Molecular dynamics of a DNA Holliday junction: the inverted repeat sequence d(CCGGTACCGG)4.

All-atom molecular dynamics (MD) computer simulations have been applied successfully to duplex DNA structures in solution for some years and found to give close accord with observed results. However, the MD force fields have generally not been parameterized against unusual DNA structures, and their use to obtain dynamical models for this class of systems needs to be independently validated. The four-way junction (4WJ), or Holliday junction, is a dynamic DNA structure involved in central cellular processes of homologous replication and double strand break repair. Two conformations are observed in solution: a planar open-X form (OPN) with a mobile center and four duplex arms, and an immobile stacked-X (STX) form with two continuous strands and two crossover strands, stabilized by high salt conditions. To characterize the accuracy of MD modeling on 4WJ, we report a set of explicit solvent MD simulations of ∼100 ns on the repeat sequence d(CCGGTACCGG)(4) starting from the STX structure (PDB code 1dcw), and an OPN structure built for the same sequence. All 4WJ MD simulations converged to a stable STX structure in close accord with the crystal structure. Our MD beginning in the OPN form converts to the STX form spontaneously at both high and low salt conditions, providing a model for the conformational transition. Thus, these simulations provide a successful account of the dynamical structure of the STX form of d(CCGGTACCGG)(4) in solution, and provide new, to our knowledge, information on the conformational stability of the junction and distribution of counterions in the junction interior.

Dynamical allosterism in the mechanism of action of DNA mismatch repair protein MutS.

The multidomain protein Thermus aquaticus MutS and its prokaryotic and eukaryotic homologs recognize DNA replication errors and initiate mismatch repair. MutS actions are fueled by ATP binding and hydrolysis, which modulate its interactions with DNA and other proteins in the mismatch-repair pathway. The DNA binding and ATPase activities are allosterically coupled over a distance of ∼70 Å, and the molecular mechanism of coupling has not been clarified. To address this problem, all-atom molecular dynamics simulations of ∼150 ns including explicit solvent were performed on two key complexes--ATP-bound and ATP-free MutS⋅DNA(+T bulge). We used principal component analysis in fluctuation space to assess ATP ligand-induced changes in MutS structure and dynamics. The molecular dynamics-calculated ensembles of thermally accessible structures showed markedly small differences between the two complexes. However, analysis of the covariance of dynamical fluctuations revealed a number of potentially significant interresidue and interdomain couplings. Moreover, principal component analysis revealed clusters of correlated atomic fluctuations linking the DNA and nucleotide binding sites, especially in the ATP-bound MutS⋅DNA(+T) complex. These results support the idea that allosterism between the nucleotide and DNA binding sites in MutS can occur via ligand-induced changes in motion, i.e., dynamical allosterism.

Spectroscopic and molecular dynamics evidence for a sequential mechanism for the A-to-B transition in DNA.

The A-to-B form transition has been examined in three DNA duplexes, d(CGCGAATTCGCG)(2), d(CGCGAATTGCGC), and d(CGCAAATTTCGC), using circular dichroism spectroscopy, ultraviolet resonance Raman (UVRR) spectroscopy, and molecular dynamics (MD) simulation. Circular dichroism spectra confirm that these molecules adopt the A form under conditions of reduced water activity. UVRR results, obtained under similar conditions, suggest that the transition involves a series of intermediate forms between A and B. Cooperative and distinct transitions were observed for the bases and the sugars. Independent MD simulations on d(CGCGAATTCGCG)(2) show a spontaneous change from the A to B form in aqueous solution and describe a kinetic model that agrees well with UVRR results. Based on these observations, we predict that the mechanism of the transition involves a series of A/B hybrid forms and is sequential in nature, similar to previous crystallographic studies of derivatized duplexes. A simulation in which waters were restrained in the major groove of B DNA shows a rapid, spontaneous change from B to A at reduced water activity. These results indicate that a quasiergodic sampling of the solvent distribution may be a problem in going from B to A at reduced water activity in the course of an MD simulation.

Induced fit and the entropy of structural adaptation in the complexation of CAP and lambda-repressor with cognate DNA sequences.

