First Report of Tomato chlorotic spot virus in Processing Tomatoes in the Dominican Republic.

Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5'ATGTCTAAGGTCAAGCTCACC3' and NR5'TTATGCAACACCTGAAATTTTGGC3'), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.

First Report of Columnea latent viroid (CLVd) in Tomato in Mali.

During surveys of tomato (Solanum lycopersicum) fields in Niono, Mali, conducted in March 2011, unusual disease symptoms, including stunted growth, epinasty, and chlorosis of leaves and necrosis of leaf veins and stems were observed in multiple fields. The incidence of these symptoms was low (~1 to 5%), but they were distinct from those associated with known diseases in the region. A representative leaf sample with these symptoms was applied to filter paper (FTA cards, Whatman), and DNA and RNA extracts were prepared according to manufacturer instructions. RT-PCR tests for Tomato spotted wilt virus, Tobacco streak virus, Tomato necrotic spot virus, Tobacco/tomato mosaic viruses, Cucumber mosaic virus, Alfalfa mosaic virus, torradoviruses, and potyviruses, and PCR tests for begomoviruses, phytoplasmas, and 'Candidatus Liberibacter' infection were also negative. However, virus-like symptoms developed in all 16 tomato seedlings (cv. Early Pak 7) 7 to 10 days after mechanical (sap) inoculation with inoculum prepared from the FTA sample. No symptoms developed in mock-inoculated control plants (n = 3). Symptoms induced included stunted growth and severe epinasty of leaves, followed by necrosis of leaf veins, petioles, and stems. These symptoms were similar to those observed in plants in Mali. When RNA extracts prepared from leaves of these symptomatic plants were mechanically inoculated onto 24 tomato seedlings, similar symptoms developed in all plants, suggesting the causal agent might be a viroid. RT-PCR tests with RNA from symptomatic tomato leaves and universal (3) and various specific Pospiviroid primer pairs were negative. However, equivalent RT-PCR tests conducted with the pCLV4/pCLVR4 primer pair specific for Columnea latent viroid (CLVd) (2) generated a DNA fragment of the expected size (~370 bp). The sequence of this DNA fragment (GenBank Accession No. JQ362419) was 99% identical with those of CLVd isolates from the Netherlands (AY373446 and AY372396). In host range studies, the CLVd isolate from Mali induced symptoms in all 48 mechanically-inoculated tomato plants, whereas no symptoms developed (up to 90 days after inoculation) in inoculated Chenopodium quinoa, C. amaranticolor, Nicotiana benthamiana, N. tabacum (cvs. Havana, Glurk and Turkish), N. glutinosa, Datura stramonium, common bean (cvs. Topcrop and Pinto bean), pumpkin (cv. Small Sugar), pepper (Capsicum annuum, cv. Yolo Wonder) and cucumber (cvs. Emparator and Poinsett 76) plants (results of three independent experiments with six plants per experiment). Symptomless infections were detected in pepper (24 of 30), N. benthamiana (25 of 25), and N. tabacum cv. Turkish (11 of 24) plants by RT-PCR with the pCLV4/pCLVR4 primer pair. To our knowledge, this is the first report of CLVd infecting tomato in Mali. RT-PCR tests of seeds collected from CLVd-infected tomato, pepper, and N. benthamiana plants also detected CLVd (1). Thus, it is possible that CLVd was introduced into Mali in association with seed. References: (1) O. Batuman and R. L. Gilbertson. Phytopathology 102:S4.9, 2012. (2) R. L. Spieker. Arch. Virol. 141:1823, 1996. (3) J. T. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

Tomato chocolate spot virus, a member of a new torradovirus species that causes a necrosis-associated disease of tomato in Guatemala.

