Kainate receptors are involved in synaptic plasticity.

The ability of synapses to modify their synaptic strength in response to activity is a fundamental property of the nervous system and may be an essential component of learning and memory. There are three classes of ionotropic glutamate receptor, namely NMDA (N-methyl-D-aspartate), AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole-4-propionic acid) and kainate receptors; critical roles in synaptic plasticity have been identified for two of these. Thus, at many synapses in the brain, transient activation of NMDA receptors leads to a persistent modification in the strength of synaptic transmission mediated by AMPA receptors. Here, to determine whether kainate receptors are involved in synaptic plasticity, we have used a new antagonist, LY382884 ((3S, 4aR, 6S, 8aR)-6-((4-carboxyphenyl)methyl-1,2,3,4,4a,5,6,7,8,8a-decahydro isoquinoline-3-carboxylic acid), which antagonizes kainate receptors at concentrations that do not affect AMPA or NMDA receptors. We find that LY382884 is a selective antagonist at neuronal kainate receptors containing the GluR5 subunit. It has no effect on long-term potentiation (LTP) that is dependent on NMDA receptors but prevents the induction of mossy fibre LTP, which is independent of NMDA receptors. Thus, kainate receptors can act as the induction trigger for long-term changes in synaptic transmission.

Investigation of an outbreak of vancomycin-resistant Enterococcus faecium in a low prevalence university hospital.

BACKGROUND: Until 1995, there were no cases of vancomycin resistant enterococcus (VRE) identified at our university hospital. From May 1995 to August 1996, we investigated a cluster of 10 cases of phenotypic class Van B Enterococcus faecium. METHODS: Patients were matched with controls who were on the same unit for at least 7 days prior to the case developing VRE. Control patients were age and sex matched if possible, and had duration of hospitalization at least as long as the number of days it took the patient to become VRE positive. We analyzed 16 independent risk factors using Epi-info version 6. Environmental cultures were obtained in the MICU where 5 of the patients were located. All 10 patient isolates and environmental isolates were analyzed by pulsed field gel electrophoresis (PFGE). RESULTS: PFGE confirmed the genetic relatedness of all 10 patient isolates and environmental isolates. The VRE-positive group was more likely to be immunosuppressed and to have exposure to 3 physicians. In the MICU, significant, P < 0.05) risk factors for VRE were higher Apache scores, location adjacent to a VRE case, duration of vancomycin and amino-glycoside use, duration of invasive catheter use, and diarrhea. Among the VRE-positive environmental cultures was a blood pressure cuff wash that was used on several patients. CONCLUSION: We hypothesize that a VRE strain was introduced into our hospital environment and was spread by personnel or contaminated equipment. As a consequence of this study, a hospital-wide VRE policy was implemented.

Participation in cooperative learning activities by children with specific language impairment.

This study examined the involvement of children with specific language impairment (SLI) in a cooperative group task. Subjects consisted of 6 target children with SLI (ages 8;10 to 12;5), 6 target children matched for chronological age (CA), and 6 target children with similar language skills (LS). Each target subject interacted with 2 peers of the same age and gender. This resulted in 54 subjects participating in 18 triadic interactions (each involving 1 target subject and 2 partners). Each triad of children worked together to build a cardboard periscope. Verbal and nonverbal collaborative activity were analyzed during the interactions. All members of the CA and LS triads were highly collaborative and worked and talked together while assembling the periscope. Four of the children with SLI played very minor roles in the cooperative work within their triads. Their verbal contributions were limited, and their nonverbal activity was minimal. When children with SLI did collaborate in building the periscope, they performed less specialized tasks than did their partners.

Negotiation skills of children with specific language impairment.

This study examined the ability of 6 children with specific language impairment (SLI), ages 8; 10 to 12;5 (yr; mon) to participate in a negotiation sequence with 2 same-age peers in triadic interactions. Negotiation sequences were analyzed using a system based on Selman's interpersonal negotiation strategies (INS) model (Selman, 1981). The negotiation skills of children with SLI were compared to those of 6 children matched for chronological age (CA) and 6 children of similar language (LS) abilities, participating in the same task. Children with SLI did not produce significantly fewer utterances than the partners with whom they interacted. However, they did produce a significantly smaller percentage of the negotiation strategies produced by their triads. They also used developmentally lower level strategies than either of the partners in their triads. Children interacting within the CA and LS triads did not produce similar differences.

The ability of children with specific language impairment to access and participate in an ongoing interaction.