Molecular dynamics (MD) simulations of 5 ns on protein-DNA complexes of catabolite-activator protein (CAP), lambda-repressor, and their corresponding uncomplexed protein and DNA, are reported. These cases represent two extremes of DNA bending, with CAP DNA bent severely and the lambda-operator nearly straight when complexed with protein. The calculations were performed using the AMBER suite of programs and the parm94 force field, validated for these studies by good agreement with experimental nuclear magnetic resonance data on DNA. An explicit computational model of structural adaptation and computation of the quasiharmonic entropy of association were obtained from the MD. The results indicate that, with respect to canonical B-form DNA, the extreme bending of the DNA in the complex with CAP is approximately 60% protein-induced and 40% intrinsic to the sequence-dependent structure of the free oligomer. The DNA in the complex is an energetically strained form, and the MD results are consistent with a conformational-capture mechanism. The calculated quasiharmonic entropy change accounts for the entropy difference between the two cases. The calculated entropy was decomposed into contributions from protein adaptation, DNA adaptation, and protein-DNA structural correlations. The origin of the entropy difference between CAP and lambda-repressor complexation arises more from the additional protein adaptation in the case of lambda, than to DNA bending and entropy contribution from DNA bending. The entropy arising from protein DNA cross-correlations, a contribution not previously discussed, is surprisingly large.

Structure and axis curvature in two dA6 x dT6 DNA oligonucleotides: comparison of molecular dynamics simulations with results from crystallography and NMR spectroscopy.

Molecular dynamics (MD) simulations have been performed on the A6 containing DNA dodecamers d(GGCAAAAAACGG) solved by NMR and d(CGCAAAAAAGCG) solved by crystallography. The experimental structures differ in the direction of axis bending and in other small but important aspects relevant to the DNA curvature problem. Five nanosecond MD simulations of each sequence have been performed, beginning with both the NMR and crystal forms as well as canonical B-form DNA. The results show that all simulations converge to a common form in close proximity to the observed NMR structure, indicating that the structure obtained in the crystal is likely a strained form due to packing effects. A-tracts in the MD model are essentially straight. The origin of axis curvature is found at pyrimidine-purine steps in the flanking sequences.

cAMP controls human renin mRNA stability via specific RNA-binding proteins.

It is now recognized that post-transcriptional mechanisms are pivotal to renin production. These involve factors that modulate renin mRNA stability. In 2003 new data has emerged from work in Australia and Germany that has identified several of the, as many as, 20 or so proteins involved. These include CP1 (hnRNP E1), HuR, HADHB, dynamin, nucleolin, YP-1, hnRNP K and MINT-homologous protein. Cyclic AMP (cAMP) is a crucial regulator of renin secretion as well as transcriptional and post-transcriptional control of expression. Many of the RNA-binding proteins that were identified responded to forskolin, increasing in amount by two to 10-fold. The cAMP mechanisms that regulate renin mRNA target, at least in large part, other genes that presumably encode some of these proteins. The increase in the expression of these then facilitates, sequentially, renin mRNA stabilization and destabilization. Our data, using a battery of different techniques, confirm that CP1 and HuR stabilize renin mRNA, whereas HADHB causes destabilization. These proteins target cis-acting C-rich sequences (in the case of CP1) and AU-rich sequences (HuR) in the distal region of the 3'-untranslated region of renin mRNA. We found HADHB was enriched in juxtaglomerular cells and that that within Calu-6 cells HADHB, HuR and CP1 all localized in nuclear subregions, as well as cytoplasm (HADHB and CP1) and mitochondria (HADHB) commensurate with the role each plays in control of renin mRNA stability. The specific proteins that bind to human renin mRNA have begun to be revealed. Cyclic AMP upregulates the binding of several of these proteins, which in turn affect renin mRNA stability and thus overall expression of renin.

Molecular dynamics simulations of papilloma virus E2 DNA sequences: dynamical models for oligonucleotide structures in solution.