Tomatoes in Guatemala have been affected by a new disease, locally known as "mancha de chocolate" (chocolate spot). The disease is characterized by distinct necrotic spots on leaves, stems and petioles that eventually expand and cause a dieback of apical tissues. Samples from symptomatic plants tested negative for infection by tomato spotted wilt virus, tobacco streak virus, tobacco etch virus and other known tomato-infecting viruses. A virus-like agent was sap-transmitted from diseased tissue to Nicotiana benthamiana and, when graft-transmitted to tomato, this agent induced chocolate spot symptoms. This virus-like agent also was sap-transmitted to Datura stramonium and Nicotiana glutinosa, but not to a range of non-solanaceous indicator plants. Icosahedral virions approximately 28-30 nm in diameter were purified from symptomatic N. benthamiana plants. When rub-inoculated onto leaves of N. benthamiana plants, these virions induced symptoms indistinguishable from those in N. benthamiana plants infected with the sap-transmissible virus associated with chocolate spot disease. Tomatoes inoculated with sap or grafted with shoots from N. benthamiana plants infected with purified virions developed typical chocolate spot symptoms, consistent with this virus being the causal agent of the disease. Analysis of nucleic acids associated with purified virions of the chocolate-spot-associated virus, revealed a genome composed of two single-stranded RNAs of approximately 7.5 and approximately 5.1 kb. Sequence analysis of these RNAs revealed a genome organization similar to recently described torradoviruses, a new group of picorna-like viruses causing necrosis-associated diseases of tomatoes in Europe [tomato torrado virus (ToTV)] and Mexico [tomato apex necrosis virus (ToANV) and tomato marchitez virus (ToMarV)]. Thus, the approximately 7.5 kb and approximately 5.1 kb RNAs of the chocolate-spot-associated virus corresponded to the torradovirus RNA1 and RNA2, respectively; however, sequence comparisons revealed 64-83% identities with RNA1 and RNA2 sequences of ToTV, ToANV and ToMarV. Together, these results indicate that the chocolate-spot-associated virus is a member of a distinct torradovirus species and, thus, another member of the recently established genus Torradovirus in the family Secoviridae. The name tomato chocolate spot virus is proposed.

An Outbreak of a Necrosis Disease of Tomato in California in 2008 was Caused by a New Ilarvirus Species Related to Parietaria mottle virus.

During the 2008 early-summer growing season, virus-like necrosis symptoms, most similar to those induced by Tobacco streak virus (TSV), were observed in leaves, stems, and petioles of processing tomato plants in the Central Valley of California. Symptoms were observed in numerous fields in Merced, San Joaquin, and Yolo counties, though the incidence of the disease in most fields was not high (not more than 5% but over 20% in some areas). Antibody-based tests of representative samples of the disease for infection with Tomato spotted wilt virus, TSV, and Tomato apex necrosis virus, which cause similar symptoms, were negative. A putative virus-like agent was sap- and graft-transmitted to tomato plants and induced necrotic spots in leaves and stem and petiole necrosis symptoms that were similar to those observed in the field. Eventually, these plants recovered from these symptoms. In sap-transmission experiments, the virus-like agent induced systemic symptoms in Chenopodium quinoa and C. amaranticolor (stunted growth and leaf curl and necrosis), Nicotiana benthamiana (necrotic leaf and stem lesions), N. tabacum cvs. Havana and Turkish (stunted growth and necrotic etching and ringspots followed by recovery for cv. Havana but not for cv. Turkish), and Datura stramonium (mild mottle and ringspots in newly emerged leaves followed by recovery); no symptoms were observed in inoculated common bean (cv. Topcrop), pumpkin (cv. Small Sugar), pepper, and N. glutinosa plants. Virus minipurification was performed with leaves from noninfected and infected D. stramonium plants, and polyacrylamide gel electrophoresis analyses revealed a protein band of ~29 kDa in infected but not noninfected plants. This protein was purified and subjected to liquid chromatography-mass/mass spectrometry analysis. Four peptides, obtained from the trypsin-digested protein, each had the highest match (score of 118) with the capsid protein (CP) of Parietaria mottle virus (PMoV), an ilarvirus that induces leaf and stem necrosis in tomatoes in Europe (1). Using sequences of PMoV and other ilarviruses, a single primer was designed from the 3' nontranslated region and paired with primers designed from conserved regions of ilarvirus RNAs 1, 2, and 3. In reverse transcription-PCR analyses, these primer pairs directed the amplification of the expected-sized fragments for ilarvirus RNAs 1, 2, and 3 from RNA extracts prepared from leaves with the unusual necrosis symptoms. Sequence analyses confirmed these were ilarvirus fragments. Partial RNA 1, 2, and 3 sequences were 81, 84, and 82% identical, respectively, with those of PMoV and 80, 77, and 69% identical, respectively, with those of TSV. The amino acid sequence of the CP gene (GenBank Accession No. FJ236810) was 86 and 61% identical to those of PMoV and TSV, respectively. Together, these results indicate the necrosis disease of tomato is caused by a new ilarvirus species, tentatively named Tomato necrotic spot virus, although further studies are needed to confirm this. The mode of transmission of this new ilarvirus to tomatoes in the field is unknown, but it may involve thrips feeding on infected pollen, a known method of transmission for TSV (2). References: (1) L. Galipienso et al. Plant Pathol. 54:29, 2005. (2) R. Sdoodee and D. S. Teakle. Plant Pathol. 36:377, 1987.

