Abnormal hemoglobin anti-Lepore Hong Kong compound with ß0-thalassemia ameliorate thalassemia severity when co-inherited with α-thalassemia.

Abnormal hemoglobin anti-Lepore Hong Kong is a rare ßδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of ß0-thalassemia and α-thalassemia (-SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with ß0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2-40.8%) and behaved with ß-thalassemia trait. Furthermore, determination of the α/ß-mRNA ratio revealed a slight downregulation of ß-globin, similar to that of ß-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, ß0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.

Identification and characterization of CHD4-associated eRNA as a novel modulator of fetal hemoglobin levels in ß-thalassemia.

Fetal-to-adult hemoglobin switching is controlled by programmed silencing of γ-globin while the re-activation of fetal hemoglobin (HbF) is an effective strategy for ameliorating the clinical severity of ß-thalassemia and sickle cell disease. The identification of enhancer RNAs (eRNAs) related to the fetal (α2γ2) to adult hemoglobin (α2ß2) switching remains incomplete. In this study, the transcriptomes of GYPA+ cells from six ß-thalassemia patients with extreme HbF levels were sequenced to identify differences in patterns of noncoding RNA expression. It is interesting that an enhancer upstream of CHD4, an HbF-related core subunit of the NuRD complex, was differentially transcribed. We found a significantly positive correlation of eRNA-CHD4 enhancer-gene interaction using the public database of FANTOM5. Specifically, the eRNA-CHD4 expression was found to be significantly higher in both CD34+ HSPCs and HUDEP-2 than those in K562 cells which commonly expressed high level of HbF, suggesting a correlation between eRNA and HbF expression. Furthermore, prediction of transcription binding sites of cis-eQTLs and the CHD4 genomic region revealed a putative interaction site between rs73264846 and ZNF410, a known transcription factor regulating HbF expression. Moreover, in-vitro validation showed that the inhibition of eRNA could reduce the expression of HBG expression in HUDEP-2 cells. Taken together, the findings of this study demonstrate that a distal enhancer contributes to stage-specific silencing of γ-globin genes through direct modulation of CHD4 expression and provide insights into the epigenetic mechanisms of NuRD-mediated hemoglobin switching.

Activation of γ-globin expression by LncRNA-mediated ERF promoter hypermethylation in ß-thalassemia.

The mechanism that drives the switch from fetal to adult hemoglobin (Hb) provides a therapeutic target for ß-thalassemia. We have previously identified that hypermethylation of transcription factor ERF promoter reactivated γ-globin expression. To uncover the mechanism underlying the hypermethylation of ERF promoter, we performed RNA sequencing in ß0/ß0-thalassemia patients and identified an upregulated long noncoding RNA (RP11-196G18.23) associated with HbF production. RP11-196G18.23 bound to the ERF promoter and recruited DNA methyltransferase 3A to promote DNA hypermethylation-mediated ERF downregulation, thereby ameliorating ERF-induced γ-globin inactivation. The identification of RP11-196G18.23 provides an epigenetic mechanism for the reactivation of fetal γ-globin expression for ß-hemoglobinopathies.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Temporal characteristics of emotional conflict processing: the modulation role of attachment styles.

Theoretical account of attachment proposed that individual differences in adult attachment styles play a key role in adjusting balance between affective evaluation and cognitive control. Yet, little is known about the temporal characteristics of emotional conflict processing modulated by attachment styles. Accordingly, the present study used event-related potentials (ERP) and multivariate pattern analysis (MVPA) combined with an emotional face-word Stroop task to investigate the temporal dynamics of attachment-related cognitive-affective patterns in emotional conflict processing. The ERP results demonstrated multiple-process of emotional conflict modulated by attachment styles. In early sensory processing, positive faces captured avoidant attachment individuals' attention as reflected in greater P1, while the same situation led to greater N170 in secure and anxious individuals. Crucially, impairment in conflict-monitoring function was found in anxious individuals as reflected by the absence of interference effect on N450, leading to impaired ability of inhibitory control as indicated by decreased slow potential. In contrast, avoidant individuals showed greater slow potential for inhibiting emotional interference. Furthermore, MVPA revealed that the corresponding time window for conflict monitoring was found for emotional distractors decoding rather than congruency decoding in the anxious attachment group. Convergent results from ERPs and MVPA indicated that the deficits in emotional conflict monitoring and resolution among anxious individuals might be due to the excessive approach to emotional distractors, as they habitually use emotional evaluation rather than cognitive control. In summary, the present study provides electrophysiological evidence that attachment styles modulated emotional conflict processing, which highlights the contribution of attachment to social information processing.

