ABSTRACT
Recent progress on chimeric antigen receptor (CAR)-NK cells has shown promising results in treating CD19-positive lymphoid tumors with minimal toxicities [including graft versus host disease (GvHD) and cytokine release syndrome (CRS) in clinical trials. Nevertheless, the use of CAR-NK cells in combating viral infections has not yet been fully explored. Previous studies have shown that CAR-NK cells expressing S309 single-chain fragment variable (scFv), hereinafter S309-CAR-NK cells, can bind to SARS-CoV-2 wildtype pseudotyped virus (PV) and effectively kill cells expressing wild-type spike protein in vitro. In this study, we further demonstrate that the S309-CAR-NK cells can bind to different SARS-CoV-2 variants, including the B.1.617.2 (Delta), B.1.621 (Mu), and B.1.1.529 (Omicron) variants in vitro. We also show that S309-CAR-NK cells reduce virus loads in the NOD/SCID gamma (NSG) mice expressing the human angiotensin-converting enzyme 2 (hACE2) receptor challenged with SARS-CoV-2 wild-type (strain USA/WA1/2020). Our study demonstrates the potential use of S309-CAR-NK cells for inhibiting infection by SARS-CoV-2 and for the potential treatment of COVID-19 patients unresponsive to otherwise currently available therapeutics. IMPORTANCE: Chimeric antigen receptor (CAR)-NK cells can be "off-the-shelf" products that treat various diseases, including cancer, infections, and autoimmune diseases. In this study, we engineered natural killer (NK) cells to express S309 single-chain fragment variable (scFv), to target the Spike protein of SARS-CoV-2, hereinafter S309-CAR-NK cells. Our study shows that S309-CAR-NK cells are effective against different SARS-CoV-2 variants, including the B.1.617.2 (Delta), B.1.621 (Mu), and B.1.1.529 (Omicron) variants. The S309-CAR-NK cells can (i) directly bind to SARS-CoV-2 pseudotyped virus (PV), (ii) competitively bind to SARS-CoV-2 PV with 293T cells expressing the human angiotensin-converting enzyme 2 (hACE2) receptor (293T-hACE2 cells), (iii) specifically target and lyse A549 cells expressing the spike protein, and (iv) significantly reduce the viral loads of SARS-CoV-2 wild-type (strain USA/WA1/2020) in the lungs of NOD/SCID gamma (NSG) mice expressing hACE2 (hACE2-NSG mice). Altogether, the current study demonstrates the potential use of S309-CAR-NK immunotherapy as an alternative treatment for COVID-19 patients.
Subject(s)
Angiotensin-Converting Enzyme 2 , COVID-19 , Killer Cells, Natural , Receptors, Chimeric Antigen , SARS-CoV-2 , Spike Glycoprotein, Coronavirus , Viral Load , Animals , SARS-CoV-2/immunology , Killer Cells, Natural/immunology , Angiotensin-Converting Enzyme 2/metabolism , Angiotensin-Converting Enzyme 2/genetics , Angiotensin-Converting Enzyme 2/immunology , Mice , Humans , Receptors, Chimeric Antigen/immunology , Receptors, Chimeric Antigen/genetics , Receptors, Chimeric Antigen/metabolism , COVID-19/immunology , COVID-19/virology , COVID-19/therapy , Spike Glycoprotein, Coronavirus/immunology , Spike Glycoprotein, Coronavirus/genetics , Spike Glycoprotein, Coronavirus/metabolism , Single-Chain Antibodies/immunology , Single-Chain Antibodies/genetics , Mice, SCID , Mice, Inbred NODABSTRACT
Hyperandrogenism and polycystic ovarian syndrome result from the imbalance or increase of androgen levels in females. Androgen receptor (AR) mediates the effects of androgens, and this study examines whether neuronal AR plays a role in reproduction under normal and increased androgen conditions in female mice. The neuron-specific AR knockout (KO) mouse (SynARKO) was generated from a female mouse (synapsin promoter driven Cre) and a male mouse (Ar fl/y). Puberty onset and the levels of reproductive hormones such as LH, FSH, testosterone, and estradiol were comparable between the control and the SynARKO mice. There were no differences in cyclicity and fertility between the control and SynARKO mice, with similar impairment in both groups on DHT treatment. Neuronal AR KO, as in this SynARKO mouse model, did not alleviate the infertility associated with DHT treatment. These studies suggest that neuronal AR KO neither altered reproductive function under physiological androgen levels, nor restored fertility under hyperandrogenic conditions.
