Binding of a desmetallo-porphyrin conjugate of Hoechst 33258 to DNA. III. Strong bonding to single-strand oligonucleotides.

The binding of the conjugate of Hoechst 33258 with 5,10,15,20-tetrakis (1-methyl-4-pyridyl)-21H,23H-porphyrin (PORHOE) to single-strand DNA has been detected by UV-vis spectrophotometry and 1H-NMR. The red-shift of porphyrin Soret band with strong hypochromicity indicates that the porphyrin moiety dominates in the interaction of the PORHOE with ssDNA. The affinity constants of PORHOE for d(GCATACAATTCG) or d(CGAATTGTATGC) were determined to be >10(5) M(-1), with strong cooperativity.

Binding of a porphyrin conjugate of Hoechst 33258 to DNA. I. UV-visible and melting studies detect multiple binding modes to a 12-mer nonself-complementary duplex.

Relative to ligand-free duplex DNA, the melting temperature of the 1:1 complex of the duplex d(CGAATTGTATGC):d(GCATACAATTCG) with the conjugate of Hoechst 33258 with a des-metalloporphyrin, increased from 42 to 60.5 degrees C indicating strong ligand binding. UV-vis spectrophotometric titration detected more than one class of binding site (apparent dissociation constants approximately 0.2 microM for simple noncooperative binding and 1 microM for the simultaneous cooperative mode with Hill coefficient approximately 2).

Binding of a porphyrin conjugate of Hoechst 33258 to DNA. II. NMR spectroscopic studies detect multiple binding modes to a 12-mer nonself-complementary duplex DNA.

We have probed by 1H NMR spectroscopy the molecular basis of the interaction between Hoechst 33258 conjugated to a des-metalloporphyrin and a non self-complementary duplex DNA sequence, designed on the known chemical nuclease selectivity of this system. The imino NMR spectra are consistent with two distinct families of structure, that is, PORHOE binding either way along the duplex. 2D spectral, T2, and linewidth data suggest multiple species within the two conformational families.

Synthetic inhibitors of the processing of pretransfer RNA by the ribonuclease P ribozyme: enzyme inhibitors which act by binding to substrate.

2,2'-p-Phenylene bis[6-(4-methyl-1-piperazinyl)]benzimidazole, 2,2'-bis(3,5-dihydroxyphenyl)-6,6'-bis benzimidazole, and 2,2'-bis(4-hydroxyphenyl)-6,6'-bis benzimidazole are shown by UV-visible and fluorescence spectrophotometry to be strong ligands for tRNA, giving simple, hyperbolic binding isotherms with apparent dissociation constants in the micromolar range. Hydroxyl radical footprinting indicates that they may bind in the D and T loops. On the basis of this tRNA recognition as a rationale, they were tested as inhibitors of the processing of precursor tRNAs by the RNA subunit of Escherichia coli RNase P (M1 RNA). Preliminary studies show that inhibition of the processing of Drosophila tRNA precursor molecules by phosphodiester bond cleavage, releasing the extraneous 5'-portion of RNA and the mature tRNA molecule, was dependent on both the structure of the inhibitor and the structure of the particular tRNA precursor substrate for tRNA(Ala), tRNA(Val), and tRNA(His). In more detailed followup using the tRNA(His) precursor as the substrate, experiments to determine the concentration dependence of the reaction showed that inhibition took time to reach its maximum extent. I(50) values (concentrations for 50% inhibition) were between 5.3 and 20.8 microM, making these compounds among the strongest known inhibitors of this ribozyme, and the first inhibitors of it not based on natural products. These compounds effect their inhibition by binding to the substrate of the enzyme reaction, making them examples of an unusual class of enzyme inhibitors. They provide novel, small-molecule, inhibitor frameworks for this endoribonuclease ribozyme.

Refined high-field NMR solution structure of a binary-addressed pyrene/perfluoro-azide complementary DNA oligonucleotide system shows extensive distortion in the central nick region.

