User-friendly one-step disposable signal-on bioassay for glyphosate detection in water samples.

The onsite detection of glyphosate requires an easy-to-handle, low-cost and disposable assay for untrained users as requested by the ASSURED guidelines. A new strategy based on the expression of fusion proteins is proposed here. A glyphosate oxidase derived from Bacillus subtilis and the 6E10 variant of the dye peroxidase from Pseudomonas putida, both fused with the carbohydrate binding module (CBM) 3a from Clostridium thermocellum, were designed and expressed, leading to GlyphOx-CBM and 6E10-CBM. Cell lysates were used to immobilise both enzymes on cotton buds' heads without any purification. The cotton buds exhibit glyphosate oxidase activity when dipped into a glyphosate-contaminated water sample containing the 6E10-CBM chromogenic substrates. The chromophore could be quantified both in the solution and on the cotton buds' heads. Photography followed by image analysis allows to detect glyphosate with a linear range of 0.25-2.5 mM and a limit of detection (LoD) of 0.12 mM. When the chromogenic substrates are replaced by luminol, the chemiluminescence reaction allows the detection of glyphosate with a linear range of 2-500 µM and a LoD of 0.45 µM. No interference was observed using glyphosate analogues (glycine, sarcosine, aminomethylphosphonic acid) or other herbicides used in a mixture. Only cysteine was found to inhibit 6E10-CBM. Two river waters spiked with glyphosate lead to recoveries of 64-131%. This work describes a very easy-to-handle and inexpensive signal-on bioassay for glyphosate detection in real surface water samples.

DNA biosensor/biochip for multiplex blood group genotyping.

At present, 33 blood groups representing over 300 antigens are listed by the International Society of Blood Transfusion (ISBT). Most of them result from a single nucleotide polymorphism (SNP) in the corresponding DNA sequence, i.e. approx. 200 SNPs. In immunohematology laboratories, blood group determination is classically carried out by serological tests, but these have some limitations, mostly in term of multiplexing and throughput. Yet, there is a growing need of extended blood group typing to prevent alloimmunization in transfused patients and transfusion accidents. The knowledge of the molecular bases of blood groups allows the use of molecular biology methods within immunohematology laboratories. Numerous assays focused on blood group genotyping were developed and described during the last 10 years. Some of them were real biochips or biosensors while others were more characterized by the particular molecular biology techniques they used, but all were intending to produce multiplex analysis. PCR techniques are most of the time used followed by an analytical step involving a DNA biosensor, biochip or analysis system (capillary electrophoresis, mass spectrometry). According to the method used, the test can then be classified as low-, medium- or high-throughput. There are several companies which developed platforms dedicated to blood group genotyping able to analyze simultaneously various SNPs or variants associated with blood group systems. This review summarizes the characteristics of each molecular biology method and medium-/high-throughput platforms dedicated to the blood group genotyping.

Multiplexed immunoassay for the rapid detection of anti-tumor-associated antigens antibodies.

TAAs (tumor-associated antigens) microarrays were designed to detect auto-antibodies directly in patient sera. Twelve different probes were chosen according to their described occurrence in cancer pathologies (Cyclin B1, Cyclin D1, Complement factor H, c-myc, IMP1, p53, p62, survivin, Her2/neu, Koc, NY-ESO-1 and PSA). Microarrays of these 12 proteins were immobilized within the nitrocellulose/cellulose acetate membrane of a 96-well filtering microtiter plate bottom. The captured auto-antibodies were detected using a staining approach based on alkaline phosphatase labeling. Thus, the presence of specific auto-antibodies in samples was visualized through the positive staining of the corresponding TAA spots. The TAA HiFi microarrays were shown to be able to capture specific purified anti-TAA antibodies. In real samples, 9 proteins from the 12 TAAs panel were shown to generate specific signal and 5 antigens (p53, NY-ESO-1, IMP1, cyclin B1 and c-myc) were shown to have interaction with more than 10% of the positive sera from cancer patients. This protein subpanel was proven to be able to detect 72.2% of the cancer patients tested (within a 34 panel of 18 patients and 16 healthy donors).

Disposable screen-printed chemiluminescent biochips for the simultaneous determination of four point-of-care relevant proteins.