This study investigated the ability of 6 children with specific language impairment (SLI), ages 8;10 to 12;5 (years; months), to enter and participate in an ongoing dyadic interaction. Performance was compared to that of 6 chronological age-matched (CA) peers and 6 language-similar (LS) peers. All children in the LS and CA groups successfully accessed the interaction, and most did so quickly. Two children from the SLI group did not access, and the 4 remaining subjects required varying amounts of time to access. Following successful access, the triadic interactions of subjects were examined. The accessing children with SLI talked significantly less, were addressed significantly less, and collaborated less than either of the partners within their triads. Few significant differences were observed between LS or CA children and their partners.

Responses to requests for clarification by older and young adults with mental retardation.

This study compared the ability of young (mean chronological age = 29 yrs., SD = 3.67 yrs.) and older adults (chronological age = 63 yrs., SD = 5.54 yrs.) with mild to moderate mental retardation to respond to stacked requests for clarification in conversation. Data were collected in dyadic conversations between subject and investigator. During the course of the conversation, the investigator introduced stacked sequences of three requests for clarification of the same message ("Huh?", "What?", "What?"). Neither group of subjects was as responsive to the requests for clarification as would have been predicted based on their general cognitive and linguistic levels of functioning. Few significant differences were observed between the young and older groups.

Investigations on the mechanisms of methotrexate resistance in a cisplatin-resistant L1210 murine leukemia cell subline.

We report a murine leukemia cell variant (L1210/DDP), selected for cisplatin (DDP) resistance, to be cross-resistant to methotrexate (MTX). Cross-resistance of L1210 cells to DDP and MTX has been observed by others, and has also been recorded in P388 murine leukemia and SSC-25 human squamous carcinoma cells. We demonstrated that MTX resistance is not due to dihydrofolate reductase (DHFR) gene amplification, increased DHFR enzyme activity or decreased MTX binding to the target enzyme. Of the mechanisms commonly proposed for MTX resistance, only differences in transport were observed when comparing sensitive (L1210/0) and resistant (L1210/DDP) cells. Our results suggest that MTX resistance in L1210/DDP cells is due to altered methotrexate uptake.

Transfection of a manganese-containing superoxide dismutase gene into hamster tracheal epithelial cells ameliorates asbestos-mediated cytotoxicity.

To determine if overexpression of manganese-containing SOD (MnSOD) alters cell sensitivity to asbestos, an expression cassette containing murine MnSOD cDNA was cotransfected with pSV2neo, a plasmid conferring resistance to the antibiotic G418, into a diploid cell line of hamster tracheal epithelial (HTE) cells. Pools of G418-resistant transfectants were characterized by Southern and Northern blot analyses and enzyme activity assays. Although increases in MnSOD gene copies in individual cell pools ranged from approximately 7- to 86-fold in comparison to cells transfected with pSV2neo alone, steady-state levels of MnSOD mRNA were increased only by 1.4-to 2.3-fold. Despite modest increases in MnSOD mRNA, significant elevations in MnSOD enzyme activity were observed in pools of G418-resistant cells. MnSOD-transfected cell lines were more resistant to the cytotoxic effects of crocidolite asbestos using a sensitive colony-forming efficiency (CFE) assay. These data show that MnSOD has a direct role in cell defense against asbestos-induced cytotoxicity, an oxidant-dependent process.

Plasmid amplification-promoting sequences from the origin region of Chinese hamster dihydrofolate reductase gene do not promote position-independent chromosomal gene amplification.

Initiation of DNA synthesis occurs with high frequency at oribeta, a region of DNA from the amplified dihydrofolate reductase (DHFR) domain of Chinese hamster CHOC 400 cells that contains an origin of bidirectional DNA replication (OBR). Recently, sequences from DHFR oribeta/OBR were shown to stimulate amplification of cis-linked plasmid DNA when transfected into murine cells. To test the role of oribeta/OBR in chromosomal gene amplification, linearized plasmids containing these sequences linked to a DHFR expression cassette were introduced into DHFR- CHO DUKX cells. After selection for expression of DHFR, cell lines that contain a single integrated, unrearranged copy of the linearized expression plasmid were identified and exposed to low levels of the folate analog, methotrexate (MTX). Of seven clonal cell lines containing the vector control, three gained resistance to MTX by 5 to 15-fold amplification of the integrated marker gene. Of 16 clonal cell lines that contained oribeta/OBR linked to a DHFR mini-gene, only 6 gained resistance to MTX by gene amplification. Hence, sequences from the DHFR origin region that stimulate plasmid DNA amplification do not promote amplification of an integrated marker gene in all chromosomal contexts. In addition to showing that chromosomal position has a strong influence on the frequency of gene amplification, these studies suggest that the mechanism that mediates the experiment of episomal plasmid DNA does not contribute to the early steps of chromosomal gene amplification.