The specificity of papilloma virus E2 protein-DNA binding depends critically upon the sequence of a region of the DNA not in direct contact with the protein, and represents one of the simplest known examples of indirect readout. A detailed characterization of this system in solution is important to the further investigation hypothesis of a structural code for DNA recognition by regulatory proteins. In the crystalline state, the E2 DNA oligonucleotide sequence, d(ACCGAATTCGGT), exhibits three different structural forms. We report herein studies of the structure of E2 DNA in solution based on a series of molecular dynamics (MD) simulations including counterions and water, utilizing both the canonical and various crystallographic structures as initial points of departure. All MDs converged on a single dynamical structure of d(ACCGAATTCGGT) in solution. The predicted structure is in close accord with two of the three crystal structures, and indicates that a significant kink in the double helix at the central ApT step in the other crystal molecule may be a packing effect. The dynamical fine structure was analyzed on the basis of helicoidal parameters. The calculated curvature in the sequence was found to originate primarily from YPR steps in the regions flanking the central AATT tract. In order to study the role of structural adaptation of the DNA in the binding process, a subsequent simulation on the 16-mer cognate sequence d(CAACCGAATTCGGTTG) was initiated from the crystallographic coordinates of the bound DNA in the crystal structure of the protein DNA complex. MD simulations starting with the protein-bound form relaxed rapidly back to the dynamical structure predicted from the previous simulations on the uncomplexed DNA. The MD results show that the bound form E2 DNA is a dynamically unstable structure in the absence of protein, and arises as a consequence of both structural changes intrinsic to the sequence and induced by the interaction with protein.

Molecular dynamics simulations of DNA curvature and flexibility: helix phasing and premelting.

Recent studies of DNA axis curvature and flexibility based on molecular dynamics (MD) simulations on DNA are reviewed. The MD simulations are on DNA sequences up to 25 base pairs in length, including explicit consideration of counterions and waters in the computational model. MD studies are described for ApA steps, A-tracts, for sequences of A-tracts with helix phasing. In MD modeling, ApA steps and A-tracts in aqueous solution are essentially straight, relatively rigid, and exhibit the characteristic features associated with the B'-form of DNA. The results of MD modeling of A-tract oligonucleotides are validated by close accord with corresponding crystal structure results and nuclear magnetic resonance (NMR) nuclear Overhauser effect (NOE) and residual dipolar coupling (RDC) structures of d(CGCGAATTCGCG) and d(GGCAAAAAACGG). MD simulation successfully accounts for enhanced axis curvature in a set of three sequences with phased A-tracts studied to date. The primary origin of the axis curvature in the MD model is found at those pyrimidine/purine YpR "flexible hinge points" in a high roll, open hinge conformational substate. In the MD model of axis curvature in a DNA sequence with both phased A-tracts and YpR steps, the A-tracts appear to act as positioning elements that make the helix phasing more precise, and key YpR steps in the open hinge state serve as curvature elements. Our simulations on a phased A-tract sequence as a function of temperature show that the MD simulations exhibit a premelting transition in close accord with experiment, and predict that the mechanism involves a B'-to-B transition within A-tracts coupled with the prediction of a transition in key YpR steps from the high roll, open hinge, to a low roll, closed hinge substate. Diverse experimental observations on DNA curvature phenomena are examined in light of the MD model with no serious discrepancies. The collected MD results provide independent support for the "non-A-tract model" of DNA curvature. The "junction model" is indicated to be a special case of the non-A-tract model when there is a Y base at the 5' end of an A-tract. In accord with crystallography, the "ApA wedge model" is not supported by MD.

Assessment of the molecular dynamics structure of DNA in solution based on calculated and observed NMR NOESY volumes and dihedral angles from scalar coupling constants.