A screen-printed (SP) microarray is presented as a platform for the achievement of multiparametric biochips. The SP platform is composed of eight (0.28-mm(2)) working electrodes modified with electroaddressed protein A-aryl diazonium adducts. The electrode surfaces are then used as an affinity immobilisation support for the orientated binding of capture monoclonal antibodies, having specificity against four different point-of-care related proteins (myoglobin, cardiac troponin I, C-reactive protein and brain natriuretic peptide). The immobilised capture antibodies are involved in sandwich assays of the four proteins together with biotinylated detection antibodies and peroxidase-labelled streptavidin in order to permit a chemiluminescent imaging of the SP platform and a sensitive detection of the assayed proteins. The performances of the system in pure buffered solutions, using a 25-min assay duration, were characterised by dynamic ranges of 0.5-50, 0.1-120, 0.2-20 and 0.67-67 microg/L for C-reactive protein, myoglobin, cardiac troponin I and brain natriuretic peptide, respectively. The four different assays were also validated in spiked 40-times-diluted human sera, using LowCross buffer, and were shown to work simultaneously in this complex medium.

Protein microarrays enhanced performance using nanobeads arraying and polymer coating.

A nanosize material composed of 330nm glass beads coated with a copolymer of N,N-dimethylacrylamide (DMA), N,N-acryloyloxysuccinimide (NAS) and [3-(methacryloyl-oxy)propyl]trimethoxysilane (MAPS) was developed to improve the protein immobilization on biochips. The developed material, bearing rabbit-IgG proteins, was arrayed as 150mum spots trapped at the surface of a poly(dimethylsiloxane) elastomer (PDMS), and compared to copoly(DMA-NAS-MAPS)-coated glass slides and latex beads based biochips. Evidences were made through scanning electron microscopy that the newly developed material based microarray exhibited surface irregularities at the submicron level leading to high specific area. The combination of such large immobilization area with the highly efficient protein immobilization of the copoly(DMA-NAS-MAPS) polymer, enabled the achievement of microarrays exhibiting good performances both in pure media and complex samples (human sera). Indeed, high specific/non-specific signal ratio was found using this optimized immobilization procedure. Chemiluminescent detection of anti-rabbit-IgG was obtained through peroxidase labeled antibodies in the 5mug/l to 10mg/l range. Application of the developed system to real samples was achieved for the detection of rheumatoid factor (RF) through a capture assay. Interesting results were obtained, with a RF detection over the 5.3-485IU/ml range and without measurable matrix effect or non-specific signal.

Dithiocarbamate fungicide thiram detection: comparison of bioluminescent and fluorescent whole-cell bioassays based on hsp22 stress promoter induction.

Detection of toxic substances interfering with endocrine system is one of the major preoccupations of the European community. A whole-cell bioassay for pollution detection based on stress induction has been designed. Well characterized toxicants, cadmium chloride and thiram (a dithiocarbamate fungicide), were used to optimize the detection conditions such as time-course conditions, cell line and reporter gene to be used. HeLa cells containing the firefly luciferase (luc) reporter gene under the control of the Drosophila melanogaster hsp22 promoter were compared to liver cells (HepG2) containing the same stress gene promoter fused either to the luc or the EGFP (Enhanced-Green Fluorescent Protein) gene. The sensitivity of the obtained bioassay was found to be enhanced by the concomitant use of liver cells and EGFP reporter gene. The detection limits of the toxicants were then lowered from 1 to 0.1 microM and from 1 to 0.01 microM for CdCl(2) and thiram, respectively.

DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences.

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.

Chemical stress sensitive luminescent human cells: molecular biology approach using inducible Drosophila melanogaster hsp22 promoter.