Subject(s)
Androgens , Polycystic Ovary Syndrome , Humans , Female , Male , Mice , Animals , Androgens/pharmacology , Receptors, Androgen/genetics , Mice, Knockout , Sexual Maturation , Reproduction/genetics , NeuronsABSTRACT
Hyperandrogenemia and polycystic ovary syndrome are a result of the imbalance of androgen levels in females. Androgen receptor (Ar) mediates the effect of androgen, and this study examines how neuronal Ar in the central nervous system mediates metabolism under normal and increased androgen conditions in female mice. The neuron-specific ARKO mouse (SynARKO) was created from female (Ar fl/wt; synapsin promoter driven Cre) and male (Ar fl/y) mice. A glucose tolerance test revealed impaired glucose tolerance that was partially alleviated in the SynARKO-dihydrotestosterone (DHT) mice compared with Con-DHT mice after 4 months of DHT treatment. Heat production and food intake was higher in Con-DHT mice than in Con-veh mice; these effects were not altered between SynARKO-veh and SynARKO-DHT mice, indicating that excess androgens may partially alter calorie intake and energy expenditure in females via the neuronal Ar. The pAkt/Akt activity was higher in the hypothalamus in Con-DHT mice than in Con-veh mice, and this effect was attenuated in SynARKO-DHT mice. Western blot studies show that markers of inflammation and microglia activation, such as NF-kB p-65 and IBA1, increased in the hypothalamus of Con-DHT mice compared with Con-veh. These studies suggest that neuronal Ar mediates the metabolic impacts of androgen excess in females.
ABSTRACT
Loss of function in transport protein particles (TRAPP) links a new set of emerging genetic disorders called "TRAPPopathies". One such disorder is NIBP syndrome, characterized by microcephaly and intellectual disability, and caused by mutations of NIBP/TRAPPC9, a crucial and unique member of TRAPPII. To investigate the neural cellular/molecular mechanisms underlying microcephaly, we developed Nibp/Trappc9-deficient animal models using different techniques, including morpholino knockdown and CRISPR/Cas mutation in zebrafish and Cre/LoxP-mediated gene targeting in mice. Nibp/Trappc9 deficiency impaired the stability of the TRAPPII complex at actin filaments and microtubules of neurites and growth cones. This deficiency also impaired elongation and branching of neuronal dendrites and axons, without significant effects on neurite initiation or neural cell number/types in embryonic and adult brains. The positive correlation of TRAPPII stability and neurite elongation/branching suggests a potential role for TRAPPII in regulating neurite morphology. These results provide novel genetic/molecular evidence to define patients with a type of non-syndromic autosomal recessive intellectual disability and highlight the importance of developing therapeutic approaches targeting the TRAPPII complex to cure TRAPPopathies.