To assess the accuracy of the molecular dynamics (MD) models of nucleic acids, a detailed comparison between MD-calculated and NMR-observed indices of the dynamical structure of DNA in solution has been carried out. The specific focus of our comparison is the oligonucleotide duplex, d(CGCGAATTCGCG)(2), for which considerable structural data have been obtained from crystallography and NMR spectroscopy. An MD model for the structure of d(CGCGAATTCGCG)(2) in solution, based on the AMBER force field, has been extended with a 14 ns trajectory. New NMR data for this sequence have been obtained in order to allow a detailed and critical comparison between the calculated and observed parameters. Observable two-dimensional (2D) nuclear Overhauser effect spectroscopy (NOESY) volumes and scalar coupling constants were back-calculated from the MD trajectory and compared with the corresponding NMR data. The comparison of these results indicate that the MD model is in generally good agreement with the NMR data, and shows closer accord with experiment than back-calculations based on the crystal structure of d(CGCGAATTCGCG)(2) or the canonical A or B forms of the sequence. The NMR parameters are not particularly sensitive to the known deficiency in the AMBER MD model, which is a tendency toward undertwisting of the double helix when the parm.94 force field is used. The MD results are also compared with a new determination of the solution structure of d(CGCGAATTCGCG)(2) using NMR dipolar coupling data.

Hidden Markov models from molecular dynamics simulations on DNA.

An enhanced bioinformatics tool incorporating the participation of molecular structure as well as sequence in protein DNA recognition is proposed and tested. Boltzmann probability models of sequence-dependent DNA structure from all-atom molecular dynamics simulations were obtained and incorporated into hidden Markov models (HMMs) that can recognize molecular structural signals as well as sequence in protein-DNA binding sites on a genome. The binding of catabolite activator protein (CAP) to cognate DNA sequences was used as a prototype case for implementation and testing of the method. The results indicate that even HMMs based on probabilistic roll/tilt dinucleotide models of sequence-dependent DNA structure have some capability to discriminate between known CAP binding and nonbinding sites and to predict putative CAP binding sites in unknowns. Restricting HMMs to sequence only in regions of strong consensus in which the protein makes base specific contacts with the cognate DNA further improved the discriminatory capabilities of the HMMs. Comparison of results with controls based on sequence only indicates that extending the definition of consensus from sequence to structure improves the transferability of the HMMs, and provides further supportive evidence of a role for dynamical molecular structure as well as sequence in genomic regulatory mechanisms.

Free-energy component analysis of 40 protein-DNA complexes: a consensus view on the thermodynamics of binding at the molecular level.

Noncovalent association of proteins to specific target sites on DNA--a process central to gene expression and regulation--has thus far proven to be idiosyncratic and elusive to generalizations on the nature of the driving forces. The spate of structural information on protein--DNA complexes sets the stage for theoretical investigations on the molecular thermodynamics of binding aimed at identifying forces responsible for specific macromolecular recognition. Computation of absolute binding free energies for systems of this complexity transiting from structural information is a stupendous task. Adopting some recent progresses in treating atomic level interactions in proteins and nucleic acids including solvent and salt effects, we have put together an energy component methodology cast in a phenomenological mode and amenable to systematic improvements and developed a computational first atlas of the free energy contributors to binding in approximately 40 protein-DNA complexes representing a variety of structural motifs and functions. Illustrating vividly the compensatory nature of the free energy components contributing to the energetics of recognition for attaining optimal binding, our results highlight unambiguously the roles played by packing, electrostatics including hydrogen bonds, ion and water release (cavitation) in protein-DNA binding. Cavitation and van der Waals contributions without exception favor complexation. The electrostatics is marginally unfavorable in a consensus view. Basic residues on the protein contribute favorably to binding despite the desolvation expense. The electrostatics arising from the acidic and neutral residues proves unfavorable to binding. An enveloping mode of binding to short stretches of DNA makes for a strong unfavorable net electrostatics but a highly favorable van der Waals and cavitation contribution. Thus, noncovalent protein-DNA association is a system-specific fine balancing act of these diverse competing forces. With the advances in computational methods as applied to macromolecular recognition, the challenge now seems to be to correlate the differential (initial vs. final) energetics to substituent effects in drug design and to move from affinity to specificity.

Exploratory studies of ab initio protein structure prediction: multiple copy simulated annealing, AMBER energy functions, and a generalized born/solvent accessibility solvation model.