A whole-cell bioassay has been developed for the total toxicity testing of liquid samples. The method is based on the induction of the bioluminescent activity of genetically manipulated mammalian cells. For that purpose, transfection was used to introduce, in HeLa cells, a DNA sensing element that responds to chemical stress agents (heavy metals, genotoxic agents, and endocrine-disrupting chemicals). Such element was designed to direct the expression of a reporting gene (firefly luciferase) through the activation of Drosophila melanogaster hsp22 promoter. A molecular approach was conducted to optimize hsp22 promoter element in order to decrease the background expression level of the reporting gene and to increase the sensitivity of the bioassay for testing endocrine disruptors. As a result, in the presence of 20-100 microM cadmium chloride, a 6-fold increase in luciferase expression was obtained using a specially designed truncated hsp22 promoter construction. The following chemicals known to be found in the polluted samples were tested: CdCl2, Cd(NO3)2, NaAsO2, alachlore, fentine acetate, thiram, and maneb. The stressing effect of each of them was sensitively detected by the present bioassay in the 0.05-50 microM concentration range.

Electrogenerated chemiluminescence of luminol for oxidase-based fibre-optic biosensors.

The luminol electrochemiluminescence has been exploited for the development of several fibre-optic biosensors allowing the detection of hydrogen peroxide and of substrates of H(2)O(2)-producing oxidases. Electro-optical flow injection analysis of glucose, lactate, cholesterol and choline are thus described. To perform the experiments, a glassy carbon electrode was polarized at a fixed potential. Luminol was then electrochemically oxidized and could react in the presence of hydrogen peroxide to produce light. Several parameters had to be optimized to obtain reliable optical biosensors. An optimum applied potential of +425 mV between the glassy carbon electrode and the platinum pseudo-reference electrode was determined, allowing the best signal: noise ratio to be obtained. It was also necessary to optimize the experimental conditions for the immobilization of the different oxidases involved (preactivated membranes, chemically activated collagen membranes, photopolymerized matrix). For each biosensor developed, the optimum reaction conditions have been studied: buffer composition, pH, temperature, flow rate and luminol concentration. Under optimal conditions, the detection limits (S/N = 3) were 30 pmol, 60 pmol, 0.6 nmol and 10 pmol for lactate, glucose, cholesterol and choline, respectively. The miniaturization of electrochemiluminescence-based biosensors has been realized using screen-printed electrodes instead of a glassy carbon macroelectrode, with choline oxidase as a model H(2)O(2)-generating oxidase.

Ultrasonic methodology coupled to ATP bioluminescence for the non-invasive detection of fouling in food processing equipment--validation and application to a dairy factory.

The use of an ultrasonic apparatus (40 kHz) for the non-destructive, rapid and reproducible removal of biofilm from standard materials (stainless steel and polypropylene) in a dairy factory was investigated. The application of ultrasound with the tested conditions (10 s and 40 kHz) was found not to be detrimental for standard ATP (concentration ranging between 5 x 10(-9) and 10(-5) mol 1(-1)) and for prokaryotic cells, including both rods and coccoid-shaped bacteria (Escherichia coli and Staphylococcus aureus). It allowed the use of the ATP bioluminescence measurement for quantifying the biofilm removal. The repeatability of industrial milk removal was determined on fouled stainless steel and polypropylene sheets. The variability of the results with the sonication method was constant, +/-24% (coefficient of variation) for both surfaces, and was variable with the swabbing method, +/-42% for the stainless steel sheet and +/-74% for the polypropylene sheet. The ultrasonic apparatus removed twice the amount of industrial milk biofilm compared with the swabbing method in the case of the polypropylene sheets. The apparatus was used to validate the industrial cleaning protocols of a milk factory.

An electrochemiluminescence-based fibre optic biosensor for choline flow injection analysis.

A fibre optic biosensor based on luminol electrochemiluminescence (ECL) integrated in a flow injection analysis (FIA) system was developed for the detection of choline. The electrochemiluminescence of luminol was generated by a glassy carbon electrode polarised at +425 mV vs. a platinum pseudo-reference electrode. Choline oxidase (Chx) was immobilised either covalently on polyamide (ABC type) or on UltraBind preactivated membranes, or by physical entrapment in a photo-cross-linkable poly(vinyl alcohol) polymer (PVA-SbQ) alone or after absorption on a weak anion exchanger, DEAE (diethylaminoethyl) Sepharose. The optimisation of the reaction conditions and physicochemical parameters influencing the FIA biosensor response demonstrated that the choline biosensor exhibited the best performances in a 30 mM veronal buffer containing 30 mM KCl and 1.5 mM MgCl2, at pH 9. The use of a 0.5 ml min-1 flow rate enabled the measurement of choline by the membrane-based ECL biosensors in 8 or 5 min, with ABC or UltraBind membranes, respectively, whereas the measurement required only 3 min with the DEAE-PVA system. For comparison, the detection of choline was performed with Chx immobilised using the four different supports. The best performances were obtained with the DEAE-PVA-Chx sensing layer, which allowed a detection limit of 10 pmol, whereas with the ABC, the UltraBind and the PVA systems, the detection limits were 300 pmol, 75 pmol and 220 pmol, respectively. The DEAE-based system also exhibited a good operational stability since 160 repeated measurements of 3 nmol of choline could be performed with an RSD of 4.5% whereas the stability under the best conditions was 45 assays with the other supports.

