseling. In the present paper, we discuss the different NGS-based approaches and strategies as well as the issues involved in these new technologies applied to molecular diagnosis of rare diseases. Altogether, rare diseases affect more than 3 million people in France and are responsible for about one-third of childhood deaths.

Severe neonatal seizures: From molecular diagnosis to precision therapy?

Early onset epileptic encephalopathies (EOEE) are heterogeneous group of severe epilepsies that still need to be better defined and characterized. On a genetic point of view, several dozen of genes have been associated with EOEE, and to date, it is difficult to find a common mechanism to explain EOEE. In this short review, we show that two mains genes are involved in EOEE: STXBP1 and KCNQ2. Focusing on KCNQ2 related EOEE, we show that a relatively similar phenotype can be related to various consequences of mutations on a single gene. This will probably challenge the treatment of EOEE patients.

Analytical evaluation of the Capillarys 2 Flex piercing for routine haemoglobinopathies diagnosis.

To evaluate the analytical performance of a new capillary electrophoresis instrument, the Capillarys 2 Flex piercing (Sebia, France), allowing the separation and quantitative estimation of the different haemoglobin fractions from whole blood, in capped primary tube.The analytical precision for the determination of HbA2 and HbF percentages was satisfactory and within the range of previously published results for HPLC methods. The correlation between Capillarys 2 Flex Piercing and Bio-Rad Variant II HPLC system showed a linear correlation for HbA2, HbF and HbS measurements, and the analysis interpretation was the same whatever the method used. Conversely to HPLC method, the capillary's electrophoresis technology allowed HbE and Hb Lepore fraction separation from HbA2. We showed that the Capillarys 2 Flex Piercing is suitable for haemoglobinopathies diagnosis and screening and offers an excellent alternative to HPLC techniques as a first-line method or for confirmatory analysis.

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

[Neonatal screening for sickle cell disease at the Nice University Hospital: the last 8 years]. / Dépistage néonatal de la drépanocytose au CHU de Nice : bilan des 8 dernières années.

INTRODUCTION: Screening for sickle cell disease, the most common of recessive autosomic hemoglobin disorders, allows detection of sickle cell disease SCD (homozygous sickle cell disease, compound heterozygote SC, and S ß-thalassemia) in a target population. Our objective was to evaluate its effectiveness at the Nice University Hospital. POPULATION AND METHODS: This prospective study was conducted between 1 January 2000 and 31 December 2008. The national targeted newborn screening, run together with the Guthrie test on the 3rd day of life, offered at-risk newborns (based on ethnicity and family history), allow the detection of qualitative hemoglobin abnormalities. A confirmatory test is performed when positive. Gender, ethnicity, type of hemoglobin found, zygosity, age at diagnosis, the presence at a 2nd consultation of the families identified, and acceptance of the confirmatory test were collected and analyzed. RESULTS: A total of 19,775 children were born in Nice University Hospital during this period, among whom screening detected 151 hemoglobinopathies: 139 heterozygotes and 12 major sickle cell syndrome (9 SS and 3 S ß-thalassemia). The prevalence of SCD on the targeted and the total population was, respectively, 1 out of 659 and 1 out of 1648 and the prevalence of heterozygotes was 1 out of 57 and 1 out of 142. The sex ratio was close to 1. Hemoglobin S predominated (74% of pathogens Hb). The Maghreb and sub-Saharan Africa were the 2 main areas of origin. One hundred and four of 151 families, including 12 cases of SCD, returned to consultation after they received a letter requesting attendance at a 2nd consultation. For 80 children, the confirmatory test was accepted. Feedback was possible for 72 of the 80 families. DISCUSSION: The number of children screened is increasing, thanks to better awareness among medical staff. The prevalence of SCD and heterozygotes found in Nice University Hospital is similar to what is described in the literature. With screening, early diagnosis allows early treatment at the age of 2 months before the occurrence of complications, reducing morbidity and mortality. CONCLUSION: Screening for sickle cell disease appears effective in Nice. It seems necessary to continue focusing on the importance of screening among maternity healthcare actors.