Identification of biomarkers for the antiangiogenic and antitumour activity of the superoxide dismutase 1 (SOD1) inhibitor tetrathiomolybdate (ATN-224).

Tetrathiomolybdate (choline salt; ATN-224), a specific, high-affinity copper binder, is currently being evaluated in several phase II cancer trials. ATN-224 inhibits CuZn superoxide dismutase 1 (SOD1) leading to antiangiogenic and antitumour effects. The pharmacodynamics of tetrathiomolybdate has been followed by tracking ceruloplasmin (Cp), a biomarker for systemic copper. However, at least in mice, the inhibition of angiogenesis occurs before a measurable decrease in systemic copper is observed. Thus, the identification and characterisation of other biomarkers to follow the activity of ATN-224 in the clinic is of great interest. Here, we present the preclinical evaluation of two potential biomarkers for the activity of ATN-224: (i) SOD activity measurements in blood cells in mice and (ii) levels of endothelial progenitor cells (EPCs) in bonnet macaques treated with ATN-224. The superoxide dismutase activity in blood cells in mice is rapidly inhibited by ATN-224 treatment at doses at which angiogenesis is maximally inhibited. Furthermore, ATN-224 dosing in bonnet macaques causes a profound and reversible decrease in EPCs without significant toxicity. Thus, both SOD activity measurements and levels of EPCs may be useful biomarkers of the antiangiogenic activity of ATN-224 to be used in its clinical development.

Response to hypoxia involves transforming growth factor-beta2 and Smad proteins in human endothelial cells.

Oxygen deprivation (hypoxia) is a consistent component of ischemia that induces an inflammatory and prothrombotic response in the endothelium. In this report, it is demonstrated that exposure of endothelial cells to hypoxia (1% O(2)) increases messenger RNA and protein levels of transforming growth factor-beta2 (TGF-beta2), a cytokine with potent regulatory effects on vascular inflammatory responses. Messenger RNA levels of the TGF-beta2 type II membrane receptor, which is a serine threonine kinase, also increased. The stimulatory effect of hypoxia was found to occur at the level of transcription of the TGF-beta2 gene and involves Smad proteins, a class of intracellular signaling proteins that mediates the downstream effects of TGF-beta receptors. Transient transfection studies showed that the region spanning -77 and -40 base pairs within the TGF-beta2 promoter (harboring a Smad-binding "CAGA box") is activated in hypoxic cells compared with nonhypoxic controls (P <.01). Hypoxia also stimulated transcription from another promoter, 3TP-Lux, a reporter construct responsive to Smads and TGF-beta. In addition, specific binding to a Smad-binding oligonucleotide was observed with nuclear extracts from hypoxic endothelial cells but not from nonhypoxic cells. It is concluded that Smad proteins, which can regulate endothelial responses to mechanical and inflammatory stress, also may play an important role in vascular responses to hypoxia and ischemia.

Stress, peer affiliation, and transforming growth factor-beta1 in differentially reared primates.