The structural analysis of the photoactivated binary system of complementary-addressing nucleic acid sequences (1:2:3) by high-resolution NMR spectroscopy and restrained molecular dynamics is reported. The binary system comprised a 12 base-pair target DNA sequence, pdGTATCAGTTTCT (1), and two hexanucleotides, (dAGAAACp-L-Az (2) and Pyr-pdTGATAC (3)), complementary to neighbouring sites in the target DNA. Oligonucleotide (2) is conjugated with a p-azidotetrafludrobenzyl group (Az) via a linker group (L), and the other oligonucleotide (3) is equipped with the photosensitizing pyrenyl-1-methylamino group (Pyr). We now extend the structural analysis of 1:2:3, which was previously based on qualitative 2D 1H-NMR data and thermodynamic analysis of complex formation from UV-visible thermal denaturation experiments. In the current work structural refinement was performed by separate molecular dynamics runs for six different starting structures based on 318 proton-proton distance-range constraints, evaluated from the 1H-NOESY spectrum (tau(mix) = 200 ms, 600 MHz) using complete relaxation matrix analysis (NMR/TRIAD/MARDIGRAS). Additional Watson-Crick hydrogen bond restraints were included in the calculations based on the detected signals from the exchangeable protons, using REFOPT(NY) methods. The final averaged structure obtained from the six refined co-ordinate sets showed a considerable degree of axis bend (62.5 degrees) with the bending point in the middle of the duplex in the region of the backbone nick between the two short oligonucleotides. The complex behaves dynamically as the equivalent of two short B-DNA-like duplexes displaying a hinge-like flexing at their junction. In all final structures the Pyr function location was very restricted, the aromatic group lying in the duplex minor groove near residues 4T, 5C and 2T. In contrast, the location of the perfluoroazido group was different in all the final structures, indicating the high flexibility of this group in the duplex. The only feature common to all six final azido group orientations was the outside location on the side of the major groove. The distance between the Pyr and Az groups varied from 11 A to 24 A for the six final structures (17 A, final average structure). The dynamics of duplex denaturation for 1:2:3 was probed by monitoring the temperature-induced NMR line broadening of the imino protons in a 1D variable temperature NMR experiment. The melting of 1:2:3 starts both from the ends and from the middle part of the duplex at the backbone break between the two short oligonucleotides reflecting the destabilisation of the pyrene-arylazido nick region in the duplex.

Structure of photoreactive binary system of oligonucleotide conjugates assembled on the target nucleotide sequence.

Recently we have developed an approach to superspecific photomodification of nucleic acids by binary systems of oligonucleotides conjugated to precursor groups capable of assembling into photoactivatable structure upon simultaneous binding of the conjugates to the target. We have investigated the solution structure of a model binary system 1:2:3, where 1 is the target 12-mer 5'-pdGTATCAGTTTCT, 2 is the photoreactive conjugate 5'-dAGAAACp-NH(CH2)2NH-Az and 3 is the sensitizing conjugate 5'-Pyr-pdTGATAC (Az is p-azidotetrafluorobenzoyl group and Pyr is the pyrenyl-1-methylamino group). The photoreaction within this complex results in crosslinking of reagent 2 with N7-position of the G7 residue of the target thus indicating that the photoreactive Az residue is located in the major groove near the G7 residue. The center-to-center distances between the Pyr and Az moieties in complex 1:2:3 independently determined by the Pyr-group fluorescence quenching and the Az-group sensitized photodecomposition were 11.2 and 12.6 A, respectively.

[New approach to the study of interaction of amino acid side groups with aryl azides]. / Novyi podkhod k izucheniiu vzaimodeistviia aminokislot po ikh bokovym radikalam s arilazidami.