Identification of four novel large deletions and complex variants in the α-globin locus in Chinese population.

BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

Hb Q-Thailand heterozygosity unlinked with the (-α4.2/) α+-thalassemia deletion allele identified by long-read SMRT sequencing: hematological and molecular analyses.

OBJECTIVE: In the present study, two unrelated cases of Hb Q-Thailand heterozygosity unlinked with the (-α4.2/) α+-thalassemia deletion allele were identified by long-read single molecule real-time (SMRT) sequencing in southern China. The aim of this study was to report the hematological and molecular features as well as diagnostic aspects of the rare manifestation. METHODS: Hematological parameters and hemoglobin analysis results were recorded. A suspension array system for routine thalassemia genetic analysis and long-read SMRT sequencing were applied in parallel for thalassemia genotyping. Traditional methods, including Sanger sequencing, multiplex gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA), were used together to confirm the thalassemia variants. RESULTS: Long-read SMRT sequencing was used to diagnose two Hb Q-Thailand heterozygous patients for whom the hemoglobin variant was unlinked to the (-α4.2/) allele for the first time. The hitherto undescribed genotypes were verified by traditional methods. Hematological parameters were compared with those of Hb Q-Thailand heterozygosity linked with the (-α4.2/) deletion allele in our study. For the positive control samples, long-read SMRT sequencing revealed a linkage relationship between the Hb Q-Thailand allele and the (-α4.2/) deletion allele. CONCLUSIONS: Identification of the two patients confirms that the linkage relationship between the Hb Q-Thailand allele and the (-α4.2/) deletion allele is a common possibility but not a certainty. Remarkably, as it is superior to traditional methods, SMRT technology may eventually serve as a more comprehensive and precise method that holds promising prospects in clinical practice, especially for rare variants.

A Novel 5 kb Deletion in the ß-Globin Gene Cluster Identified in a Chinese Patient.

ß-Thalassemia (ß-thal), a highly prevalent disease in tropical and subtropical regions of Southern China, is caused mainly by point mutations in the ß-globin gene cluster. However, large deletions have also been found to contribute to some types of ß-thal. We identified a novel 5 kb deletion in the ß-globin cluster in a Chinese patient using multiplex ligation-dependent probe amplification (MLPA), and characterized it with single molecule real-time (SMRT) sequencing, gap-polymerase chain reaction (gap-PCR) and Sanger sequencing. The deletion was located between positions 5226189 and 5231091 on chromosome 11 (GRCh38), extending from 4 kb upstream of the 5' untranslated region (5'UTR) to the second intron of the ß-globin gene. The patient with this deletion presented with microcytosis and hypochromic red cells, as well as relatively high Hb F and Hb A2 levels. Our research indicated that SMRT sequencing is a useful tool for accurate detection of large deletions. Our study broadens the spectrum of deletional ß-thalassemias and provides a perspective for further study of the function of the ß-globin cluster.

The -α3.7III subtype of α+-thalassemia was identified in China.

OBJECTIVE: The 3.7 kb deletion (-α3.7) in the α-globin cluster, which characterizes α+-thalassemia, has been reported to have a carrier rate of 4.78% in southern China. Three -α3.7 subtypes have been identified worldwide. However, the -α3.7 III subtype has not previously been identified in China. Herein, we reported identification of the -α3.7 III subtype in a Chinese patient. METHODS: We used gap-PCR and a liquid chip system to detect α-thalassemia mutations. Multiple ligation-dependent probe amplification was performed to detect the large deletion. We finally used Sanger sequencing and single molecule real-time sequencing to characterize and confirm the genotype. RESULTS: The proband, characterized as -α3.7 III heterozygous, showed microcytosis and hypochromic red cells, with a mean corpuscular volume of 78 fL and mean corpuscular hemoglobin of 25.4 pg. The proband's mutation was inherited from her father, who had normal blood parameters. CONCLUSION: We first identified the -α3.7 III subtype in China. Consequently, all -α3.7 subtypes have now been identified in the Chinese population. Therefore, attention should be paid to -α3.7 III in clinical prenatal diagnosis, given that commonly used methods such as gap-PCR may lead to misdiagnosis or missed diagnosis.