A bidirectional regulatory interaction between the central nervous system and the immune system is largely provided by cytokines and their specific receptors, which are expressed by cells of both systems. Transforming growth factor-beta1 (TGF-beta1), produced by glial cells and lymphocytes and regulated by steroid hormones, is one such cytokine. In the current study, we examined the relationship between TGF-beta1 and peer affiliation in bonnet macaques (Macaca radiata) either reared normally or exposed as infants to conditions in which their mothers faced fluctuating requirements for food procurement (variable foraging demand [VFD]). Rearing under VFD conditions has been previously shown to produce dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis in these animals. Serum levels of TGF-beta1 after exposure to a moderate stressor had no correlation with peer affiliation under baseline conditions (r=.07), but were highly correlated with affiliation after subsequent challenge with a fear stimulus (r=.62). Affiliation after the fear stimulus also was inversely correlated with baseline levels of affiliation (r=-.71). These data suggest that changes in peripheral TGF-beta1 may be reflective of latent behavioral and biochemical propensities possibly related to affect. Further examination of the effects of early adversity will improve our understanding of the relationship between the HPA axis and immune function.

Relationship between cytokine levels and coronary artery disease in women.

Inflammation is thought to have a role in the pathogenesis of atherosclerotic coronary artery disease (CAD), and the measurement of markers of inflammation has been suggested to improve the identification of individuals at risk for this disease. The incidence of CAD in women is not accounted for by conventional risk factors, and the association of CAD and the antiinflammatory cytokine transforming growth factor beta1 (TGF-beta1) in this population is unknown. Associations among TGF-beta1, the inflammatory cytokine tumor necrosis factor alpha (TNF-alpha), and CAD severity in inner city women were examined. Fifty-three women requiring angiography (mean age, 60.7 years) were stratified as having on of the following conditions: 0 vessel disease (VD) (n = 20), 1 (VD) (n = 10), 2 VD (n = 9), or 3 VD (n = 14). Fasting serum cytokine levels were determined by enzyme-linked immunosorbent assay. Serum TGF-beta1 was lower in patients with extensive disease (2 and 3 VD versus 0 and 1 VD). The lowest TGF-beta1 levels (<30 ng/mL) were in the 2 and 3 VD groups. In contrast, in the 0 and 1 VD groups, TGF-beta1 was above 41 ng/mL. Serum TGF-beta1 correctly classified the severity of CAD in 62.3% of patients, with a predictive threshold of 58 ng/mL by discriminant function analysis. TGF-beta1 may be a determinant of clinical events and outcome in CAD in women.

Successful medical management of orbital abscess in a patient with sickle cell anemia.

The authors describe a patient with sickle cell anemia who had an orbital abscess at the site of a bone infarct during hospitalization for a painful crisis. Because the patient was in close medical observation, the orbital abscess was diagnosed within 48 hours of the onset of symptoms. The patient was treated with a 2-week course of intravenous antibiotics. This resulted in complete resolution of the abscess, as evidenced by clinical improvement and findings on computerized axial tomography scanning. The authors conclude that a heightened suspicion of orbital abscess in sickle cell patients with ocular symptoms will allow the diagnosis of an orbital abscess that can then be cured with antibiotic treatment but without orbital surgery.

Differential regulation of transforming growth factor beta-1 gene expression by glucocorticoids in human T and glial cells.