A new approach to the study of the interaction of amino acid side chains with photoreactive aryl azides was proposed. This approach was based on the drawing together of the reacting groups by the attachment of the reacting compounds to complementary oligonucleotides. Cystamine, histamine, and 1,6-hexamethylenediamine mimicking the cystine, histidine, and lysine residues, respectively, were attached to the 3'-terminal phosphate of the oligonucleotide GGTATCp through a phosphamide bond and used as the targets for photomodification. Derivatives of the oligonucleotide pGATACCAA with the fragment N3C6H4NH- attached directly to its 5'-end by a phosphamide bond or through the spacer -(CH2)nNH- (where n is 2, 4, and 6) were used as photoreagents. Their derivatives containing the same spacer and the N3C6F4CO-NH(CH2)3NH- or 2-N3,5-NO2-C6H3CO-NH(CH2)3NH- residues were also used. The duplexes were photomodified by irradiation with 300-350 nm wavelength light. The maximal yields of the photo-cross-linking were from 22 to 68%. The reagents containing p-azidoaniline residue were found to be the most effective toward the targets. The maximum yields of the photomodification products modeling the side chains of cysteine and lysine were found to vary from 40 to 67% and to depend on the length and the structure of the spacers used. The duplex with the target bearing the imidazole residue (the histidine model) manifested a yield decreased to 25%. This fact was in a good agreement with the data of computer modeling that indicated an unfavorable mutual displacement of the imidazole residue and the photoreactive group.

Structural studies by high-field NMR spectroscopy of a binary-addressed complementary oligonucleotide system juxtaposing pyrene and perfluoro-azide units.

Recently, a new approach has been proposed to improve the site-specificity and efficiency of the modification of nucleic acid target sequences, the binary system of complementary-addressing nucleic acid sequences. The binary system comprises two oligonucleotides, one modified with a photosensitizing group and the other with a photoreactive group. The sites of chemical modification are arranged to bring the two chemical functions close enough together in space to allow efficient energy transfer from the photo-excited photosensitizer to an arylazide moiety which expels N2 to form a nitrene which subsequently covalently labels the target nucleic acid. Structural analysis performed by high-resolution 2D NMR spectroscopy (400 MHz and 600 MHz) are reported for the model binary system 1:2:3, where 1 is the target 12-mer pdGTATCAGTTTCT, 2 is a photoactivatable fluoroazide derivative dAGAAACp-L-Az and 3 is the photosensitizer derivative Pyr-pdTGATAC (here: Az is the p-azidotetrafluorobenzyl group, Pyr the pyrenyl-1-methylamino group, L a linker group). The assignment of oligonucleotide and modifying group protons was performed using 1H COSY, TOCSY and NOESY experiments. Comprehensive analysis of 1H NOESY spectra of 1:2:3 showed that terminal fragments of the complex [5'p-1T-2G-3A-4T-], [-21A-22T-23A-24C], [-8T-9T-10T-11C-12T] and [13A-14G-15A-15A-17A-18C-] gave a continuous set of intra- and inter-nucleotide interactions, typical of regular double-stranded B-DNA. In contrast, the central region of the complex composed of 5C, 6A, 7G, 19T and 20G nucleotide residues, nearest the Pyr and Az groups, was found to be distorted. Thus some signals from aromatic and/or sugar-ring protons of the above nucleotide residues were extremely broadened or almost absent. Moreover, some intra- and/or inter-nucleotide interactions, typical of the regular DNA duplex, were not detected for the [-5C-6A-7G-] and [-19T-20G-] regions of the tandem system. Instead of that, some cross-peaks of low-intensity between the H2 proton of the Pyr group and 7G(H1'), 7G(H2'/H2"), 7G(H3'), 4T(H2"), 4T(H4') and 4T(H5'/H5") were observed. Additional 1H -1H NOE-interactions between methylene protons of the linker group L and some sugar ring protons of 18C nucleotide residue were detected. A preliminary structural model, constructed using proton-proton distances between Pyr and the DNA and Az-L and DNA obtained from a 1H NOESY experiment at 300 ms mixing time as constraints for the refinement of the structure, displayed significant distortion from B-DNA of the double-stranded helix in the middle of the complex, (-5C-6A-7G, -18C-19T-20G-). The Pyr group was located in what remains of the minor groove near 4T, 5C, 6A and 7G and the centroid of the azide ring less than 9A degrees from the centroid of the ring system of Pyr group.