First study to describe a novel HbA2: c.400A > C mutation and Hb Dongguan heterozygote in two unrelated Chinese families.

OBJECTIVES: Here we report two rare α-globin chain variants in two unrelated families: Hb Val de Marne [α133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C] and Hb Dongguan [α52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G]. Notably, HBA2: c.400A > C is an unreported new variant in the third exon of the α2 gene, and simple heterozygous unstable Hb Dongguan haematological characteristics are proposed for the first time. METHODS: Hb analysis was performed by using capillary electrophoresis (CE). Twenty-three common mutations were detected using a suspension array system. Mutations were identified by DNA sequencing. RESULTS: The CE results showed an abnormal peak with incomplete separation from Hb A at zone 8 in two members of Family 1. DNA sequencing confirmed the presence of Hb Val de Marne [α133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C]. Five members of Family 2 exhibited an abnormal peak at zone 11, and DNA sequencing confirmed the presence of Hb Dongguan [α52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G]. CONCLUSIONS: The discovery of HBA2: C.400A > C expands the existing spectrum of α-globin variants. The carriers of simple heterozygous Hb Dongguan generally do not have obvious clinical symptoms. The information in this study will help clinicians understand the screening, molecular diagnosis and clinical significance of Hb variants.

Accurate detection of α-globin gene copy number variants with two reactions using droplet digital PCR.

BACKGROUND: The α-thalassemia is a highly prevalent disease in tropical and subtropical regions, including southern China, and is mainly caused by deletion in α-globin genes (HBA1 and HBA2). The clinical manifestation of α-thalassemia is highly correlated with the copy number of α-globin genes. The decrease in copy number results in α-thalassemia, while duplication or triplication compounded with ß-thalassemia may aggravate the clinical manifestation. However, the common methods used to measure the copy number variants can only detect the three common types: -SEA, -α3.7, and -α4.2, and may easily miss the rare deletional type and duplication or triplication cases. Therefore, a new method that allows the detection of different copy number variants in α-globin genes simultaneously and accurately needs to be established. METHODS: A total of 428 peripheral-blood and fetal chorionic villus or amniotic fluid samples were used in this study. We employed a pair of primers and two probes, one for HBA1 and another for HBA2, to perform droplet digital polymerase chain reaction (ddPCR). Each reaction needed the ddPCR of RPP30 as a reference gene to calculate the copy number. RESULTS: We accurately detected the copy number variants in α-globin genes, including the common form α-thalassemia, triplications such as αααanti4.2, and trisomy 16, by performing only two reactions. The accuracy rate for detecting the copy number of α-globin genes was up to 100%. CONCLUSION: In conclusion, ddPCR served as an accurate and rapid method for detecting copy number variations in the clinical screening for α-thalassemia.

Anxiety and Depression in Chinese Students During the COVID-19 Pandemic: A Meta-Analysis.

Background: The novel 2019 coronavirus disease (COVID-19) pandemic has spread rapidly worldwide and poses a global health threat. Aims: This study assessed the prevalence of anxiety and depression symptoms in Chinese students during the COVID-19 pandemic and explored potential moderating factors. Methods: We searched English and Chinese databases using pertinent keywords for articles published and unpublished, up until November 2020. The estimate of the overall prevalence of anxiety and depression was conducted through a random-effects model. Results: A total of 31 cross-sectional studies were included. The overall prevalence of anxiety and depression symptoms in Chinese students during the COVID-19 pandemic was 24.0% (95% CI [20.0-29.0%]) and 22.0% (95% CI [18.0-27.0%]) respectively. Subgroup analyses revealed that Chinese middle school students were at heightened risk of anxiety, while university students were at heightened risk of depression. Students who lived in higher-risk areas presented severe anxiety and depression, especially during the late period of the COVID-19 epidemic. Conclusions: Overall, during the COVID-19 pandemic, there was a high prevalence of anxiety in Chinese students and a high prevalence of depression among Chinese students in high-risk areas. Therefore, comprehensive and targeted psychological interventions should be developed to address the mental health of students in different grades, especially in high-risk areas and during the late period of the COVID-19 pandemic.