The inflammatory process in the brain requires bidirectional interaction of the immune and nervous systems. Evidently, astrocytic glial cells play an important role in facilitating this communication by releasing immunomodulators and cytokines. Expression of transforming growth factor beta-1 (TGF beta-1), a potent inhibitor of T cell function and glial cell proliferation, is highly regulated in T cells and is believed to be an important component in the molecular interaction between the immune and nervous systems. Comparative analysis of TGF beta-1 gene expression in human T and glial cells by Northern hybridization and S1 nuclease protection assay showed that dexamethasone (DM) caused a significant decrease in the basal and PMA-induced levels of TGF beta-1 mRNA in glial cells but not in T cells. This reduction correlated with a lower level of TGF beta-1 protein production. Transient transfection assay using deletion constructs of the 5' TGF beta-1 gene promoter-containing sequences between -453 and +11 bp identified a region spanning -160 to -60 bp as a potential sequence responsive to regulation by DM in T cells, whereas in glial cells, the overall transcriptional activity of the 5' TGF beta-1 promoter was reduced after DM treatment, but promoter activity within each construct remained constant in response to DM. Thus, a DM-responsive region could not be identified within the TGF beta-1 promoter in glial cells. These findings suggest that TGF beta-1 gene expression is differentially regulated by distinct regulatory elements in T and glial cells, and that extracellular stimulators, including glucocorticoids, can utilize the TGF beta-1-regulatory pathway to affect the functions of neural and immune cells.

Glucocorticoid-mediated inhibition of interleukin-2 receptor alpha and -beta subunit expression by human T cells.

To determine the mechanism of glucocorticoid (GC)-mediated inhibition of T cell functions, the effect of dexamethasone (DM) on T cell proliferation and interleukin-2 receptor (IL-2R) generation were studied. Dexamethasone inhibited IL-2-induced T cell proliferation by 30%-88%, relative to its concentration within the cultures. The effect of DM on expression of IL-2R alpha (Tac, p55, CD25) and beta (p75) genes in activated T cells was examined next. In T cells stimulated with purified phytohemagglutinin (PHA-p) and 4 beta-phorbol 12-myristate 13-acetate (PMA) addition of DM to the cultures resulted in a 60% reduction in IL-2R alpha and a 30% reduction in IL-2R beta membrane expression compared to T cells cultured in the absence of DM (p < 0.01). Inhibition of membrane IL-2R alpha and IL-2R beta expression by 10(-6) M DM was partially reversible by recombinant human IL-2 (rhIL-2). By Northern blot analysis, DM caused a comparable decrease in IL-2R alpha and in IL-2R beta mRNA levels to membrane receptor expression in mitogen-stimulated T cells. By in vitro transcription assays, DM regulated IL-2R alpha gene expression at a transcriptional level while transcription of IL-2R beta gene was unaffected by DM. The mechanism of action of DM on IL-2R alpha transcription was examined by determining the mRNA levels of the p50 subunit of nuclear factor kappa B (NF-kappa B), a transcription factor that stimulates IL-2R alpha gene expression. The data indicate that 10(-6) M DM increased T cell p50 NF-kappa B mRNA levels by four-fold compared to the levels obtained in the absence of DM. Further, the level of nuclear proteins capable of binding to the NF-kappa B sites in activated T cells increased in response to DM. In sum, DM regulates T cell membrane expression of IL-2R by more than one molecular mechanism.

Effects of repeated stress on T cell numbers and function in rats.

Although stress has been reported to affect various functions of the immune system, the mechanism that mediate these effects remain unclear. Thus we examined the effects that 1, 7, and 14 days of stress could have on various aspects of immune and endocrine function in rats. Rats subjected to repeated stress (7 and 14 days) showed significant decreases in the total number of mononuclear cells, particularly suppressor/cytotoxic (CD8) T cells, in the spleen and blood. The mitogenic responses of T cells to phytohemagglutinin (PHA) and concanavalin-A (Con A) were also significantly diminished at these times, as well as after acute (1 day) stress in the case of PHA stimulation. The mechanisms of this impaired T cell mitogenesis were explored by assessing the effects of stress on T cell interleukin 2 (IL-2) production and T cell responsiveness to IL-2. T cells from repeatedly stressed rat showed a decreased production of IL-2 in response to PHA, although their proliferative response to exogenous IL-2 was normal. Repeated stress also decreased body weight and spleen weight, increased adrenal weight, and decreased plasma levels of triiodothyronine and testosterone. These results suggest that lower levels of IL-2 production during stress could be one reason for the decreased mitogen responsiveness of T cells, often seen with stress. This is important because defective IL-2 production could also lead to significant impairment of immunoregulatory T cell generation and thus a predisposition to malignancy or autoimmune disease that some have associated with stress.