[Study of the secondary structure of a single-stranded DNA fragment using self-modification reaction]. / Izuchenie vtorichnoi struktury odnotsepochechnogo fragmenta DNK s ispol'zovaniem reaktsii samomodifikatsii.

Electrophoretic analysis of the products of chemical destruction at modified base residues was used to determine the site-directedness of self-alkylation of the 26-mer DNA fragment pTTGCCTTGAATGGGAAGAGGGTCATT (T26). This fragment possesses a 4-[N-methyl-N-(2-chloroethyl)amino]benzylamido group (CIR-), covalently attached to the 5'-terminal phosphate group both in the presence and in the absence of the oligonucleotide effector (Phn-L)pTGACCCTCp(L-Phn), where Phn is an N-(2-hydroxyethyl)phenazinium residue and L is an ethylenediamine linker. Molecular modeling with the method of molecular mechanics/dynamics (MM/D) was used to investigate the secondary structure of the CIR-T26 conjugate and to interpret the change of the alkylation site upon treatment with CIR-T26 in the presence of an effector.

Thermodynamic and structural features of cooperative interactions in tandem oligonucleotide derivatives arranged at the complementary template. Chemical modification data.

General equations are derived for the limit yield [PZ] infinity of the intraduplex reaction between reactive oligonucleotide derivative X bearing p-(N-2-chloroethyl-N-methyl-amino)phenyl residue and oligonucleotide target P encompassing the sequence complementary to X in the presence of one or two oligonucleotide effectors E1 and E2. The latters form the complementary tandem sequence E1-X-E2 at the target. It is shown that association constants characterizing the affinity of the reagent X to the effector containing complexes PE1, PE2 and PE1E2 may be calculated from the dependencies of [PZ] infinity on the initial concentration chi 0 of X providing the sufficient excess of effectors is present. The approach was applied to reaction of C1RCH2NHpd(TTCCCA) with 26-mer dTTGCCTTGAATGGGAAGAGGGTCATT and effectors Phn-L-pd(TTCAAGG-C)p-L-Phn(E1) and Phn-L-pd(TGACCCTC)p-L-Phn(E2) where Phn- is N-(2-hydroxyethyl)-phenazinium residue and L is -NHCH2CH2NH- spacer. The association constants were found to be Kxe1 = 6.75 x 10(5)M-1, Kxe2 = 4.15 x 10(4)M-1 and Kxe12 = 5.87 x 10(6)M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4)M-1 in the absence of effectors. The experiments on self-alkylation of target reactive derivative C1RCH2NHpd(TTGCCTTGAATGGGAAGAGGGTCATT) both in the presence and in the absence of effector E2 as well as the Molecular Mechanics calculations of its prereactive states showed target to form the hairpin secondary structure. Under reasonable suggestions taking into account the internal structure of the target co-operativity parameters describing the contribution of interactions of the terminal nucleotides of X with adjacent residues of effector were calculated and found to be alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2, respectively.

[Study of the spatial structure of the product of intracomplex alkylation of the octanucleotide pd(TGTTTGGC) by 4-(N-methyl-N-(2-chloroethyl) amino)benzyl-5'-phosphamide derivative of the heptanucleotide pd(CCAAACA) in an aqueous solution by two-dimensional 1H-NMR spectroscopy and constrained molecular mechanics]. / Issledovanie prostranstvennoi struktury produkta vnutrikompleksnogo alkilirovaniia oktanukleotida pd(TGTTTGGC) 4-(N-metil-N-(2-khlorétil)amino)benzil-5'-fosfamidnym proizvodnym geptanukleotida pd(CCAAACA) v vodnom rastvore metodom dvumernoi 1H-IaMR-spektroskopii i ogranichennoi molekuliarnoi mekhaniki.