[Genetic Effect Analysis of ß-globin Gene 3'UTR+101G>C (HBB:c. *233G>C) Variant].

OBJECTIVE: To investigate whether ß-globin gene 3'UTR+101G>C (HBB:c.*233G>C) variant has genetic effect and provide basis for gene diagnosis and genetic counseling. METHOD: Whole blood cell analysis and capillary zone electrophoresis (CZE) were used to analyze the hematological indexes. The most frequent 23 mutations in southern Chinese individuals were routinely measured by PCR-flow fluorenscence immunmicrobeads assay. Sanger sequencing was used to detect the other variants of ß-globin gene (HBB). RESULTS: In 463 cases, a total of 7 cases with HBB:c.*233G>C variant were detected, among them 4 cases carried other pathogenic variants of HBB gene (2 cases were in trans, 2 cases were in cis), who had typical hematological characteristics of mild ß-thalassemia, and 3 cases also carried abnormal hemoglobin variation, but did not have hematological characteristics of ß-thalassemia. CONCLUSION: The study shows that HBB:c.*233G > C variant has no obvious genetic effect and should be a benign polymorphism.

Compounded with hemoglobin Port Phillip and -α4.2 or --SEA deletions were identified in Chinese population.

INTRODUCTION: Although over 1000 hemoglobin (Hb) variants were identified so far, Hb Port Phillip compound with α-thalassemia deletion had no reported before. METHODS: Two patients and the associated families from Guangdong province in China were recruited. Hematological parameters were determined by blood routine examination and hemoglobin electrophoresis. Genotyping was performed by Gap-PCR and Sanger sequencing. RESULTS: One patient was diagnosed as Hb Port Phillip, while her daughter was compounded with -α4.2 deletion, with normal Hb level (150 g/L), mean corpuscular volume (MCV) 108.4 fl and mean corpuscular hemoglobin (MCH) (30.5 pg). Another patient was diagnosed as compound Hb Port Phillip and --SEA deletion. This proband presented with more severe α-thalassemia trait than the patient compounded with -α4.2 deletion, with hemoglobin 80 g/L, MCV 61.7 fl, and MCH 18.7 pg. CONCLUSION: Here we first time identified two patients compound with Hb Port Phillip and -α4.2 and --SEA deletions, respectively, which had never been reported. Our study widens the genotypes of hemoglobinopathy and provides reference for genetic counselling and prenatal diagnosis in this population.

Severe fetal anemia and hydrops fetalis associated with compound heterozygosity for Hb Zurich-Albisrieden (HBA2:c.178G>C) and Hb Quong Sze (HBA2:c.377T>C).

We report on a fetus with cardiomegaly and increased middle cerebral artery-peak systolic velocity at 25 weeks of gestation. Severe fetal anemia (hemoglobin (Hb) level 37 g/L) was confirmed by cordocentesis. Hb analysis showed that Hb Bart's was 9% in cord blood. Molecular analysis of the proband's family found that the mother was a carrier of Hb Quong Sze (Hb QS, HBA2:c.377T>C), the father was a carrier of Hb Zurich-Albisrieden (Hb ZA, HBA2:c.178G>C), and the fetus was a compound heterozygote for Hb ZA and Hb QA. Despite intrauterine blood transfusions, the fetus experienced problems including oligohydramnios, growth retardation, placental thickening, and heart enlargement in the third trimester. The couple chose to terminate the pregnancy, and fetal autopsy confirmed the above diagnosis. This is the first report of a case of Hb ZA compounded with Hb QS, and provides a reference for genetic counselling and prenatal diagnosis in the Chinese population.