The development of an ultrasonic apparatus for the noninvasive and repeatable removal of fouling in food processing equipment.

A new ultrasonic apparatus operating at a frequency of 40 kHz was developed to dislodge biofilms from food processing equipment in order to assess the effectiveness of cleaning protocols. Sonication conditions to remove biofilms and quantification by ATP-bioluminescence are described. An industrial meat process was developed at the laboratory level to form a biofilm with industrial characteristics. Our results show that the biofilm removal by sonication during 10 s is reproducible and four times greater compared to the swabbing method (83% removal of fouling material against 20%). Unlike the swabbing method, this ultrasonic apparatus permitted the immediately demonstration of the inefficiency (within 1 min) of an industrial meat cleaning protocol. This apparatus is portable, easy to use and can be operated by unskilled users.

Chemiluminescent choline biosensor using histidine-modified peroxidase immobilised on metal-chelate substituted beads and choline oxidase immobilised on anion-exchanger beads co-entrapped in a photocrosslinkable polymer.

A novel sensing layer design is presented based on the non-covalent immobilisation of enzymes on derivatized Sepharose beads subsequently entrapped in PVA-SbQ photopolymer. Two different modified Sepharose beads were used, IDA- and DEAE-Sepharose, for the immobilisation, respectively, of horseradish peroxidase (HRP) modified with histidine, and choline oxidase (Chx). The HRP-IDA-Sepharose-based sensing layer was used in a flow injection analysis chemiluminescent system as the basis of an H2O2 biosensor. It was shown that the pre-immobilisation on IDA-Sepharose beads enhanced the sensing layer stability and enabled the immobilisation of a larger amount of enzyme. A 1.8 mg charge of HRP-IDA-Sepharose beads in the sensing layer produced the most sensitive H2O2 biosensor. Such an analytical system exhibited very good performances, with a cycle time of 2 min and a detection limit of 15 pmol (detection ranging over four decades at least), and an unusual long operational stability of 200 measurements (CV, 3.5%). The HRP-IDA-Sepharose beads were then combined with Chx-DEAE-Sepharose. With this modified Sepharose-based biosensor the limit of detection for choline (S/N, 3) was equal to 0.5 pmol and the working range was 0.35 pmol-10 nmol. Moreover, the cycle time was only 2.5 min with the new sensing layer, and a long operational stability of 150 successive assays was found, with a variation coefficient of 2.6%.

Fiberoptic biosensors based on chemiluminescent reactions.

The chemiluminescence of luminol in the presence of H2O2 has been exploited to develop fiberoptic biosensors associated with flow injection analysis systems. A chlorophenol sensor was developed based on the ability of certain halophenols to enhance the peroxidase-catalyzed luminol chemiluminescence. Horseradish peroxidase immobilized on a collagen membrane was used. Ten chlorophenols have been tested with this chemiluminescent-based sensor. The lower detection limit was obtained with 4-chloro-3-methylphenol and was equal to 0.01 microM. Electrochemiluminescent-based fiberoptic biosensors for glucose and lactate were also developed using glucose oxidase or lactate oxidase immobilized on polyamide membranes. In the presence of oxidase-generated H2O2, the light emission was triggered electrochemically by means of a glassy carbon electrode polarized at +425 mV vs a platinum pseudo-reference electrode. The detection limits for glucose and lactate were 150 and 60 pmol, respectively, and the dynamic ranges were linear from 150 pmol to 600 nmol and from 60 pmol to 60 nmol, respectively.