Using one- and two-dimensional 1H NMR spectroscopy (400 MHz), a detailed study of the spatial structure of the covalent adduct, a product of the intracomplex alkylation of octanucleotide pd[TGTTTGGC] by the 4-[N-methyl-N-(2-chloroethyl)amino]benzyl-5'-phosphamide derivative of heptanucleotide pd[CCAAACA] in aqueous solution, was continued. The distances between closely spaced protons of oligonucleotides as well as between protons of the benzylamide fragment and protons of the nearest nucleotide units were determined by measurements of the nuclear Overhauser effect. Analysis of effective correlation times for some pairs of protons of the covalent adduct showed that the values of tau c for the benzylamide fragment and nucleotide units C-1 and C-8, which directly interact with it, coincide and are smaller than those for the internal nucleotide units, suggesting the increased rigidity of the structure in the vicinity of the modification region. Using the method of constrained molecular mechanics, a probable state of the covalent adduct in solution is proposed that is in the best agreement with the experimentally obtained set of interproton distances. Problems connected with calculating the distance between a pair of protons with coincident chemical shifts and any third proton are considered.

[Intracomplex alkylation of octanucleotide pd(TGTTTGGC) by a 5'-(4-N-methyl-N-(2-chloroethyl)-amino)benzylphosphamide derivative of heptanucleotide pd(CCAAACA). Preparation of a covalent adduct and study of its spatial structure in an aqueous solution by two-dimensional (1)H-NMR spectroscopy]. / Vnutrikompleksnoe alkilirovanie oktanukleotida pd(TGTTTGGC) 5'-(4-N-methyl-N-(2-chlorétil)-amino)benzilfosfamidnym proizvodnym geptanukeltodia pd(CCAAACA). Poluchenie kovalentnogo addukta i issledovanie ego prostranstvennoi struktury v vodnom rastvore metodom dvumernoi (1)H-IaMR-spektroskopii.

Covalent adduct--the product of intracomplex alkylation at N-3-position of dC-8-nucleoside residue of target octanucleotide pd[TGTTTGGC] was completely synthesized by means of 4-[N-methyl-N-(2-chloroethyl)amino]benzyl-5'-phosphamido derivative of heptanucleotide pd[CCAAACA]. Its melting temperature was shown to be 70 degrees C. Tm did not depend on covalent adduct concentration and was by 40 degrees C higher than that for unmodified duplex pd[TGTTTGGC].pd[CCAAACA] at concentration of 0.5 x 10(-4) M. The spatial structure of the covalent adduct in aqueous solution was investigated by two-dimensional 3H-NMR spectroscopy. The assignment of oligonucleotide protons as well as protons of a modifying group was carried out using COSY, COSY-DQF and NOESY experiments. Conformational analysis of proton-proton coupling constants for H1', H2'a, H2'b and H3' protons showed the sugar residues to be in 2'-endo conformation. Analysis of NOE connectivities observed between the protons of the alkylating group and oligonucleotide protons yielded conclusion, regarding the 4-[N-methyl-N-(2-chloroethyl)amino]benzylamido 5'-residue being localized in the region of the lacked nucleoside residue of the heptanucleotide chain about 5 A apart from the dC-1 residue and from cytosine base of the alkylated dC-8 residue.

[Study of the spatial structure of the duplex (Phn-NH(CH2)NH)pd(CCAAACA).pd(TGTTTGGC) with covalently bound 10-(2-hydroxyethyl)phenazine by in aqueous solution by 2D-(1)H-NMR and by limited molecular mechanics]. / Issledovanie prostranstvennoi strukury dupleksa (Phn-NH(CH2)NH)pd(CCAAACA).pd(TGTTTGGC) s kovalentno prisodinennym 10-(2-gidroksiétil)fenaziniem v vodnom rastvore metodom 2M-(1)IaMR-spektroskopii i metodomogranichennoi molekuliarnoi mekhaniki.

