Worker Size, Geographical Distribution, and Introgressive Hybridization of Invasive Solenopsis invicta and Solenopsis richteri (Hymenoptera: Formicidae) in Tennessee.

Worker size and geographical distribution of red imported fire ants (Solenopsis invicta Buren), black imported fire ants (Solenopsis richteri Forel), and their hybrid (S. invicta × S. richteri) (Hymenoptera: Formicidae) were evaluated from colonies sampled across Tennessee. The fire ant species and hybrid status were determined using cuticular hydrocarbon and venom alkaloid indices obtained from gas chromatography and mass spectrometry. Hybrids were the most common fire ant throughout Tennessee. With the exception of a few isolated S. invicta samples, only hybrids were found in east Tennessee, and hybrids predominated in middle Tennessee. In west Tennessee, mixed populations of S. richteri and hybrids were found. Hybrids were more common in west Tennessee than a survey performed a decade earlier. No statistical differences were detected in the average inter-colonial worker size of S. richteri and hybrids. Likewise, average worker size was not related to geographic location in Tennessee. The similarity in average worker size among hybrid colonies with a wide range of cuticular hydrocarbon and venom alkaloid values suggests introgression was not impacting ant size in colonies sampled throughout Tennessee.

First Report of Black Leaf Mold of Tomato Caused by Pseudocercospora fuligena in Ohio.

Diseased tomato (Solanum lycopersicum L. cvs. Geronimo, Rebelski, and Big Dena) plants were received for diagnosis from a home gardener in Wayne County, Ohio, in August 2013 and from a 0.14-ha greenhouse in Brown County, Ohio, in September 2013. Approximately 10 and 60% of leaf area was diseased in the home garden and greenhouse, respectively. One or more lesions, each with an indistinct border, were observed on the leaves. Black fungal growth was observed on both sides of the leaf in association with the lesions. Microscopic examination revealed Cercospora-like conidia (2). Three symptomatic leaves from each location were surface-sterilized with 0.5% NaClO for 1 min and cultured on V8 juice agar medium at room temperature under continuous fluorescent lighting. One isolate was selected from each of Wayne Co. (SAM33-13) and Brown Co. (SAM34-13). The fungus produced small, dark-brown colonies within 2 weeks of plating. Mycelium was olive brown and septate, producing fascicles of conidiophores. Conidia were cylindrical, 2 to 14 septate, and 25.8 to 109.7 × 6.5 µm. Genomic DNA was extracted from colonies of isolate SAM33-13 grown on V8 juice agar medium using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI). The internal transcribed spacer (ITS) region of rDNA was amplified by PCR using primer pair ITS1 and ITS4 (5), and the purified amplicon was sequenced (OARDC Molecular and Cellular Imaging Center, Wooster, OH). The ITS sequence was 99% identical to those of GenBank accessions of Pseudocercospora fuligena from Korea (JX290079) and Thailand (GU214675). The sequence was deposited in GenBank (KF931141). Based on morphology (4) and sequence analysis, the fungus was identified as P. fuligena (Roldan) Deighton (basionym Cercospora fuligena). To satisfy Koch's postulates, three 4-week-old tomato plants each of the cultivars L390 (AVRDC, Taiwan) and Mountain Spring (Siegers Seed Co., Holland, MI) were sprayed with a suspension of 1 × 103 conidia/ml of isolates SAM33-13 or SAM34-13 prepared from 3-week-old cultures growing on V8 juice agar medium. Three non-inoculated control plants were sprayed with sterilized water. Plants were maintained in a growth chamber at 25 to 30°C, 80% RH, and a 12 h/12 h day/night cycle. The first symptoms appeared 3 weeks after inoculation as light yellow foliar lesions. The lesions enlarged and turned black due to fungal growth, and the infected leaves dried. Disease severity was 70 and 10% of leaf area for cvs. L390 and Mountain Spring, respectively, for each isolate. Non-inoculated control plants were symptomless, and no fungus was re-isolated from the leaves. P. fuligena was isolated from symptomatic leaves of inoculated plants as described above, and the identity was confirmed based on morphology. In the United States, C. fuligena has not been reported infecting tomato since the first report in Florida in 1974 (1). To our knowledge, this is the first report of black leaf mold of tomato caused by P. fuligena in Ohio. Resistant cultivars, crop sanitation, and fungicides are recommended to manage the disease (3). References: (1) C. H. Blazquez and S. A. Alfieri. Phytopathology 64:443, 1974. (2) U. Braun. IMA Fungus 4:265, 2013. (3) R. Cerkauskas. AVRDC Publication 04-606, 2004. (4) B. Halfeld-Vieira et al. Fitopatol. Bras. 31:3, 2006. (5) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5'-CTCGGTTTTCTGCTTTTC-3' and JAP886, 5'CGGACAGGCTGGAGAAATCG3') (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5'-CGTATCTGAGGATGTTGAGT-3' and JAP888, 5'-GCTAACTCCTTGTTCTTTTG-3'). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5'-AGTATTATGCATCTATAGATTAGCACA-3' and TCSV-R1, 5'-ACAAATCATCACATTGCCAGGA-') were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