Molecular analysis of a t(14;14) translocation in leukemic T-cells of an ataxia telangiectasia patient.

We have detected and cloned two rearrangements in the T-cell receptor alpha locus from a clone of somatic cell hybrids carrying a t(14;14)(q11;q32) chromosomal translocation derived from an ataxia telangiectasia patient with T-cell chronic lymphocytic leukemia. The T-cell clone carrying the t(14;14) chromosomal translocation was known to be present for greater than 10 years before the onset of overt leukemia. One molecular rearrangement of the T-cell receptor alpha locus corresponded to a functional variable-joining region (V-J) joining, whereas the other derived from the breakpoint of the t(14;14)(q11;q32) translocation. Chromosomal in situ hybridization of the probe derived from the t(14;14) breakpoint localized the breakpoint region to 14q32.1, apparently the same region that is involved in another ataxia telangiectasia characteristic chromosome translocation, t(7;14)(q35;q32). The 14q32.1 breakpoint is at least 10,000 kilobase pairs (kbp) centromeric to the immunoglobulin heavy chain locus. Sequence analysis of the breakpoint indicates the involvement of a J alpha sequence during the translocation. Comigration of high-molecular weight DNA fragments involved with t(7;14) and t(14;14) translocations suggests the presence of a cluster of breakpoints in the 14q32.1 region, the site of a putative oncogene, TCL1.

Lymphocyte interleukin 2 production and responsiveness are altered in patients with primary myelodysplastic syndrome.

Immunoregulatory T and B cell functions in 15 patients with primary myelodysplastic syndrome (MDS) were studied by measuring the proliferative and the stimulatory capacity of T and B cells, respectively, in autologous (auto) and allogeneic (allo) mixed lymphocyte reaction (MLR). T cell proliferation in the auto MLR was 25% of the control (P less than .02), whereas proliferation in the allo MLR was normal. When control T cells were stimulated by MDS B cells, their proliferative response was only 57% of the control (P less than .01). The mechanism responsible for these abnormalities was studied by determining the capacity of MDS and normal T cells to produce interleukin 2 (IL 2) and to generate IL 2 receptors (IL 2R) following stimulation with control and MDS B cells. In the auto MLR of MDS patients, only 3% +/- 2% of T cells developed IL 2R positivity, whereas in control cultures 12% +/- 2% of T cells were positive, as determined by immunofluorescence, using a monoclonal antibody (MoAb) directed against the IL 2R, and FACS analysis. When MDS T cells were stimulated by control B cells, IL 2R generation and the production of IL 2 were within normal limits. In contrast, when control T cells were stimulated by MDS B cells or control B cells, the MDS B cells induced production of only 26% of IL 2 as compared with control B cells. In parallel experiments, IL 2R generation in control T cells stimulated by either MDS or control B cells was similar. We conclude that in the primary MDS, T and B cell interactions are impaired. Although MDS T cells develop normal quantities of IL 2R and produce normal amounts of IL 2 when stimulated by control B cells, they are markedly impaired when stimulated by self B cells. Similarly, MDS B cells can induce IL 2R generation in control T cells but not in MDS T cells. Myelodysplastic B cells are also defective in inducing IL 2 production by normal T cells in an allo MLR. These in vitro abnormalities strongly suggest that generation of lymphocytes with immunoregulatory functions is impaired in patients with MDS.

Defective interleukin-2 production and responsiveness by T cells in patients with chronic lymphocytic leukemia of B cell variety.