Neonatal screening for sickle cell disease in France.

BACKGROUND: As a result of population growth in African-Caribbean regions of overseas France, and now immigration essentially from North and sub-Saharan Africa to mainland France, neonatal screening for sickle cell disease (SCD) has been performed in France since 1985 in Guadalupe and dependencies, as a universal test. After several pilot studies, screening was gradually extended to mainland France in 1996. Since 2000, the test has been performed at national level for all newborns defined as being "at risk" for SCD based on ethnic origin. METHODS: A dry blood sample is obtained by heel stick and analysed by isoelectric focusing as a first-line method, followed by either high-performance liquid chromatography or acid agar electrophoresis for confirmation, whenever a variant haemoglobin is observed on isoelectric focusing. RESULTS: In 2007, 28.45% of all newborns in mainland France were screened for SCD. Since 1996, a total of 3,890 newborns have been found to have SCD, and they have been followed up by reference paediatricians. CONCLUSION: Although screening for SCD at birth in France is not universal, it appears that missed babies are relatively infrequent. Despite obvious sociological problems inherent to the at-risk population, the follow-up of SCD babies is rather successful. Due to the birth prevalence of SCD in France, especially in comparison with other common genetic diseases, screening all newborns regardless of ethnic origin is an issue that is being addressed.

Mutations in PHD-like domain of the ATRX gene correlate with severe psychomotor impairment and severe urogenital abnormalities in patients with ATRX syndrome.

Mutations in ATRX are associated with a wide and clinically heterogeneous spectrum of X-linked mental retardation syndromes. The ATRX protein, involved in chromatin remodelling, belongs to the family of SWI/SNF DNA helicases and contains a plant homeodomain (PHD)-like domain. To date, more than 60 different mutations have been reported in ATRX. One of them is recurrent and accounts for 20% of all the reported mutations, whereas all others are private. Most mutations are clustered in the two major functional domains, the helicase and the PHD-like domain. So far, no clear genotype-phenotype correlation has been established, with exception to the rare truncating mutations located at the C-terminal part of the protein, which are consistently associated with severe urogenital defects. In this study, we report the molecular analysis performed in 16 families positive for ATRX. Our findings indicate that, in addition to the previously described mutation 'hotspot' in the PHD-like domain, two other protein sections emerge as minor 'hotspots' in the helicase region encoded by exons 18-20 and 26-29, respectively, gathering 33% of all described mutations. Additionally, based on the clinical data collected for 22 patients from the 16 families, we observe that mutations in the PHD-like domain produce severe and permanent psychomotor deficiency, usually preventing patients from walking, as well as constant urogenital abnormalities, while mutations in the helicase domain lead to delayed but correct psychomotor acquisitions together with mild or absent urogenital abnormalities. In summary, mutations in the helicase domain are associated with milder phenotypes than mutations in the PHD-like domain.

[Beta(o)/beta(o) thalassemia with a mild phenotype]. / Thalassémie beta(o)/beta(o) avec phénotype "intermédiaire": un diagnostic rare... auquel il faut penser.

We report the case of a 30 years old patient of Algerian origin, presenting a beta-thalassemia major with a phenotype of intermediate severity. Its genotype is beta(o)/beta(o), leading to a complete absence of beta-globin synthesis. This genotype is usually responsible for major clinical complications and a severe anaemia requiring regular transfusions. However, the patient presents with a mild form of the disease and a moderate relatively well tolerated anaemia. This phenotype was found related to a high level of synthesis of foetal haemoglobin, dependent most probably on an homozygous state for the polymorphism (XmnI -158, C>T) in the promoter of the Ggamma gene. This observation shows that it is important to keep in mind that beta-thalassemia major may have a mild or intermediate phenotype because of polymorphisms of the beta locus.