Detailed investigation of the spatial structure of duplex (Phn-NH(CH2)2NH) x pd(CCAAACA).pd(TGTTTGGC) having a covalently linked N-(2-hydroxyethyl)-phenazine in aqueous solution was continued by means of one- and two-dimensional 1H-NMR spectroscopy. Distances between the protons of the oligonucleotides as well as distances between the phenazinium and the nearest nucleotide groups protons were determined from the series of one-dimensional NOE experiments. The effective correlation time tau c determined for some proton pairs shows the phenazinium fragment to have greater internal motion than the heterocyclic bases. The deoxyribose protons coupling constants show the sugars to be in 2'-endo-conformation. The restrained molecular mechanics have yielded a possible structure of duplex in the aqueous solution fitting the experimental set of interproton distances.

[Study of the structure of the duplex (Phn-NH(CH2)2NH)pd(CCAAACA) .pd(TGTTTGGC) with covalently bound 10-(2-hydroxyethyl)phenazine in an aqueous solution by 2D-1H-NMR spectroscopy]. / Issledovanie struktury dupleksa (Phn-NH(CH2)2NH)pd(CCAAACA.pd(TGTTTGGC)s kovlentno prisoedinennym 10-(2-gidroksiétil)fenaziniem v vodnom rostvore metodom 2M-1H-IaMR-spektroskopii.

The spatial structure of duplex (Phn-NH(CH2)2NH)pd(CCAAACA).pd(TGTTTGGC) having a N-(2-oxyethyl)-phenazinium residue covalently linked with the 5'-terminal phosphate of the heptanucleotide was studied by means of one- and two-dimensional 1H-NMR spectroscopy. The resonances of phenazinium protons, ethylenediamine linker protons, as well as, oligonucleotide H5/H6/H8/CH3 base protons and H1',H2'a, H2'b, H3', H4' deoxyribose protons have been assigned by means of 1H-COSY, 1H-NOESY and 1H-13C-COSY. The presence of the phenazine residue in duplex causes an additional imino proton signal of the terminal (G-7).(C-1) base pair, suggesting a higher stability of the duplex (Phn-NH(CH2)2NH)pd(CCAAACA).pd(TGTTTGGC) as compared to the unmodified duplex pd(CCAAACA).pd(TGTTTGGC). Analysis of NOE interactions between protons of the dye and the oligonucleotides show the phenazinium polycyclic system to intercalate between G-7 and C-8 residues of the octanucleotide.

[Study of the spatial structure of the duplex d(pTGTTTGGC) d(pCCAAAC)A in aqueous solution by methods of uni- and two-dimensional (1)H-NMR spectroscopy and organic molecular mechanics]. / Issledovanie prostranstvennoi struktury dupleksa d(pTGTTTGGC) d(pCCAAAC)A v vodnom rastvore metodami odno- i dvumernoi (1)H-IaMR- spektroskopii i organichnnoi molekuliarnoi mekhaniki.

Structure of the complementary complex d(pTGTTTGGC) d(pCCAAAC)A in the aqueous solution has been investigated by one- and two-dimensional 1H NMR spectroscopy. The resonances of nonexchangeable protons of bases as well as methyl and deoxyribose 1', 2'a, 2'b, 3' and 4' protons have been assigned by means of two-dimensional J-correlated spectroscopy (COSY) and two-dimensional nuclear Overhauser enhancement spectroscopy (NOESY). Using one-dimensional NOE measurements, 62 interproton distances (intranucleotide: (H6/H8)i--(H1')t, (H6/H8)i--(H2'a)i, (H1')i--(H2'a)i, (H1')i--(H2'b)i; internucleotide: (H6/H8)i--(H1')i-1, (H6/H8)i--(H2'a)i-1, (H6/H8)i--(H2'b)i-1, (H5/CH3)i--(H6/H8)i-1, (H5/CH3)i--(H2'a/H2'b)i-1) have been determined for nearest-neighbour protons. Spin-coupling constant values for some sugar protons have been obtained from COSY spectra. The restrained molecular mechanics calculations have yielded the possible solution structures of duplex fitting the experimental set of interproton distances and coupling constants.