The present studies were designed to investigate the mechanism(s) of the defective T cell proliferative response to various stimuli in patients with B cell chronic lymphocytic leukemia B-CLL. In 14 patients with advanced B-CLL (stage III or IV) we found the T cell response in the autologous (auto) and allogeneic (allo) mixed lymphocyte reaction (MLR) to be 35.7% and 30% of the controls, respectively. Proliferation in the MLR depends upon the production of and response to interleukin 2 (IL 2), a T cell growth factor. IL 2 production in eight B-CLL patients was 22% of the control. The response to IL 2 was measured by the increase in the T cell proliferation in the MLR with the addition of IL 2. T cell proliferation in both the auto and allo MLR of CLL patients was significantly lower than in the controls after the addition of IL 2. The proliferative response of normal T cells to stimulation by CLL B cells was 50% of the control. This latter response was increased to control levels when cultures were supplemented with exogenous IL 2, suggesting that CLL B cells could stimulate IL 2 receptor generation in normal T cells in an allo MLR, but not IL 2 production. The presence of IL 2 receptors on activated T cells was directly determined using anti-Tac, a monoclonal antibody with specificity for the IL 2 receptor. Of the mitogen- or MLR-activated T cells in CLL patients, 6% and 10%, respectively, expressed Tac antigen, whereas identically stimulated control T cells were 60% and 47% Tac+, respectively. Our findings suggest that T cells in B-CLL are defective in their recognition of self or foreign major histocompatibility antigens as demonstrated by their impaired responsiveness in the MLR. Thus, these cells are unable to produce IL 2 or generate IL 2 receptors.

Commitment to erythroid or granulocyte-macrophage differentiation is associated with loss of macromolecular insoluble cold globulin.

In mice a macromolecular insoluble cold globulin (MICG) is present on the surface of resting and stimulated peripheral T lymphocytes, thymocytes, fetal prothymocytes and hemopoietic stem cells forming spleen colonies, colony-forming unit-spleen (CFU-S). Here we demonstrate that removal of MICG positive cells from bone marrow by treatment with antibody and complement does not affect the number of erythroid, burst-forming unit-erythroid (BFU-E) and granulocyte-macrophage, colony-forming unit-granulocyte macrophage (CFU-GM) progenitors developing in vitro. Thus, commitment of stem cells to lineage specific differentiation is associated with the loss of the MICG marker. Furthermore, the removal of MICG positive T lymphocytes from bone marrow does not affect the growth of BFU-E or CFU-GM.

Ontogeny of interleukin 2 responsive cells in the fetal thymus.

The ontogeny of IL 2-responsive cells in the thymus of CBA/J mice was examined in neonatal animals and in fetuses at 14, 16, and 18 to 20 days gestation. The thymocytes were tested for responsiveness to 2 micrograms/ml Con A, TCGF, IL 2, and co-stimulation by Con A plus TCGF or IL 2. These responses were compared with those of thymocytes of 6- to 8-wk-old CBA/J. Thymocytes (1 X 10(5)) were cultured, and the reaction was measured at maximum response (96 hr). Neonatal animals gave an unusually high response to TCGF or partially purified IL 2 alone, approximately five times greater than the adult. A low but significantly enhanced proliferation, stimulated by partially purified IL 2 alone, was observed with 14-day fetal thymocytes, even though cultures of these cells in medium alone had higher background proliferation than any other age tested. In the co-stimulator reaction, proliferation significantly above background was measured at 16 days of gestation with Con A plus TCGF. The magnitude of the co-stimulator reaction increased with age, especially between the 16th and 18th day of gestation and immediately after birth.

Macromolecular insoluble cold globulin (MICG): a marker for pluripotential hemopoietic stem cells.

In embryonic mice pluripotential hemopoietic stem cells (PHSC) originate in the yolk sac and migrate to the fetal liver and from there to the bone marrow. Hemopoietic cells from yolk sac and fetal liver also migrate to the thymic primordium, and within the thymic environment these prothymocytes differentiate into mature T cells. We have recently demonstrated that macromolecular insoluble cold globulin (MICG), a T cell marker, is synthesized and inserted into the plasma membrane of embryonic prothymocytes as soon as these cells appear in the early thymus. In addition, we have shown that MICG+ cells are present within the fetal liver before the thymus has fully formed. In the present study we show that pluripotential hemopoietic stem cells in the fetal liver and bone marrow have MICG on their surface and represent a subpopulation of these MICG+ cells. The implications of these findings in relationship to stem cell differentiation and isolation are discussed.