Subject(s)
Intellectual Disability , Microcephaly , Animals , Mice , Intellectual Disability/genetics , Intellectual Disability/metabolism , Microcephaly/genetics , Microcephaly/metabolism , Neurites/physiology , Neurons/metabolism , ZebrafishABSTRACT
The brain is one of the important reservoir sites for HIV persistent/latent infection that often leads to HIV-associated neurocognitive disorders (HAND). However, HIV dynamics in the brain is an understudied area and little is known about mechanisms underlying the development and progression of HAND. This issue is mainly due to the lack of suitable in vitro models that can recapitulate the cellular and molecular complexity of the human brain. Hence, there is an urgent need for such models to study HIV neuropathogenesis and to develop therapeutics for HAND. The emergence of three-dimensional (3D) brain organoids generated from induced pluripotent stem cells (iPSCs) has now provided a clinically relevant in vitro model to study HIV brain infection and neuropathogenesis. Recently, there have been a noticeable number of publications that demonstrate the feasibility and advantages of this model for studies of neurobiology and brain disorders as well as HIV infection. Here, we describe the development of iPSC-derived human microglia-containing brain organoids, including advantages/challenges, and focus on their applicability for modeling HIV brain infection.
Subject(s)
HIV Infections , Induced Pluripotent Stem Cells , Humans , Brain/pathology , OrganoidsABSTRACT
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
Subject(s)
COVID-19 , Viral Vaccines , Humans , SARS-CoV-2/genetics , Signal Transduction , RNA, Messenger/geneticsABSTRACT
Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.S) are effective in preventing SARS-CoV-2 infection and alleviating COVID-19 illness, they have different efficacy against COVID-19. It is unclear whether the differences are due to varying ability of the vaccines to elicit a specific IgG antibody response and neutralization activity against spike protein of the virus. In this study, we compared the plasma IgG and neutralization titers against spike proteins of wild-type SARS-CoV-2 and eight variants in healthy subjects who received the mRNA-1273, BNT162b2 or Ad26.COV2.S vaccine. We demonstrated that subjects vaccinated with Ad26.COV2.S vaccine had significantly lower levels of IgG and neutralizing titers as compared to those who received the mRNA vaccines. While the linear regression analysis showed a positive correlation between IgG levels and neutralizing activities against SARS-CoV-2 WT and the variants, there was an overall reduction in neutralizing titers against the variants in subjects across the three groups. These findings suggest that people who received one dose of Ad26.COV2.S vaccine have a more limited IgG response and lower neutralization activity against SARS-CoV-2 WT and its variants than recipients of the mRNA vaccines. Thus, monitoring the plasma or serum levels of anti-SARS-CoV-2 spike IgG titer and neutralization activity is necessary for the selection of suitable vaccines, vaccine dosage and regimens.
ABSTRACT
Adeno-associated virus (AAV)-mediated genetic targeting of microglia remains a challenge. Overcoming this hurdle is essential for gene editing in the central nervous system (CNS). Here, we characterized the minimal/native promoter of the HEXB gene, which is known to be specifically and stably expressed in the microglia during homeostatic and pathological conditions. Dual reporter and serial deletion assays identified the critical role of the natural 5' untranslated region (-97 bp related to the first ATG) in driving transcriptional activity of the mouse Hexb gene. The native promoter region of mouse, human, and monkey HEXB are located at -135, -134, and -170 bp to the first ATG, respectively. These promoters were highly active and specific in microglia with strong cross-species transcriptional activities, but did not exhibit activity in primary astrocytes. In addition, we identified a 135 bp promoter of CD68 gene that was highly active in microglia but not in astrocytes. Considering that HEXB is specifically expressed in microglia, these data suggest that the newly characterized microglia-specific HEXB minimal/native promoter can be an ideal candidate for microglia-targeting AAV gene therapy in the CNS.