Comparison of MIDI Sherlock system and pulsed-field gel electrophoresis in characterizing strains of methicillin-resistant Staphylococcus aureus from a recent hospital outbreak.

An outbreak of methicillin-resistant Staphylococcus aureus infections at the University of Utah Health Sciences Center occurred over a 7-month period. While the isolates phenotypically appeared to be similar in gross morphology and have similar Vitek antibiotic susceptibility patterns, two additional methods of strain characterization were evaluated to enhance the epidemiological investigation: pulsed-field gel electrophoresis and gas chromatography with the MIDI Sherlock system. Sherlock uses gas chromatography to qualitatively and quantitatively analyze the cellular fatty acid composition of organisms and creates two-dimensional plots based on principal-component analysis to define groups of closely related organisms. All isolates were also evaluated by digesting their chromosomal DNAs with the low-frequency-cutting enzyme SmaI and separating the restriction fragments by contour-clamped homogeneous electric field gel electrophoresis. Sample preparation for this pulsed-field gel electrophoresis included a novel cell lysis procedure involving achromopeptidase, greatly reducing the turnaround time. Isolates tested were recovered from the following: 45 suspected outbreak patients, 6 hospitalized patients believed to be unrelated to the outbreak, 6 patients from outside the hospital, and one health care practitioner implicated in the outbreak. Of 45 phenotypically similar suspect strains, 43 clustered tightly on the Sherlock two-dimensional plot. All outbreak patient isolates were also identical by pulsed-field gel electrophoresis with the exception of the same two outliers identified by Sherlock. In this epidemiologic investigation, we found an excellent correlation between the Sherlock and pulsed-field gel electrophoresis results for strain characterization of methicillin-resistant S. aureus.

Ability of institutionalized and community-based adults with retardation to respond to questions in an interview context.

This study examined the ability of adults with mild and moderate levels of retardation to respond to simple and complex questions. The sample consisted of 20 subjects living in an institutional setting and 20 subjects living in the community. A 30-minute language sample, structured as a job interview, was elicited from each subject by an investigator. During the interview, the investigator asked a number of questions interspersed within the conversation. Two levels of questions were presented: simple and complex. Ten questions were presented at each level. Responses were scored in terms of how informative and truthful the subject was (specific scoring conventions were based upon the work of Grice, 1975). The community group produced a significantly greater number of appropriate answers to both simple and complex questions than did the institutional group. Group differences were observed along both parameters of informativeness and truthfulness.

Comprehension monitoring skills of adults with mental retardation.

The ability of 30 adults with mild and moderate levels of mental retardation to monitor their comprehension while performing a direction-following task was examined. Subjects were "employed" to aid the investigator in compiling objects for gift bags. The task consisted of 60 directions (e.g., "Give me a blue pencil"), of which 6 contained trouble sources (ambiguous directions, unintelligible words, and compliance problems). Each subject's response to the directions involving trouble sources was scored to determine if the subject (a) demonstrated effective comprehension monitoring (as indicated by an immediate awareness of the problem and effective attempt to rectify the problem), (b) requested clarification after attempting to comply with the direction and being unable to do so, (c) demonstrated ineffective comprehension monitoring (as indicated by an awareness of the problem but an ineffective means of dealing with it), or (d) showed no awareness of the trouble source. The ability of subjects to monitor comprehension varied with type of trouble source. Ambiguous trouble sources were the most difficult for the subjects to detect, and compliance-problem trouble sources were the most frequently identified.

The transactivator proteins VP16 and GAL4 bind replication factor A.

Many transcription factors can activate the initiation of DNA replication. We have used affinity chromatography to show that the acidic activation domains of the transcription factors VP16, GAL4, and p53 each bind selectively to human and yeast replication factor A (RPA). The binding is direct and to the largest subunit of the trimeric RPA complex, RPA-1. Mutations in VP16 that reduce the ability of GAL4-VP16 to activate polyomavirus DNA replication also compromise the binding of VP16 to RPA. We suggest that transcription factors may interact with RPA either to stabilize single-stranded DNA at a replication origin or to recruit DNA polymerase alpha to the replication initiation complex.

Responses to requests for conversational repair by adults with mental retardation.