First Report of Anthracnose of Onion Caused by Colletotrichum coccodes in Ohio.

Dry bulb onion (Allium cepa L. cvs. Pulsar, Bradley, and Livingston) plants with symptoms of anthracnose were observed in three commercial fields totaling 76.5 ha in Huron Co., Ohio, in July 2013. Symptoms were oval leaf lesions and yellowing, curling, twisting, chlorosis, and death of leaves. Nearly half of the plants in a 32.8-ha field of the cv. Pulsar were symptomatic. Concentric rings of acervuli with salmon-colored conidial masses were observed in the lesions. Conidia were straight with tapered ends and 16 to 23 × 3 to 6 µm (2). Colletotrichum coccodes (Wallr.) S. Hughes was regularly isolated from infected plants (2). Culturing diseased leaf tissue on potato dextrose agar (PDA) amended with 30 ppm rifampicin and 100 ppm ampicillin at room temperature yielded white aerial mycelia and salmon-colored conidial masses in acervuli. Numerous spherical, black microsclerotia were produced on the surface of colonies after 10 to 14 days. To confirm pathogen identity, total DNA was extracted directly from a 7-day-old culture of isolate SAM30-13 grown on PDA, using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) following the manufacturer's instructions. The ribosomal DNA internal transcribed spacer (ITS) region was amplified by PCR using the primer pair ITS1 and ITS4 (2), and sequenced. The sequence, deposited in GenBank (KF894404), was 99% identical to that of a C. coccodes isolate from Michigan (JQ682644) (1). Ten onion seedlings cv. Ebenezer White at the two- to three-leaf stage of growth were spray-inoculated with a conidial suspension (1 × 105 conidia/ml containing 0.01% Tween 20, with 10 ml applied/plant). Plants were maintained in a greenhouse (21 to 23°C) until symptoms appeared. Control plants were sprayed with sterilized water containing 0.01% Tween 20, and maintained in the same environment. After 30 days, sunken, oval lesions each with a salmon-colored center developed on the inoculated plants, and microscopic examination revealed the same pathogen morphology as the original isolates. C. coccodes was re-isolated consistently from leaf lesions. All non-inoculated control plants remained disease-free, and C. coccodes was not re-isolated from leaves of control plants. C. coccodes was reported infecting onions in the United States for the first time in Michigan in 2012 (1). This is the first report of anthracnose of onion caused by C. coccodes in Ohio. Unusually wet, warm conditions in Ohio in 2013 likely contributed to the outbreak of this disease. Timely fungicide applications will be necessary to manage this disease in affected areas. References: (1) A. K. Lees and A. J. Hilton. Plant Pathol. 52:3. 2003. (2) L. M. Rodriguez-Salamanca et al. Plant Dis. 96:769. 2012. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

First Report of Armillaria Root Rot Caused by Armillaria mellea Infecting Carrizo Citrange and Sour Orange Rootstocks in Turkey.