Subject(s)
2019-nCoV Vaccine mRNA-1273/immunology , Antibodies, Neutralizing/immunology , Antibodies, Viral/immunology , BNT162 Vaccine/immunology , COVID-19/immunology , Immunoglobulin G/immunology , SARS-CoV-2/immunology , Spike Glycoprotein, Coronavirus/immunology , 2019-nCoV Vaccine mRNA-1273/administration & dosage , BNT162 Vaccine/administration & dosage , COVID-19/blood , COVID-19/genetics , COVID-19/prevention & control , Female , Humans , Male , SARS-CoV-2/genetics , SARS-CoV-2/metabolism , Spike Glycoprotein, Coronavirus/geneticsABSTRACT
BACKGROUND: As the COVID-19 pandemic rages on, the new SARS-CoV-2 variants have emerged in the different regions of the world. These newly emerged variants have mutations in their spike (S) protein that may confer resistance to vaccine-elicited immunity and existing neutralizing antibody therapeutics. Therefore, there is still an urgent need of safe, effective, and affordable agents for prevention/treatment of SARS-CoV-2 and its variant infection. RESULTS: We demonstrated that green tea beverage (GTB) or its major ingredient, epigallocatechin gallate (EGCG), were highly effective in inhibiting infection of live SARS-CoV-2 and human coronavirus (HCoV OC43). In addition, infection of the pseudoviruses with spikes of the new variants (UK-B.1.1.7, SA-B.1.351, and CA-B.1.429) was efficiently blocked by GTB or EGCG. Among the 4 active green tea catechins at noncytotoxic doses, EGCG was the most potent in the action against the viruses. The highest inhibitory activity was observed when the viruses or the cells were pre-incubated with EGCG prior to the infection. Mechanistic studies revealed that EGCG blocked infection at the entry step through interfering with the engagement of the receptor binding domain (RBD) of the viral spikes to angiotensin-converting enzyme 2 (ACE2) receptor of the host cells. CONCLUSIONS: These data support further clinical evaluation and development of EGCG as a novel, safe, and cost-effective natural product for prevention/treatment of SARS-CoV-2 transmission and infection.
ABSTRACT
Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab.
ABSTRACT
Patients with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection manifest mainly respiratory symptoms. However, clinical observations frequently identified neurological symptoms and neuropsychiatric disorders related to COVID-19 (Neuro-SARS2). Accumulated robust evidence indicates that Neuro-SARS2 may play an important role in aggravating the disease severity and mortality. Understanding the neuropathogenesis and cellular mechanisms underlying Neuro-SARS2 is crucial for both basic research and clinical practice to establish effective strategies for early detection/diagnosis, prevention, and treatment. In this review, we comprehensively examine current evidence of SARS-CoV-2 infection in various neural cells including neurons, microglia/macrophages, astrocytes, pericytes/endothelial cells, ependymocytes/choroid epithelial cells, and neural stem/progenitor cells. Although significant progress has been made in studying Neuro-SARS2, much remains to be learned about the neuroinvasive routes (transneuronal and hematogenous) of the virus and the cellular/molecular mechanisms underlying the development/progression of this disease. Future and ongoing studies require the establishment of more clinically relevant and suitable neural cell models using human induced pluripotent stem cells, brain organoids, and postmortem specimens.
Subject(s)
Brain/virology , COVID-19/pathology , Nervous System Diseases/virology , Neuroglia/virology , Neurons/virology , Animals , Brain/pathology , Cell Line , Humans , Nervous System Diseases/pathology , Neural Stem Cells , Neuroglia/pathology , Neurons/pathologyABSTRACT
NFκB signaling and protein trafficking network play important roles in various biological and pathological processes. NIK-and-IKK2-binding protein (NIBP), also known as trafficking protein particle complex 9 (TRAPPC9), is a prototype member of a novel protein family, and has been shown to regulate both NFκB signaling pathway and protein transport/trafficking. NIBP is extensively expressed in the nervous system and plays an important role in regulating neurogenesis and neuronal differentiation. NIBP/TRAPPC9 mutations have been linked to an autosomal recessive intellectual disability syndrome, called NIBP Syndrome, which is characterized by nonsyndromic autosomal recessive intellectual disability along with other symptoms such as obesity, microcephaly, and facial dysmorphia. As more cases of NIBP Syndrome are identified, new light is being shed on the role of NIBP/TRAPPC9 in the central nervous system developments and diseases. NIBP is also involved in the enteric nervous system. This review will highlight the importance of NIBP/TRAPPC9 in central and enteric nervous system diseases, and the established possible mechanisms for developing a potential therapeutic.