Downregulation by CNNM2 of ATP5MD expression in the 10q24.32 schizophrenia-associated locus involved in impaired ATP production and neurodevelopment.

Genome-wide association studies (GWAS) have accelerated the discovery of numerous genetic variants associated with schizophrenia. However, most risk variants show a small effect size (odds ratio (OR) <1.2), suggesting that more functional risk variants remain to be identified. Here, we employed region-based multi-marker analysis of genomic annotation (MAGMA) to identify additional risk loci containing variants with large OR value from Psychiatry Genomics Consortium (PGC2) schizophrenia GWAS data and then employed summary-data-based mendelian randomization (SMR) to prioritize schizophrenia susceptibility genes. The top-ranked susceptibility gene ATP5MD, encoding an ATP synthase membrane subunit, is observed to be downregulated in schizophrenia by the risk allele of CNNM2-rs1926032 in the schizophrenia-associated 10q24.32 locus. The Atp5md knockout (KO) in mice was associated with abnormal startle reflex and gait, and ATP5MD knockdown (KD) in human induced pluripotent stem cell-derived neurons disrupted the neural development and mitochondrial respiration and ATP production. Moreover, CNNM2-rs1926032 KO could induce downregulation of ATP5MD expression and disruptions of mitochondrial respiration and ATP production. This study constitutes an important mechanistic component that links schizophrenia-associated CNNM2 regions to disruption in energy adenosine system modulation and neuronal function by long-distance chromatin domain downregulation of ATP5MD. This pathogenic mechanism provides therapeutic implications for schizophrenia.

GATA zinc finger domain-containing protein 2A (GATAD2A) deficiency reactivates fetal haemoglobin in patients with ß-thalassaemia through impaired formation of methyl-binding domain protein 2 (MBD2)-containing nucleosome remodelling and deacetylation (NuRD) complex.

Reactivation of fetal haemoglobin (HbF) expression is an effective way to treat ß-thalassaemia and sickle cell anaemia. In the present study, we identified a novel GATA zinc finger domain-containing protein 2A (GATAD2A) mutation, which contributed to the elevation of HbF and ameliorated clinical severity in a patient with ß-thalassaemia, by targeted next-generation sequencing. Knockout of GATAD2A led to a significant induction of HbF in both human umbilical cord blood-derived erythroid progenitor-2 (HUDEP-2) and human cluster of differentiation (CD)34+ cells with a detectable impact on erythroid differentiation. Furthermore, heterozygous knockout of GATAD2A impaired recruitment of chromodomain helicase DNA-binding protein 4 (CHD4) to the methyl-binding domain protein 2 (MBD2)-containing nucleosome remodelling and deacetylation (NuRD) complex. Our present data suggest that mutations causing the haploinsufficiency of GATAD2A might contribute to amelioration of clinical severity in patients with ß-thalassaemia.

Epigenetic inactivation of ERF reactivates γ-globin expression in ß-thalassemia.

The fetal-to-adult hemoglobin switch is regulated in a developmental stage-specific manner and reactivation of fetal hemoglobin (HbF) has therapeutic implications for treatment of ß-thalassemia and sickle cell anemia, two major global health problems. Although significant progress has been made in our understanding of the molecular mechanism of the fetal-to-adult hemoglobin switch, the mechanism of epigenetic regulation of HbF silencing remains to be fully defined. Here, we performed whole-genome bisulfite sequencing and RNA sequencing analysis of the bone marrow-derived GYPA+ erythroid cells from ß-thalassemia-affected individuals with widely varying levels of HbF groups (HbF ≥ 95th percentile or HbF ≤ 5th percentile) to screen epigenetic modulators of HbF and phenotypic diversity of ß-thalassemia. We identified an ETS2 repressor factor encoded by ERF, whose promoter hypermethylation and mRNA downregulation are associated with high HbF levels in ß-thalassemia. We further observed that hypermethylation of the ERF promoter mediated by enrichment of DNMT3A leads to demethylation of γ-globin genes and attenuation of binding of ERF on the HBG promoter and eventually re-activation of HbF in ß-thalassemia. We demonstrated that ERF depletion markedly increased HbF production in human CD34+ erythroid progenitor cells, HUDEP-2 cell lines, and transplanted NCG-Kit-V831M mice. ERF represses γ-globin expression by directly binding to two consensus motifs regulating γ-globin gene expression. Importantly, ERF depletion did not affect maturation of erythroid cells. Identification of alterations in DNA methylation of ERF as a modulator of HbF synthesis opens up therapeutic targets for ß-hemoglobinopathies.