Citrus rootstocks, Carrizo citrange (Citrus sinensis [L.] Osb. × Poncirus trifoliata [L.] Raf.) and sour orange (C. aurantium L.) grown in containers filled with 5 liters of potting mix of 40% peat and 60% volcanic tuff declined in a 0.2-ha commercial nursery in Adana, Turkey, between 2004 and 2007. Seedlings with symptoms of root rot were found with an average disease incidence of 20% among 1,000 Carrizo citrange seedlings and 10% among 15,000 sour orange seedlings. The potting mixture preparation unit was located next to an oak tree (Quercus sp.) showing symptoms of Armillaria root rot. Six- to 12-month-old seedlings of both rootstocks were stunted and the crowns were necrotic with the presence of white mycelium. Mycelial fans were observed beneath the bark of infected roots and they expanded into the crown. The root systems and nearby potting mix contained rhizomorphs. Thus, Armillaria spp. was suspected as a possible causal agent. Three diseased crowns and three rhizomorphs were surface-sterilized with 1% NaClO for 1 min and cultured on benomyl-dichloran-streptomycin containing selective medium (3) at 25°C in the dark for 1 week. Six isolates transferred to 1.5% malt extract agar at 33°C in the dark for 7 weeks consistently yielded abundant aerial hyphae and mean diameter growth range was 4 to 21 mm and the mycelium margin was regular (1). To confirm pathogen identity, total DNA was extracted using the PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc., CA) directly from 7-day-old cultures grown in potato dextrose broth (PDB). The ribosomal DNA internal transcribed spacer (ITS) region was amplified by PCR using the primer pair ITS1 and ITS4 (5) and sequenced. The sequences were 99% identical to that of Armillaria mellea isolates from Japan (AB510880) and China (KF032535). This confirmed the identity of the causal agent as A. mellea (Vahl.) P. Kumm. Ten 3-month-old seedlings of Carrizo citrange and sour orange were transplanted into steam-sterilized potting mix and inoculated with wood pieces of oak (Quercus sp.) colonized by the fungus (two pieces for each container) (2). The oak wood pieces were sterilized prior to the colonization by the pathogen. Plants were maintained in a greenhouse (23 to 25°C) until symptoms appeared. Ten non-inoculated seedlings from each rootstock served as controls and were maintained in the same environment. After 4 months, the crowns of the seedlings developed necrotic areas and root systems contained rhizomorphs on all inoculated seedlings and fungus was re-isolated from crowns and rhizomorphs. All control plants remained disease-free and no fungus was re-isolated. A. mellea was reported to infect citrus rootstocks in Spain in 1999 (4). To our knowledge, this is the first report of Armillaria root rot caused by A. mellea infecting Carrizo citrange and sour orange rootstocks in Turkey. This indicates that citrus rootstocks could be at risk for infection and sterilization of the potting mix and good sanitation practices in nurseries are very important. References: (1) J. N. Bruhn et al. Mycopathologia 142:89, 1998. (2) F. M. Grasso et al. Plant Dis. 91:1517, 2007. (3) T. C. Harrington et al. Page 81 in: Methods for Research on Soilborne Phytopathogenic Fungi. APS Press, St. Paul, MN, 1992. (4) J. J. Tuset et al. Bol. San. Veg. Plagas 25: 491, 1999. (5) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

First Report of Leek yellow stripe virus in Garlic in Ohio.