A theoretical and computational approach to ab initio structure prediction for polypeptides in water is described and applied to selected amino acid sequences for testing and preliminary validation. The method builds systematically on the extensive efforts applied to parameterization of molecular dynamics (MD) force fields, employs an empirically well-validated continuum dielectric model for solvation, and an eminently parallelizable approach to conformational search. The effective free energy of polypeptide chains is estimated from AMBER united atom potential functions, with internal degrees of freedom for both backbone and amino acid side chains explicitly treated. The hydration free energy of each structure is determined using the Generalized Born/Solvent Accessibility (GBSA) method, modified and reparameterized to include atom types consistent with the AMBER force field. The conformational search procedure employs a multiple copy, Monte Carlo simulated annealing (MCSA) protocol in full torsion angle space, applied iteratively on sets of structures of progressively lower free energy until a prediction of a structure with lowest effective free energy is obtained. Calibration tests for the effective energy function and search algorithm are performed on the alanine dipeptide, selected protein crystal structures, and united atom decoys on barnase, crambin, and six examples from the Rosetta set. Specific demonstration cases of the method are provided for the 8-mer sequence of Ala residues, a 12-residue peptide with longer side chains QLLKKLLQQLKQ, a de novo designed 16 residue peptide of sequence (AAQAA)3Y, a 15-residue sequence with a beta sheet motif, GEWTWDATKTFTVTE, and a 36 residue small protein, Villin headpiece. The Ala 8-mer readily formed an alpha-helix. An alpha-helix structure was predicted for the 16-mer, consistent with observed results from IR and CD spectroscopy and with the pattern in psi/straight phi angles of known protein structures. The predicted structure for the 12-mer, composed of a mix of helix and less regular elements of secondary structure, lies 2.65 A RMS from the observed crystal structure. Structure prediction for the 8-mer beta-motif resulted in form 4.50 A RMS from the crystal geometry. For Villin, the predicted native form is very close to the crystal structure, RMS values of 3.5 A (including sidechains), and 1.01 A (main chain only). The methodology permits a detailed analysis of the molecular forces which dominate various segments of the predicted folding trajectory. Analysis of the results in terms of internal torsional, electrostatic and van der Waals and the electrostatic and non-electrostatic contributions to hydration, including the hydrophobic effect, is presented.

Molecular dynamics simulations of B '-DNA: sequence effects on A-tract-induced bending and flexibility.

Molecular dynamics (MD) simulations including water and counterions are reported on five examples of A-tract DNA oligonucleotide dodecamer duplexes for which crystal structures are available, the homopolymeric duplex sequences poly(dA) and poly(dG), and two related sequences that serve as controls. MD was performed using the AMBER suite of programs for 3 ns on each sequence. These results, combined with previously reported MDs on 25-mer and 30-mer oligonucleotides on sequences with phased A-tracts carried out under a similar simulation protocol, are used to examine salient issues in the structural chemistry of ApA steps and A-tract induced axis bending. MD modeling successfully describes the distinctive B' structure of A-tracts in solution as essentially straight (wedge angles of <1 degrees ), more rigid than generic B-form DNA, with slight base-pair inclination, high propeller twist and a minor groove narrowing 5' to 3'. The MD structures in solution agree closely with corresponding crystal structures, supporting the idea that crystal structures provide a good model for A-tract DNA structure in solution. From the collective MD results, bending and flexibility are calculated by step. Pyrimidine-purine steps are predicted to be most intrinsically bent and also most bendable, i.e. susceptible to bending. Pyrimidine-pyrimidine ( approximately purine-purine) and purine-pyrimidine steps show less intrinsic deformation and deformability. The MD calculated flexibility correlates well with the protein-induced bendability derived independently from the protein DNA crystal structures. The MD results indicate that bending and flexibility of base-pair steps in DNA are highly correlated, i.e. steps that exhibit the most intrinsic deformation from B-form DNA turn are also the most dynamically deformable. The MD description of A-tract-induced axis bending shows most consistency with the non A-tract, general-sequence model, in which the sequence curvature originates primarily in base-pair roll towards the major groove in non-A-tract regions of the sequence, particularly pyrimidine-purine steps. The direction of curvature is towards the minor groove viewed from opposite the A-tracts, but the A-tracts per se exhibit only minor deformation. The MD results are found to be consistent with the directionality of bending inferred for DNA sequences from gel retardation and cyclization experiments.

Molecular dynamics simulation reveals sequence-intrinsic and protein-induced geometrical features of the OL1 DNA operator.