DNA methylation patterns of ß-globin cluster in ß-thalassemia patients.

BACKGROUND: Reactivation of fetal hemoglobin (HbF, α2γ2) holds a therapeutic target for ß-thalassemia and sickle cell disease. Although many HbF regulators have been identified, the methylation patterns in ß-globin cluster driving the fetal-to-adult hemoglobin switch remains to be determined. RESULTS: Here, we evaluated DNA methylation patterns of the ß-globin cluster from peripheral bloods of 105 ß0/ß0 thalassemia patients and 44 normal controls. We also recruited 15 bone marrows and 4 cord blood samples for further evaluation. We identified that the CpG sites in the locus control region (LCR) DNase I hypersensitive site 4 and 3 (HS4-3) regions, and γ- and ß-globin promoters displayed hypomethylation in ß0/ß0-thalassemia patients, especially for the patients with high HbF level, as compared with normal controls. Furthermore, hypomethylations in most of CpG sites of the HS4-3 core regions were also observed in bone marrows (BM) of ß0/ß0-patients compared with normal controls; and methylation level of γ-globin promoter -50 and + 17 CpG sites showed lower methylation level in patients with high HbF level compared with those with low HbF level and a negative correlation with HbF level among ß0-thalassemia patients. Finally, γ-globin promoter + 17 and + 50 CpG sites also displayed significant hypomethylation in cord blood (CB) tissues compared with BM tissues from normal controls. CONCLUSIONS: Our findings revealed methylation patterns in ß-globin cluster associated with ß0 thalassemia disease and γ-globin expression, contributed to understand the epigenetic modification in ß0 thalassemia patients and provided candidate targets for the therapies of ß-hemoglobinopathies.

A Genetic Variant Ameliorates ß-Thalassemia Severity by Epigenetic-Mediated Elevation of Human Fetal Hemoglobin Expression.

A delayed fetal-to-adult hemoglobin (Hb) switch ameliorates the severity of ß-thalassemia and sickle cell disease. The molecular mechanism underlying the epigenetic dysregulation of the switch is unclear. To explore the potential cis-variants responsible for the Hb switching, we systematically analyzed an 80-kb region spanning the ß-globin cluster using capture-based next-generation sequencing of 1142 Chinese ß-thalassemia persons and identified 31 fetal hemoglobin (HbF)-associated haplotypes of the selected 28 tag regulatory single-nucleotide polymorphisms (rSNPs) in seven linkage disequilibrium (LD) blocks. A Ly1 antibody reactive (LYAR)-binding motif disruptive rSNP rs368698783 (G/A) from LD block 5 in the proximal promoter of hemoglobin subunit gamma 1 (HBG1) was found to be a significant predictor for ß-thalassemia clinical severity by epigenetic-mediated variant-dependent HbF elevation. We found this rSNP accounted for 41.6% of ß-hemoglobinopathy individuals as an ameliorating factor in a total of 2,738 individuals from southern China and Thailand. We uncovered that the minor allele of the rSNP triggers the attenuation of LYAR and two repressive epigenetic regulators DNA methyltransferase 3 alpha (DNMT3A) and protein arginine methyltransferase 5 (PRMT5) from the HBG promoters, mediating allele-biased γ-globin elevation by facilitating demethylation of HBG core promoter CpG sites in erythroid progenitor cells from ß-thalassemia persons. The present study demonstrates that this common rSNP in the proximal Aγ-promoter is a major genetic modifier capable of ameliorating the severity of thalassemia major through the epigenetic-mediated regulation of the delayed fetal-to-adult Hb switch and provides potential targets for the treatment of ß-hemoglobinopathy.