Leek yellow stripe virus (LYSV), genus Potyvirus, family Potyviridae, infects a wide range of Allium species worldwide. LYSV is one of several viruses that chronically infect garlic, Allium sativum L. The garlic virus complex, which includes LYSV, Onion yellow dwarf virus, and Garlic common latent virus, is perpetuated by asexual propagation (4) and is transmitted to clean planting material by aphids (3). This virus complex can reduce garlic bulb weight by nearly three quarters (2), and LYSV-only infections can result in approximately a one-quarter reduction in bulb weight (2). Garlic is grown as a small-scale, specialty crop in Ohio. During late May and early June 2013, garlic plants with virus-like symptoms were collected from Medina, Holmes, and Wayne counties, Ohio. Plants exhibited chlorotic streaking, foliar dieback, dwarfing, small bulbs, and cylindrical bulbs that failed to differentiate into cloves. Incidence of affected plants in the fields was up to 5% and all fields had early season aphid infestations. Flexuous rods were observed in TEM micrographs of plant sap from symptomatic leaves. Five symptomatic plants and six asymptomatic plants (from fields with symptomatic plants) were evaluated for LYSV by DAS-ELISA (Agdia, Inc., Elkhart, IN). Reverse transcriptase (RT)-PCR with LYSV-specific primers LYSV-WA and LYSV-WAR (3) was performed with cDNA generated by the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Both foliar and bulb tissues were tested using both detection methods. Forty percent of symptomatic plants and 67% of asymptomatic plants tested positive for LYSV with both ELISA and RT-PCR. LYSV was detected in both foliar and bulb tissues, including both tissues from asymptomatic plants. Five PCR amplicons generated from both foliar and bulb tissue were sequenced and shown to share 96 to 98% maximum identity with an LYSV polyprotein gene accession in GenBank (AY842136). This provided additional support that the detected virus was LYSV. LYSV was initially difficult to detect in Ohio fields due to low disease incidence and subtle symptom development. Use of virus-tested garlic bulbs can improve yield for several years, even following viral reinfection by aphids, compared to growing garlic from chronically infected bulbs (1). However, many growers routinely save bulbs from year to year and lack access to or knowledge of virus-tested sources of garlic bulbs. Conducive conditions, chronic infections, or co-infections with other viruses enhance the severity of symptoms and yield loss (2). LYSV has previously been reported in garlic producing regions of the northwestern United States (3), and to our knowledge, this is the first report of LYSV in garlic in Ohio. References: (1) V. Conci et al. Plant Dis. 87:1411, 2003. (2) P. Lunello et al. Plant Dis. 91:153, 2008. (3) H. Pappu et al. Plant Health Progress 10, 2008. (4) L. Parrano et al. Phytopathol. Mediterr. 51:549, 2012.

First Report of Tomato Pith Necrosis Caused by Pseudomonas mediterranea in the United States and P. corrugata in Ohio.

Tomato (Solanum lycopersicum, cvs. Mountain Fresh, Big Dena, and Trust) plants with symptoms of pith necrosis were received from six commercial high tunnels in Ohio during May and July 2012. Disease incidence ranged from 1 to 5%. Symptoms included wilting of shoots, dry, dark brown coalescent lesions on stems, brown discolored pith with a ladder-like appearance, and in some cases, adventitious root formation. Bacterial streaming was observed microscopically from necrotic stem tissue. Bacteria were isolated from surface-sterilized diseased stem tissue by plating 10-fold serial dilutions onto yeast dextrose carbonate (YDC) and Pseudomonas F (PF) agar media. The majority of the colonies recovered were similar in morphology on YDC: round and mucoid, with a greenish center that later became dry and winkled with a curly margin, and producing a yellow-green diffusible pigment. Colonies were creamy, yellow-brown in color and non-florescent on PF medium. Nine isolates from six plant samples were purified. All isolates were gram-negative, levan negative, oxidase positive, and potato rot negative. Three isolates were positive and six were negative for arginine dihydrolase activity. None induced a hypersensitive reaction in tobacco. All isolates grew at 37°C. The isolates were further identified by PCR assays using species-specific primers PC5/1-PC5/2 for Pseudomonas corrugata and PC1/1-PC1/2 for P. mediterranea (1,2). DNA of a reference P. mediterranea strain from Turkey was used as a positive control. A 600-bp band was amplified using P. mediterranea primers from the six arginine dihydrolase negative isolates recovered from four of six samples. An 1,100-bp band was amplified from the three arginine dihydrolase positive isolates from two other samples using P. corrugata primers. The 600-bp PCR products amplified from the P. mediterranea reference strain and isolate SM664-12 were purified and sequenced. The DNA sequence of SM664-12 was 99% aligned with that of the reference strain from Turkey and a BLAST search in NCBI indicated only one match with P. mediterranea strain G-229-21 (Accession No. EU117098.1), with an E-value 1e-145 and 84% identity. P. mediterranea (SM664-12) and P. corrugata (SM658-12) were each inoculated onto four 4-week-old tomato plants (cv. Mountain Fresh) by injecting a 50 µl bacterial suspension (108 CFU/ml) into the stem at the axil of the first true leaf (2). Negative control plants were injected with sterile water. Plants were kept in a mist chamber for 72 h at 25°C, then moved into a growth chamber maintained at 25/20°C day/night, 12-h light/dark, and 80% relative humidity. Plants exhibited dark brown lesions at the inoculation site after 4 weeks and brown discoloration of the pith developed, whereas no lesions were observed in control plants. The reisolated bacteria were tested by PCR and identified as P. corrugata and P. mediterranea. Therefore, we have confirmed that tomato pith necrosis in Ohio involves at least two bacteria, P. corrugata and P. mediterranea. Although tomato pith necrosis has been observed in Ohio since the 1990s, to our knowledge, this is the first confirmation of a causal agent as P. corrugata in Ohio and the first report of P. mediterranea causing tomato pith necrosis in the United States. References: (1) V. Catara et al. Eur. J. Plant Pathol. 106:753, 2000. (2) V. Catara et al. Int. J. Syst. Evol. Microbiol. 52:1749, 2002.