Regenerable immunobiosensor for the chemiluminescent flow injection analysis of the herbicide 2,4-D.

A semi-automated chemiluminescent competitive immunosensor for the herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) is presented. Anti-2,4-D polyclonal antibodies are directly labelled with horseradish peroxidase allowing a p-iodophenol enhanced chemiluminescent detection. Using antigen immobilised on UltraBind type pre-activated membranes, the 2,4-D immunosensor exhibits low non-specific/specific binding ratio (maximum ratio: 5%) of the labelled antibodies. The quantification of free 2,4-D in water is performed by co-injecting the sample and the labelled antibodies in the flow system, incubating this solution with the antigen immobilised membrane and measuring the amount of specifically bound labelled antibodies. Such an analytical system enables the detection of 4 mug l(-1) of free antigen in 20 min, and the 2,4-D detection is possible in the range 4 mug l(-1)-160 mg l(-1). The immunosensor can be regenerated by simply flowing a chaotropic solution (0.1 M HCl, 0.1 M NaCl, 0.1 M glycine) in the system. This regeneration ability enables the achievement of more than 30 measurement cycles of free 2,4-D with the same antigen immobilised membrane with a good reproducibility (RSD=12.5%).

Luciferin incorporation in the structure of acrylic microspheres with subsequent confinement in a polymeric film: A new method to develop a controlled release-based biosensor for ATP, ADP and AMP.

The controlled release of coreactants at the sensing tip of a biosensor is a possible approach to develop self-contained devices. For luciferin which is a firefly luciferase cosubstrate, a new method of retention is evaluated. The two-step procedure consists of incorporating the substrate in acrylic microspheres during their formation, these last being then confined in a PVA SbQ film. When associated with a compartmentalised trienzymatic sequence (adenylate kinase, creatine kinase and luciferase), such a complex matrix ensures the internal delivery of the cosubstrate in the enzymatic microenvironment at a controlled rate. For the three adenylic nucleotides (ATP, ADP and AMP), the self-containment working time is 3 h of continuous and reproducible assays. The sensitivity of the fibre optic biosensor represents, for ATP, 30% of that obtained when luciferin is supplied in solution whereas for ADP and AMP, the values are about 80% of the reference ones.

Design of bioluminescence-based fiber optic sensors for flow-injection analysis.

A fiber optic sensor based on enzyme-catalyzed light-emitting reactions has been developed and integrated in a flow-injection analysis (FIA) system. The firefly luciferase, specific for ATP, and the bacterial oxidoreductase/luciferase system, specific for NADH, have been immobilized on preactivated polyamide membranes. ATP and NADH analysis could be performed in the range from 0.1 pmol to 3 nmol and from 0.5 pmol to 1 nmol, respectively. By co-immobilizing these two bioluminescence systems on the same membrane, a multi-function biosensor has been designed allowing the alternate determination of ATP or NADH with the same sensitivity as that obtained with the two different mono-functional biosensors. A partly self-contained biosensor has been also developed for the flow injection analysis of NADH. For this purpose, FMN (one of the substrates of the bacterial bienzymatic system) has been embedded in a synthetic matrix. Different supports have been tested for the non-covalent immobilization of this substrate and its release in the immediate vicinity of the bound enzymes. Using a photo-crosslinked poly(vinyl alcohol) support, 40 reliable assays (CV = 4.5%) could be performed without changing or reloading the matrix.

Fibre-optic biosensor based on luminescence and immobilized enzymes: microdetermination of sorbitol, ethanol and oxaloacetate.

We have investigated highly selective and ultrasensitive biosensors based on luminescent enzyme systems linked to optical transducers. A fibre-optic sensor with immobilized enzymes was designed; the solid-phase bioreagent was maintained in close contact contact with the tip of a glass fibre bundle connected to the photomultiplier tube of a luminometer. A bacterial luminescence fibre-optic sensor was used for the microdetermination of NADH. Various NAD(P)-dependent enzymes, sorbitol dehydrogenase, alcohol dehydrogenase and malate dehydrogenase, were co-immobilized on preactivated polyamide membranes with the bacterial system and used for the microdetermination of sorbitol, ethanol and oxaloacetate at the nanomolar level with a good precision.