We have carried out molecular dynamics simulation of the lambda OL1 DNA operator on the free and the protein-bound forms. Our results lead us to conclude that the binding of the repressor actually makes the N-7 atom of Gua8' more solvent exposed, thereby enhancing its reactivity to chemical methylation. This increase in solvent accessibility surface area occurs simultaneously with the formation of hydrogen bonds between Lys-4 of the nonconsensus flexible N-terminal arm and Gua6' of the nonconsensus half-site operator DNA. Calculations of protein--DNA interaction energies reveal that among the residues of the arm, Lys-4 contributes the most favorably to the interaction energies. This result is consistent with mutagenesis studies that established that lysine at position 4 is absolutely required for tight binding. We find that the nonconsensus arm and the nonconsensus monomer interacts less favorably with DNA than do their respective counterparts of the consensus monomer. Moreover, the six-residue flexible arm accounts for at least half the total protein--DNA interactions energy. These results are in agreement with previous experimental studies. In accord with the diffuse electron density map observed in crystallographic studies of the nonconsensus flexible arm, we find that our model built for this region is more flexible and exhibits more conformations than its consensus counterpart. The simulation also reveals that DNA bending observed near the outer edge of the operator site is an intrinsic sequence-dependent property. By contrast, the DNA-bending features observed toward the center of the operator are induced by the protein. On the whole, stepwise protein-induced bending is more pronounced in the consensus half-site operator. We also find that the unusually large helical twist (49 degrees ) observed in the protein-bound form near the center of the operator results from the binding of the protein at a base step with some propensity for high twists.

Molecular dynamics and thermodynamics of protein-RNA interactions: mutation of a conserved aromatic residue modifies stacking interactions and structural adaptation in the U1A-stem loop 2 RNA complex.

Molecular dynamics (MD) simulations and free energy component analysis have been performed to evaluate the molecular origins of the 5.5 kcal/mol destabilization of the complex formed between the N-terminal RNP domain of U1A and stem loop 2 of U1 snRNA upon mutation of a conserved aromatic residue, Phe56, to Ala. MD simulations, including counterions and water, have been carried out on the wild type and Phe56Ala peptide-stem loop 2 RNA complexes, the free wild type and Phe56Ala peptides, and the free stem loop 2 RNA. The MD structure of the Phe56Ala-stem loop 2 complex is similar to that of the wild type complex except the stacking interaction between Phe56 and A6 of stem loop 2 is absent and loop 3 of the peptide is more dynamic. However, the MD simulations predict large changes in the structure and dynamics of helix C and increased dynamic range of loop 3 for the free Phe56Ala peptide compared to the wild type peptide. Since helix C and loop 3 are highly variable regions of RNP domains, this indicates that a significant contribution to the reduced affinity of the Phe56Ala peptide for RNA results from cooperation between highly conserved and highly variable regions of the RNP domain of U1A. Surprisingly, these structural effects, which are manifested as cooperative free energy changes, occur in the free peptide, rather than in the complex, and are revealed only by study of both the initial and final states of the complexation process. Free energy component analysis correctly accounts for the destabilization of the Phe56Ala-stem loop 2 complex, and indicates that approximately 80% of the destabilization is due to the loss of the stacking interaction and approximately 20% is due to differences in U1A adaptation.

Identification of a novel AU-Rich element in the 3' untranslated region of epidermal growth factor receptor mRNA that is the target for regulated RNA-binding proteins.