First Report of Impatiens Downy Mildew Caused by Plasmopara obducens in Ohio.

Single and double flowered impatiens (Impatiens walleriana Hook.f.) plants with symptoms of downy mildew were found in commercial greenhouses in Delaware, Wayne, and Holmes counties, Ohio, in April 2012. Plants were stunted and defoliated. Symptoms on remaining leaves included general chlorosis without discrete spots and downward curling of leaves. A downy white growth was observed on the lower surface of infected leaves. The disease was widespread in affected greenhouses and incidence in cvs. Shimmer Coral, Accent Mix, and Super Elfin was nearly 90%. The downy growth consisted of coenocytic mycelia, monopodial sporangiophores, and ovoid, hyaline sporangia typical of Plasmopara obducens (J. Schröt.) J. Schröt in Cohn (1,2,4). Sporangia were borne on branchlets measuring 5 to 15 µm long (average 10 µm) at right angles to the main axis of the sporangiophore. Sporangia were 9.4 to 17.5 × 12.8 to 16.3 µm. No oospores were observed. Total DNA was extracted directly from plant tissue with the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) following the manufacturer's instructions. Large ribosomal subunit DNA was amplified by PCR using primers NL-1 and NL-4 (3). Amplicons of 690 bp and 834 bp were produced from each diseased sample, while only the 690-bp amplicon was produced from healthy tissue. DNA from each amplicon of sample IDM041712 was purified using the Wizard SV Gel and PCR Clean-Up System (Promega), sequenced, and the sequence of the diagnostic 834-bp amplicon was deposited in GenBank (JX142134). The sequence of the 834-bp amplicon was 99% similar to those of P. obducens isolates from Serbia (HQ246451) (1), the UK (AY587558), and Austria (EF196869). The sequence of the 690-bp amplicon (JX142135) was 99% similar to that of I. walleriana (HQ223336). Twelve young impatiens 'Shimmer Coral' plants were inoculated with sporangia washed from infected leaves (1 × 104 sporangia/ml). Plants were incubated at room temperature for 24 h in a moist chamber and then maintained in a greenhouse (21 to 23°C) until symptoms appeared. Control plants were sprayed with sterile water and maintained in the same environment. After 12 to 14 days, typical symptoms of downy mildew developed on the inoculated plants and microscopic examination revealed the same pathogen morphology as the original isolate. All non-inoculated control plants remained disease free. To our knowledge, this is the first report of downy mildew on impatiens in Ohio. This disease caused considerable economic losses in Ohio in 2012 and is likely to be a recurring problem requiring intensive preventative management. References: (1) A. Bulajic et al. Plant Dis. 95:491, 2011. (2) O. Constantinescu. Mycologia 83:473, 1991. (3) W. Maier et al. Can. J. Bot. 81:12, 2003. (4) S. N. Wegulo et al. Plant Dis. 88:909, 2004.