In vivo confocal microscopy as a novel and reliable tool for the diagnosis of Demodex eyelid infestation.

AIMS: Demodex mites are implicated in several ocular surface diseases such as blepharitis, ocular rosacea and dry eye syndrome. Demodex eyelid infestation is classically diagnosed by analysing depilated eyelashes under the light microscope. The use of in vivo confocal microscopy (IVCM) could be an easy way to improve its diagnosis. The ability of IVCM to identify Demodex was evaluated and compared with the classic depilation method. METHODS: Eight healthy subjects, 22 patients with dry eye syndrome without anterior blepharitis and 18 patients with anterior blepharitis were examined using lower eyelid IVCM (lash follicles and meibomian glands (MGs)). Twenty-five of the 48 subjects underwent both an IVCM examination and classic depilation to compare the two methods. Ex vivo Demodex obtained from lash depilation were also analysed using the confocal microscope. RESULTS: IVCM found 100% of the mite infestations among patients with anterior blepharitis, 60% among dry eye patients without blepharitis and 12% in healthy subjects, whereas the depilation technique found 100%, 50% and 0%, respectively. Demodex brevis and Demodex larvae inside the lash follicles were better detected by IVCM. In symptomatic patients, the Demodex infestation was often associated with MG dysfunction, which was better characterised using IVCM in symptomatic patients (60% and 40% of meibomianitis and gland fibrosis, respectively). CONCLUSIONS: IVCM is an efficient and reliable tool for the diagnosis of eyelid mite infestation and may also provide an evaluation of MGs.

Findings in detection of Herpesviridae by polymerase chain reaction and intraocular antibody production in a case series of anterior uveitis.

PURPOSE: To target the use of two biologic tests in the diagnostic of viral Herpesviridae anterior uveitis (AC) by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humor samples were collected from 42 patients suspected of having AU of infectious origin at presentation. The diagnosis of infectious uveitis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and/or detection of Herpesviridae genomes with PCR. The data were compared with data of 16 uveitis control samples used to calculate the specificity of the tests. RESULTS: Sixteen out of 42 eyes (38%) had a final diagnosis of anterior segment infectious uveitis of viral origin (Herpesviridae) confirmed by PCR positive result (5/14 eyes; 14 of the 16 eyes were tested by PCR) and/or specific intraocular antibody synthesis (14/16 eyes). CONCLUSIONS: While the GWC is progressively less often performed, these findings suggest that it still has a role in AU suspected of herpesvirus etiology.

Rapid detection and simultaneous molecular profile characterization of Acanthamoeba infections.

Diagnosis of Acanthamoeba by microscopic examination, culture, and polymerase chain reactions (PCRs) has several limitations (sensitivity, specificity, lack of detection of several strains, cost of testing for discrimination among strains). We developed a new high-resolution melting real-time PCR (HRM) to detect and characterize Acanthamoeba infections. HRM performances were evaluated with strains from the American Type Culture Collection (ATCC) and with 20 corneal scrapings. The DNA extracted from specimens were amplified, detected, and characterized in 1 run using 2 original primers diluted in a solution containing an intercalating dye. Detection and molecular characterization of Acanthamoeba infections could be achieved in less than 2.5 h with a dramatic reduction in cost of reactants (postamplification procedures and radioactive or fluorescent-labeled molecular probes were unnecessary). HRM detection limits were 0.1 cyst/µL or less (including genotypes T5 and T11), and its sensitivity and specificity were higher than other molecular tests. For the tested strains from the ATCC, the HRM drafted 4 different profiles: Type I (genotypes T2 and T4), Type II (T5 and T7), Type III (T8), and Type IV (T1, T3, T6, T9, T11, T12, and T13).

New strategy for rapid diagnosis and characterization of keratomycosis.

PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.

Association of anti-herpes simplex virus IgG in tears and serum with clinical presentation in patients with presumed herpetic simplex keratitis.

PURPOSE: To assess the clinical relevance of tear anti-herpes simplex virus (HSV) antibody measurement for the diagnosis of herpes simplex keratitis. METHODS: Records of 364 patients clinically suspect of HSV-related keratitis who had tear anti-HSV IgG assessment (tear-quantified anti-HSV IgG/filtrated IgG ratio) in our institution between January 2000 and August 2008 were retrospectively analyzed. Patients were classified into 4 groups as follows: group 1, anti-HSV IgG negative in serum and tears; group 2, anti-HSV IgG negative in tears and positive in serum; group 3, anti-HSV IgG nonsignificantly positive in tears and positive in serum; and group 4, anti-HSV IgG significantly positive in serum and tears. Randomly selected patient charts from each group were reviewed for clinical data. RESULTS: The prevalence of anti-HSV IgG in blood increased with age from >70% before 20 years to 95% after 70 years. The prevalence of anti-HSV IgG in tears increased with age from 20% before 20 years to >50% after 70 years. The presence (either significant or not) of anti-HSV IgG in tears was significantly associated with decreased corneal sensation, presence of stromal opacities, and with neurotrophic keratitis. Logistic regression showed no significant association between age and clinical signs except for herpetic ulcers and herpetic necrotizing keratitis. CONCLUSIONS: Tear production of anti-HSV IgG increases with age, and it is associated with sequelae of herpes simplex keratitis. Conversely, it is poorly associated with clinical signs of acute herpes simplex keratitis.

Real-time polymerase chain reaction and intraocular antibody production for the diagnosis of viral versus toxoplasmic infectious posterior uveitis.

PURPOSE: The aim of this work was to determine the diagnostic performance of real-time polymerase chain reaction (RT-PCR) and to assess intraocular specific antibody secretion (Goldmann-Witmer coefficient) on samples from patients with signs of posterior uveitis presumably of infectious origin and to target the use of these two biologic tests in the diagnostic of Toxoplasma/viral Herpesviridae posterior uveitis by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humour and/or vitreous fluid were collected from patients suspected of having posterior uveitis of infectious origin at presentation (140 samples). The diagnosis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and for detection of Herpesviridae and Toxoplasma gondii genomes with RT-PCR. Forty-one patients had final diagnosis of uveitis of non-Toxoplasma/non-viral origin and 35 among them constituted the control group. The main outcome measures were sensitivity, specificity, and positive and negative predictive values (PPV and NPV). RESULTS: When pre-intraocular testing indication was compared with final diagnosis, GWC was a more sensitive and specific method than RT-PCR, and was successful in detecting T. gondii, especially if the patient is immunocompetent and the testing is carried out later in the disease course, up to 15 months. For viral Herpesviridae uveitis, the sensitivity and PPV of PCR evaluation was higher than detected with GWC with respectively 46% compared with 20% for sensitivity and 85% versus 60% for PPV. In either viral retinitis or toxoplasmosis infection, RT-PCR results were positive from 24 h, although GWC was not significant until 1 week after the onset of signs. In toxoplasmosis patients, positive RT-PCR results were statistically correlated with the chorioretinitis area (more than three disc areas; p = 0.002), with the age older than 50 (p = 0.0034) and with a clinical anterior inflammation (Tyndall ≥1/2+) and panuveitis; (p = 0.0001). CONCLUSIONS: For the diagnosis of viral or toxoplasmosis-associated intraocular inflammation, the usefulness of laboratory diagnosis tools (RT-PCR and GWC) depends on parameters other than the sensitivity of the tests. Certain patient characteristics such as the age of the patients, immune status, duration since the onset of symptoms, retinitis area, predominant site and extent of inflammation within the eye should orientate the rational for the choice of laboratory testing in analysis of intraocular fluids.