The epidermal growth factor receptor (EGF-R) plays an important role in the growth and progression of estrogen receptor-negative human breast cancers. EGF binds with high affinity to the EGF-R and activates a variety of second messenger pathways that affect cellular proliferation. However, the underlying mechanisms involved in the regulation of EGF-R expression in breast cancer cells are yet to be described. Here we show that the EGF-induced upregulation of EGF-R mRNA in two human breast cancer cell lines that overexpress EGF-R (MDA-MB-468 and BT-20) is accompanied by stabilization (>2-fold) of EGF-R mRNA. Transient transfections using a luciferase reporter identified a novel EGF-regulated approximately 260-nucleotide (nt) cis-acting element in the 3' untranslated region (3'-UTR) of EGF-R mRNA. This cis element contains two distinct AU-rich sequences (~75 nt), EGF-R1A with two AUUUA pentamers and EGF-R2A with two AUUUUUA extended pentamers. Each independently regulated the mRNA stability of the heterologous reporter. Analysis of mutants of the EGF-R2A AU-rich sequence demonstrated a role for the 3' extended pentamer in regulating basal turnover. RNA gel shift analysis identified cytoplasmic proteins (~55 to 80 kDa) from breast cancer cells that bound specifically to the EGF-R1A and EGF-R2A cis-acting elements and whose binding activity was rapidly downregulated by EGF and phorbol esters. RNA gel shift analysis of EGF-R2A mutants identified a role for the 3' extended AU pentamer, but not the 5' extended pentamer, in binding proteins. These EGF-R mRNA-binding proteins were present in multiple human breast and prostate cancer cell lines. In summary, these data demonstrate a central role for mRNA stabilization in the control of EGF-R gene expression in breast cancer cells. EGF-R mRNA contains a novel complex AU-rich 260-nt cis-acting destabilizing element in the 3'-UTR that is bound by specific and EGF-regulated trans-acting factors. Furthermore, the 3' extended AU pentamer of EGF-R2A plays a central role in regulating EGF-R mRNA stability and the binding of specific RNA-binding proteins. These findings suggest that regulated RNA-protein interactions involving this novel cis-acting element will be a major determinant of EGF-R mRNA stability.

A refined prediction method for gel retardation of DNA oligonucleotides from dinucleotide step parameters: reconciliation of DNA bending models with crystal structure data.

The development and assessment of a prediction method for gel retardation and sequence dependent curvature of DNA based on dinulcleotide step parameters are described. The method is formulated using the Babcock-Olson equations for base pair step geometry (1) and employs Monte Carlo simulated annealing for parameter optimization against experimental data. The refined base pair step parameters define a stuctural construct which, when the width of observed parameter distributions is taken into account, is consistent with the results of DNA oligonucleotide crystal structures. The predictive power of the method is demonstrated and tested via comparisons with DNA bending data on sets of sequences not included in the training set, including A-tracts with and without periodic helix phasing, phased A4T4 and T4A4 motifs, a sequence with a phased GGGCCC motif, some "unconventional" helix phasing sequences, and three short fragments of kinetoplast DNA from Crithidia fasiculata that exhibit significantly different behavior on non-denaturing polyacrylamide gels. The nature of the structural construct produced by the methodology is discussed with respect to static and dynamic models of structure and representations of bending and bendability. An independent theoretical account of sequence dependent chemical footprinting results is provided. Detailed analysis of sequences with A-tract induced axis bending forms the basis for a critical discussion of the applicability of wedge models,junction models and non A-tract, general sequence models for understanding the origin of DNA curvature at the molecular level.

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.

One nanosecond molecular dynamics simulation of the N-terminal domain of the lambda repressor protein.

We have carried out molecular dynamics simulation of the N-terminal domain of the lambda repressor protein in a surrounding environment including explicit waters and ions. We observe two apparent dynamics substates in the nanosecond protein simulation, the transition occurring around 500 ps. The existence of these two apparent substates results from a high flexibility of the arm in each monomer, a relative flexibility of both arms with respect to each other, and a relative displacement of the recognition helices from 30 to 40 A of interhelical distance. Many amino acid residues, including those involved in DNA recognition, undergo a simultaneous transition in their side-chain conformations, consistent with the relationship between side-chain conformation and secondary structural elements, as observed in protein crystal structures. This result suggests plausible conformational changes experienced by the protein upon DNA binding. On the whole, the non-consensus monomer appears to be more flexible than its consensus counterpart.

Nucleic acids: theory and computer simulation, Y2K.

Molecular dynamics simulations on DNA and RNA that include solvent are now being performed under realistic environmental conditions of water activity and salt. Improvements to force-fields and treatments of long-range interactions have significantly increased the reliability of simulations. New studies of sequence effects, axis bending, solvation and conformational transitions have appeared.