This study focused on adjustments made in conversation in response to listener feedback. Subjects consisted of 22 community-based and 22 institutionalized adults with mental retardation individually matched for full-scale IQ. For each subject, data were collected in a dyadic conversation with an investigator. During the course of the conversation, the investigator introduced stacked sequences of three requests for clarification of the same message ("Huh?" "What?" "What?"). Each subject's responses to these requests were analyzed. Results indicated that community-based subjects used certain sophisticated repair strategies more often than did their institutionalized peers. However, neither group of subjects was as responsive to the requests for clarification as would have been predicted considering their general levels of intellectual and linguistic functioning.

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.

Responses to requests for clarification by linguistically normal and language-impaired children in conversation.

This study compared the conversational repair strategies employed by 8 language-impaired children (mean chronological age 9:2 years) and their linguistically normal age- and language-matched peers in response to a stacked series of requests for clarification. A 30-min language sample was elicited by an adult examiner from each of the subjects. During the course of the conversation, the examiner initiated 10 stacked request for clarification sequences. Each sequence consisted of three different neutral requests for clarification (Huh?, What?, and I didn't understand that.) and the subject's response to each request. All of the subjects appeared to recognize the obligatory nature of the neutral clarification requests employed. However, there were differences noted in the performance of the three groups. These included differences related to language maturity as well as differences specific to language condition.

The ability of normal and language-impaired children to produce grammatical corrections.

The ability of normal and language-impaired children to correct grammatical violations of word order was examined. Ten language-impaired and 10 linguistically normal subjects were sampled from the following age levels: 6, 7, 8, 9, and 10 years, resulting in a total of 100 subjects. Using a procedure designed to focus attention on language form, each of the children performed a task requiring the correction of 10 sentences containing word order errors. Normal 6-, 7-, and 8-year-olds performed significantly better than their language-impaired age-matched peers. In addition, the performance of language-impaired 9-, and 10-year-olds was superior to that of the younger impaired groups. In the normal groups, the only age level differences were produced by the 6-year-olds, who performed significantly more poorly than two of the older (8- and 10-year-old) groups.

Responses to requests for clarification in linguistically normal and language-impaired children.

This study compared the conversational repair strategies employed by language-impaired and normal children in response to a stacked series of requests for clarification. Ten linguistically normal and 10 language-impaired children were sampled from each of the following age levels, 4:10-5:10, 6:10-7:10, and 8:10-9:10, resulting in a total of 60 subjects. Each subject was asked to describe a series of action pictures for an examiner who was seated behind a screen. At regular intervals, the examiner responded to the child's description by initiating a repair sequence. Each sequence consisted of three different neutral requests for clarification ("Huh?", "What?", and "I didn't understand that.") and the subject's response to each request. Although all subjects appeared to recognize the obligatory nature of the neutral clarification requests employed, differences were observed in the repair strategies used by normal and language-impaired children. In addition, impaired and younger normal subjects had greater difficulty responding appropriately as the stacked sequence progressed.

Development of conversational repair strategies in response to requests for clarification.

Conversational repair sequences are an important aspect of communicative interaction. These sequences may occur in the event of communication failure if a listener requests clarification of a previous aspect of the speaker's message. The purpose of this study was to investigate the repair strategies employed in conversation by children at four age levels. Ten linguistically normal children were sampled from each of the following age levels: 2:7 to 3:10, 4:10 to 5:10, 6:10 to 7:10, and 8:10 to 9:10 (years:months), resulting in a total of 40 subjects. Each subject was asked to describe a series of action pictures for an examiner who was seated behind a screen. At regular intervals, the examiner responded to the child's description by initiating a stacked repair sequence. Results indicated that subjects at all age levels complied with the initial request for clarification the majority of the time. However, with increasing age, subjects became more adept at handling the stacked sequence of requests for clarification. Older children were more responsive to the requests, and 9-year-old subjects demonstrated a wider range of strategies in providing repairs.

Elementary school age children's comprehension of specific idiomatic expressions.

This study explored the ability of elementary school age children to comprehend six idiomatic expressions. Eighty linguistically normal children, 20 from each of four different grade levels (kindergarten, second grade, fourth grade, and sixth grade) participated as subjects. All of the children completed a task designed to probe comprehension of specific idioms. A short story was presented, after which the subjects were required to identify events in the story, which were described using idiomatic phrases. When examined as a group, comprehension of the idioms studied improved with increasing age. However, when examined individually, performance was found to be highly variable from idiom to idiom. These results are discussed with regard to clinical implications in the assessment and management of language-disordered children.